dynabeads m 270 streptavidin coated magnetic beads  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Dynabeads M 270 Streptavidin
    Description:
    Dynabeads M 270 Streptavidin the gold standard for isolation and handling of biotinylated nucleic acids antibodies or other biotinylated ligands and targets The very high binding affinity of the streptavidin biotin interaction Kd 10 15 is used in a vast number of applications Benefits and features • Direct and fast isolation of any biotinylated molecule• Flexible protocols with gentle and efficient liquid phase reaction kinetics• Very low nonspecific binding of nucleotides and nucleic acids• Very low aggregation in high salt hybridization buffers• Well suited for nucleic acid applications with extreme demands• Low nonspecific binding of small and negatively charged proteins• Production follows a validated process in compliance with cGMP for medical devices• Well suited for automated protocolsAbout Dynabeads M 270 StreptavidinThese uniform and superparamagnetic beads are 2 8 µm in diameter with a monolayer not a multilayer of recombinant streptavidin covalently coupled to the surface This leaves the vast majority of the biotin binding sites sterically available for binding not only of free biotin but also for binding of biotinylated ligands targets They are hydrophilic negatively charged and show rapid liquid phase reaction kinetics Their specific and defined surface allow for efficient capture separation and downstream handling The streptavidin monolayer ensures negligible leakage and the lack of excess adsorbed streptavidin ensures batch consistency and reproducibility of your results ApplicationsOver the past 15 years streptavidin coupled Dynabeads have been used and cited for a very wide variety of applications Examples include direct indirect isolation and downstream handling of nucleic acids proteins peptides and other target molecules Ideal for sequence specific DNA RNA capture in nucleic acid based diagnostics specifically with samples with a high chaotropic salt concentration immunoassays involving small biotinylated antigens and applications that are not compatible with BSA these beads are not blocked with BSA Easily adaptated to automated processes Dynabeads are used on more than 25 000 routine IVD instruments worldwide The product holds high standards with respect to reproducibility both within and between batches and automation ability and drives reliability for your results Binding capacityThe size of the molecule and the biotinylation procedure will affect the binding capacity The capacity also depends on steric availability and charge interaction between bead and molecule and between molecules There are two or three biotin binding sites available for each streptavidin molecule on the surface of the bead after immobilization One mg of Dynabeads M 270 Streptavidin typically binds • 950 pmoles free biotin• 200 pmol biotinylated peptides• 10 µg biotinylated IgG• 10 µg ds DNA• 200 pmol ss oligonucleotides
    Catalog Number:
    65305
    Price:
    None
    Applications:
    ChIP-on-Chip|Chromatin Immunoprecipitation (ChIP)|DNA & RNA Purification & Analysis|DNA Extraction|Immunoprecipitation|Protein Assays and Analysis|Protein Biology|Protein Purification|Protein Purification & Isolation|RNAi, Epigenetics & Non-Coding RNA Research|Sequence-Specific DNA or RNA Purification|Viral RNA⁄DNA Purification|Chromatin Biology
    Category:
    Beads Microspheres
    Buy from Supplier


    Structured Review

    Thermo Fisher dynabeads m 270 streptavidin coated magnetic beads
    Dynabeads M 270 Streptavidin the gold standard for isolation and handling of biotinylated nucleic acids antibodies or other biotinylated ligands and targets The very high binding affinity of the streptavidin biotin interaction Kd 10 15 is used in a vast number of applications Benefits and features • Direct and fast isolation of any biotinylated molecule• Flexible protocols with gentle and efficient liquid phase reaction kinetics• Very low nonspecific binding of nucleotides and nucleic acids• Very low aggregation in high salt hybridization buffers• Well suited for nucleic acid applications with extreme demands• Low nonspecific binding of small and negatively charged proteins• Production follows a validated process in compliance with cGMP for medical devices• Well suited for automated protocolsAbout Dynabeads M 270 StreptavidinThese uniform and superparamagnetic beads are 2 8 µm in diameter with a monolayer not a multilayer of recombinant streptavidin covalently coupled to the surface This leaves the vast majority of the biotin binding sites sterically available for binding not only of free biotin but also for binding of biotinylated ligands targets They are hydrophilic negatively charged and show rapid liquid phase reaction kinetics Their specific and defined surface allow for efficient capture separation and downstream handling The streptavidin monolayer ensures negligible leakage and the lack of excess adsorbed streptavidin ensures batch consistency and reproducibility of your results ApplicationsOver the past 15 years streptavidin coupled Dynabeads have been used and cited for a very wide variety of applications Examples include direct indirect isolation and downstream handling of nucleic acids proteins peptides and other target molecules Ideal for sequence specific DNA RNA capture in nucleic acid based diagnostics specifically with samples with a high chaotropic salt concentration immunoassays involving small biotinylated antigens and applications that are not compatible with BSA these beads are not blocked with BSA Easily adaptated to automated processes Dynabeads are used on more than 25 000 routine IVD instruments worldwide The product holds high standards with respect to reproducibility both within and between batches and automation ability and drives reliability for your results Binding capacityThe size of the molecule and the biotinylation procedure will affect the binding capacity The capacity also depends on steric availability and charge interaction between bead and molecule and between molecules There are two or three biotin binding sites available for each streptavidin molecule on the surface of the bead after immobilization One mg of Dynabeads M 270 Streptavidin typically binds • 950 pmoles free biotin• 200 pmol biotinylated peptides• 10 µg biotinylated IgG• 10 µg ds DNA• 200 pmol ss oligonucleotides
    https://www.bioz.com/result/dynabeads m 270 streptavidin coated magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dynabeads m 270 streptavidin coated magnetic beads - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: For in vitro DNA binding assay, DNA fragments (0.5 kb) were generated by PCR amplification of the plasmid pUC19 using a 5′ biotinylated forward oligonucleotide primer and an unlabeled reverse primer. .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Synthesized:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Preparation of immobilized dsDNA All oligos, including those 5'-biotinylated, 3'-FAM6, and 5'-phosphorylated were synthesized by Integrated DNA Technologies (IDT Inc., IA, USA). .. M-270 Streptavidin Dynabeads (Invitrogen) were washed three times with equal volume 2× B & W buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl).

    DNA Binding Assay:

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: Paragraph title: Protein Purification and in Vitro DNA Binding Assay ... 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Incubation:

    Article Title: Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand
    Article Snippet: After the primer-extension and in order to degrade unused primers, the mix was incubated with Exonuclease I (NEB) as per manufacturer's recommendation. .. The purified extended products were captured with biotin-binding, streptavidin-coated paramagnetic beads (0.2 mg Dynabeads® M-270 Streptavidin, Invitrogen) and washed in B & W buffer as per manufacturer's recommendation.

    Article Title: Intracellular targets of RGDS peptide in melanoma cells
    Article Snippet: .. Precipitation with streptavidin-coated Dynabeads Streptavidin-coated Dynabeads (M-270, 2.8 μm, Dynal) were re-suspended, washed in PBS three times, using a magnetic holder, re-suspended and 1 × 103 pmoles of bt-RGDS, BSA or bt-RGES per mg beads were added, incubated for 1 h at 4°C and washed in PBS for five times. .. Growing SK-MEL-110 were lysed as reported [ ], pre-incubated with 10 μl RGDS as specific competitor (1 mM) and incubated with activated beads, at 4°C overnight with unidirectional mixing.

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). .. Beads were incubated with the lysate overnight at 4 °C with gentle rocking agitation to bind biotinylated proteins.

    Article Title: A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B
    Article Snippet: .. The pooled PCR product (135 µl) was mixed with 34.5 µl of 5 M NaCl and then incubated with 1 mg of Dynabeads® M-270 Streptavidin (Life Technologies) for 10 minutes. .. To separate the ssDNA aptamer candidates from the complementary strand, the beads were incubated for 5 minutes in 50 µl of freshly prepared (daily from a 1 M NaOH stock stored at 4°C) 100 mM NaOH.

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Article Title: Functional Characterization of Alternative and Classical Pathway C3/C5 Convertase Activity and Inhibition Using Purified Models
    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen) were washed once in VBS-T/Mg [Veronal Buffered Saline pH 7.4, 2.5 mM MgCl2 , 0.05% (v/v) Tween]. .. To prepare fully loaded C3b-beads, beads (4 µl/sample) were resuspended in 0.4 ml VBS-T/Mg per sample with C3b-PEG11-biotin (1 µg/ml) and incubated for 1 h at 4°C on roller.

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20. .. After washing with binding buffer containing 50 m m HEPES, pH 7.5, 50 m m potassium chloride, and 5 m m magnesium chloride.

    Article Title: Functional Characterization of Alternative and Classical Pathway C3/C5 Convertase Activity and Inhibition Using Purified Models
    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen) were washed once in PBS-TH [Phosphate Buffered Saline pH 7.4, 0.05% (v/v) Tween, 0.5% HSA]. .. Beads (4 µl/sample) were resuspended in 0.4 ml PBS-TH per sample with 1 µg/ml biotinylated 2,4-dinitrophenol [DNP-PEG2-GSGSGSGK(Biotin)-NH2; 1,186 Da; obtained from Pepscan Therapeutics B.V., The Netherlands] and incubated for 30 min at 4°C on roller.

    Mass Spectrometry:

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: Paragraph title: 2.8 Sample Preparation for Mass Spectrometry ... Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Generated:

    Article Title: Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand
    Article Snippet: The reaction was further purified using the QIAquick Nucleotide Removal Kit (Qiagen, Valencia, CA, USA) to eliminate biotin-mononucleotides and products smaller than 17 bases generated by Exonuclease I digestion. .. The purified extended products were captured with biotin-binding, streptavidin-coated paramagnetic beads (0.2 mg Dynabeads® M-270 Streptavidin, Invitrogen) and washed in B & W buffer as per manufacturer's recommendation.

    Article Title: Comparison of PrASE and Pyrosequencing for SNP Genotyping
    Article Snippet: .. Pyrosequencing Single stranded DNA was generated by the use of immobilization of the biotinylated PCR products to 50 μg of streptavidin coated super paramagnetic beads (Dynabeads M-270, Dynal Biotech, Oslo, Norway) and 1.65 pmol Pyrosequencing primer (Table S1 from ) was hybridized by the use of a Magnatrix 1200 pipetting robot (Magnetic Biosolutions, Stockholm, Sweden) according to the manufacturers' instructions. .. Pyrosequencing was performed according to manufacturer's instructions on a PSQ™ 96 HS instrument (Biotage, Uppsala, Sweden) and analyzed with the accompanying SNP software.

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: For in vitro DNA binding assay, DNA fragments (0.5 kb) were generated by PCR amplification of the plasmid pUC19 using a 5′ biotinylated forward oligonucleotide primer and an unlabeled reverse primer. .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Polymerase Chain Reaction:

    Article Title: A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B
    Article Snippet: .. The pooled PCR product (135 µl) was mixed with 34.5 µl of 5 M NaCl and then incubated with 1 mg of Dynabeads® M-270 Streptavidin (Life Technologies) for 10 minutes. .. To separate the ssDNA aptamer candidates from the complementary strand, the beads were incubated for 5 minutes in 50 µl of freshly prepared (daily from a 1 M NaOH stock stored at 4°C) 100 mM NaOH.

    Article Title: Comparison of PrASE and Pyrosequencing for SNP Genotyping
    Article Snippet: .. Pyrosequencing Single stranded DNA was generated by the use of immobilization of the biotinylated PCR products to 50 μg of streptavidin coated super paramagnetic beads (Dynabeads M-270, Dynal Biotech, Oslo, Norway) and 1.65 pmol Pyrosequencing primer (Table S1 from ) was hybridized by the use of a Magnatrix 1200 pipetting robot (Magnetic Biosolutions, Stockholm, Sweden) according to the manufacturers' instructions. .. Pyrosequencing was performed according to manufacturer's instructions on a PSQ™ 96 HS instrument (Biotage, Uppsala, Sweden) and analyzed with the accompanying SNP software.

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen). .. A second barcoding adaptor was ligated to the enriched 3′ fragments, and the adaptor-ligated cDNA fragments were PCR-amplified, PAGE-purified, and sequenced as described for deepSuperSAGE libraries.

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: For in vitro DNA binding assay, DNA fragments (0.5 kb) were generated by PCR amplification of the plasmid pUC19 using a 5′ biotinylated forward oligonucleotide primer and an unlabeled reverse primer. .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Binding Assay:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Immobilized double stranded DNA preparation involved purification of strepdavidin coated magnetic beads, binding of the biotinylated top strand, and then annealing of the complementary bottom strand. .. M-270 Streptavidin Dynabeads (Invitrogen) were washed three times with equal volume 2× B & W buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl).

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: .. Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen). .. A second barcoding adaptor was ligated to the enriched 3′ fragments, and the adaptor-ligated cDNA fragments were PCR-amplified, PAGE-purified, and sequenced as described for deepSuperSAGE libraries.

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20. .. After washing with binding buffer containing 50 m m HEPES, pH 7.5, 50 m m potassium chloride, and 5 m m magnesium chloride.

    Pull Down Assay:

    Article Title: A biotinylated analog of the spin-trap DMPO for the detection of low abundance protein radicals by mass spectrometry
    Article Snippet: Paragraph title: Pull Down Assay ... The digests were added to streptavidin-coated magnetic beads (Dynabeads M-270; Invitrogen, San Diego, CA).

    Magnetic Beads:

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: .. Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). .. Beads were incubated with the lysate overnight at 4 °C with gentle rocking agitation to bind biotinylated proteins.

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: .. Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Immobilized double stranded DNA preparation involved purification of strepdavidin coated magnetic beads, binding of the biotinylated top strand, and then annealing of the complementary bottom strand. .. M-270 Streptavidin Dynabeads (Invitrogen) were washed three times with equal volume 2× B & W buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl).

    Article Title: A biotinylated analog of the spin-trap DMPO for the detection of low abundance protein radicals by mass spectrometry
    Article Snippet: .. The digests were added to streptavidin-coated magnetic beads (Dynabeads M-270; Invitrogen, San Diego, CA). ..

    Article Title: Functional Characterization of Alternative and Classical Pathway C3/C5 Convertase Activity and Inhibition Using Purified Models
    Article Snippet: .. Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen) were washed once in VBS-T/Mg [Veronal Buffered Saline pH 7.4, 2.5 mM MgCl2 , 0.05% (v/v) Tween]. .. To prepare fully loaded C3b-beads, beads (4 µl/sample) were resuspended in 0.4 ml VBS-T/Mg per sample with C3b-PEG11-biotin (1 µg/ml) and incubated for 1 h at 4°C on roller.

    Article Title: Functional Characterization of Alternative and Classical Pathway C3/C5 Convertase Activity and Inhibition Using Purified Models
    Article Snippet: .. Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen) were washed once in PBS-TH [Phosphate Buffered Saline pH 7.4, 0.05% (v/v) Tween, 0.5% HSA]. .. Beads (4 µl/sample) were resuspended in 0.4 ml PBS-TH per sample with 1 µg/ml biotinylated 2,4-dinitrophenol [DNP-PEG2-GSGSGSGK(Biotin)-NH2; 1,186 Da; obtained from Pepscan Therapeutics B.V., The Netherlands] and incubated for 30 min at 4°C on roller.

    Mutagenesis:

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Detection Assay:

    Article Title: Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand
    Article Snippet: Paragraph title: Primer-anchored DNA damage detection assay ... The purified extended products were captured with biotin-binding, streptavidin-coated paramagnetic beads (0.2 mg Dynabeads® M-270 Streptavidin, Invitrogen) and washed in B & W buffer as per manufacturer's recommendation.

    Labeling:

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: .. Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Purification:

    Article Title: Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand
    Article Snippet: .. The purified extended products were captured with biotin-binding, streptavidin-coated paramagnetic beads (0.2 mg Dynabeads® M-270 Streptavidin, Invitrogen) and washed in B & W buffer as per manufacturer's recommendation. .. To further remove possibly contaminating genomic DNA, samples were incubated for 5 min with 1 ml of 0.5 M NaOH, spun briefly and exposed to a magnetic field to facilitate supernatant removal.

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Immobilized double stranded DNA preparation involved purification of strepdavidin coated magnetic beads, binding of the biotinylated top strand, and then annealing of the complementary bottom strand. .. M-270 Streptavidin Dynabeads (Invitrogen) were washed three times with equal volume 2× B & W buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl).

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: All of the recombinant proteins were purified using glutathione-agarose resin according to the manufacturer's protocol (GE Healthcare). .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Protein Purification:

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: Paragraph title: Protein Purification and in Vitro DNA Binding Assay ... 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Sequencing:

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: Subsequent oligo(dT)-based reverse transcription of both fractions was performed under identical conditions, except for the use of an anchored, biotinylated oligo(dT) primer comprising a barcoding sequence instead of a recognition site for EcoP15I. .. Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen). .. A second barcoding adaptor was ligated to the enriched 3′ fragments, and the adaptor-ligated cDNA fragments were PCR-amplified, PAGE-purified, and sequenced as described for deepSuperSAGE libraries.

    Staining:

    Article Title: A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B
    Article Snippet: Twenty microliters of PCR2 product was loaded onto the gel and visualized by ethidium bromide staining. .. The pooled PCR product (135 µl) was mixed with 34.5 µl of 5 M NaCl and then incubated with 1 mg of Dynabeads® M-270 Streptavidin (Life Technologies) for 10 minutes.

    IA:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Preparation of immobilized dsDNA All oligos, including those 5'-biotinylated, 3'-FAM6, and 5'-phosphorylated were synthesized by Integrated DNA Technologies (IDT Inc., IA, USA). .. M-270 Streptavidin Dynabeads (Invitrogen) were washed three times with equal volume 2× B & W buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl).

    SDS Page:

    Article Title: Intracellular targets of RGDS peptide in melanoma cells
    Article Snippet: Precipitation with streptavidin-coated Dynabeads Streptavidin-coated Dynabeads (M-270, 2.8 μm, Dynal) were re-suspended, washed in PBS three times, using a magnetic holder, re-suspended and 1 × 103 pmoles of bt-RGDS, BSA or bt-RGES per mg beads were added, incubated for 1 h at 4°C and washed in PBS for five times. .. Samples were boiled and separated by SDS-PAGE as described above and incubated with antibody to survivin (1:200), caspase-3 (1:200), caspase-8 (1:200) (Santa Cruz Biotechnology, Alexa, CA), caspase-9 (1:1000) (Pharmingen, San Diego, CA), caspase-1 (1:500) (Alexis, San Diego, CA).

    Plasmid Preparation:

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: For in vitro DNA binding assay, DNA fragments (0.5 kb) were generated by PCR amplification of the plasmid pUC19 using a 5′ biotinylated forward oligonucleotide primer and an unlabeled reverse primer. .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Software:

    Article Title: Comparison of PrASE and Pyrosequencing for SNP Genotyping
    Article Snippet: Pyrosequencing Single stranded DNA was generated by the use of immobilization of the biotinylated PCR products to 50 μg of streptavidin coated super paramagnetic beads (Dynabeads M-270, Dynal Biotech, Oslo, Norway) and 1.65 pmol Pyrosequencing primer (Table S1 from ) was hybridized by the use of a Magnatrix 1200 pipetting robot (Magnetic Biosolutions, Stockholm, Sweden) according to the manufacturers' instructions. .. Pyrosequencing was performed according to manufacturer's instructions on a PSQ™ 96 HS instrument (Biotage, Uppsala, Sweden) and analyzed with the accompanying SNP software.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: One end of the biotinylated DNA was tethered to a streptavidin functionalized surface, and the other end to a streptavidin-coated magnetic bead (Dynabeads® M-270 Streptavidin, Invitrogen). shows the schematic diagram of the magnetic tweezers setup. .. Real time extension measurement of the DNA molecule was recorded using a camera-based centroid tracking software written in LabVIEW program (National Instruments, U.S.A).

    Recombinant:

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: All of the recombinant proteins were purified using glutathione-agarose resin according to the manufacturer's protocol (GE Healthcare). .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Sample Prep:

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: Paragraph title: 2.8 Sample Preparation for Mass Spectrometry ... Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    In Vitro:

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: Preparation of total RNA was performed according to the procedure for preparation of deepSuperSAGE libraries, including separation of the polyadenylated from the non-polyadenylated transcripts, and in vitro polyadenylation of the latter fraction. .. Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen).

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: Paragraph title: Protein Purification and in Vitro DNA Binding Assay ... 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20.

    Protein Binding:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: One end of the biotinylated DNA was tethered to a streptavidin functionalized surface, and the other end to a streptavidin-coated magnetic bead (Dynabeads® M-270 Streptavidin, Invitrogen). shows the schematic diagram of the magnetic tweezers setup. .. This reading is plotted against force in the force-extension curve, and the protein binding is detected by the resulting changes in the force-extension curve.

    Concentration Assay:

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: 2.8 Sample Preparation for Mass Spectrometry Cell pellets were thawed on ice and each pellet was resuspended in 350 μL lysis buffer (1% SDS in 50 mM Tris-HCl (pH 8.0), including 10 mM sodium azide, 10 mM sodium ascorbate, and 2.5 mM Trolox, and the protease inhibitors at a final concentration of 1 mM PMSF, 2 μg/mL leupeptin, 1 μg/mL pepstatin, and 1 μg/mL aprotonin). .. Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    High Throughput Screening Assay:

    Article Title: Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand
    Article Snippet: The purified extended products were captured with biotin-binding, streptavidin-coated paramagnetic beads (0.2 mg Dynabeads® M-270 Streptavidin, Invitrogen) and washed in B & W buffer as per manufacturer's recommendation. .. After this step, extended products were either processed for fingerprinting (mapping) nucleotide damage (f-PADDA) or for high-throughput damage quantification (q-PADDA).

    Lysis:

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: Lysates were boiled at 95 °C for 5 min to dissociate the postsynaptic density (PSD) and diluted with 1400 μL 1.25× RIPA lysis buffer (50 mM Tris, 187.5 mM NaCl, 0.625% sodium deoxycholate, 1.25% Triton X-100) to a final 1× RIPA lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). .. Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Article Title: Alternative RISC assembly: Binding and repression of microRNA-mRNA duplexes by human Ago proteins
    Article Snippet: HeLa cells (10 × 106 to 20 × 106 ) were used for each control pulldown with M-270 Streptavidin dynabeads (Invitrogen) or test pulldown with oligo(dT) dynabeads (Invitrogen). .. Cells were lysed for 15 min at room temperature in 1 mL lysis buffer containing 20 mM Hepes (pH 7.6), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 1× protease inhibitors (Roche), and 0.4 U/μL murine RNase inhibitors (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher streptavidin coated magnetic beads
    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by <t>StreptAvidin-Alexa488)</t> in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.
    Streptavidin Coated Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated magnetic beads - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Journal: Proteomes

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins

    doi: 10.3390/proteomes6040048

    Figure Lengend Snippet: SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Techniques: Labeling, Sequencing, Staining, Expressing

    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ) APEX2 or HRP (image RCSB PDB [ 53 , 54 ] ( www.rcsb.org ) of PDB ID 1HCH [ 54 ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Journal: Proteomes

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins

    doi: 10.3390/proteomes6040048

    Figure Lengend Snippet: SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ) APEX2 or HRP (image RCSB PDB [ 53 , 54 ] ( www.rcsb.org ) of PDB ID 1HCH [ 54 ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Techniques: Labeling, Sequencing, Staining, Expressing