dynabeads m 270 streptavidin coated magnetic beads  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Dynabeads M 270 Streptavidin
    Description:
    Dynabeads M 270 Streptavidin the gold standard for isolation and handling of biotinylated nucleic acids antibodies or other biotinylated ligands and targets The very high binding affinity of the streptavidin biotin interaction Kd 10 15 is used in a vast number of applications Benefits and features • Direct and fast isolation of any biotinylated molecule• Flexible protocols with gentle and efficient liquid phase reaction kinetics• Very low nonspecific binding of nucleotides and nucleic acids• Very low aggregation in high salt hybridization buffers• Well suited for nucleic acid applications with extreme demands• Low nonspecific binding of small and negatively charged proteins• Production follows a validated process in compliance with cGMP for medical devices• Well suited for automated protocolsAbout Dynabeads M 270 StreptavidinThese uniform and superparamagnetic beads are 2 8 µm in diameter with a monolayer not a multilayer of recombinant streptavidin covalently coupled to the surface This leaves the vast majority of the biotin binding sites sterically available for binding not only of free biotin but also for binding of biotinylated ligands targets They are hydrophilic negatively charged and show rapid liquid phase reaction kinetics Their specific and defined surface allow for efficient capture separation and downstream handling The streptavidin monolayer ensures negligible leakage and the lack of excess adsorbed streptavidin ensures batch consistency and reproducibility of your results ApplicationsOver the past 15 years streptavidin coupled Dynabeads have been used and cited for a very wide variety of applications Examples include direct indirect isolation and downstream handling of nucleic acids proteins peptides and other target molecules Ideal for sequence specific DNA RNA capture in nucleic acid based diagnostics specifically with samples with a high chaotropic salt concentration immunoassays involving small biotinylated antigens and applications that are not compatible with BSA these beads are not blocked with BSA Easily adaptated to automated processes Dynabeads are used on more than 25 000 routine IVD instruments worldwide The product holds high standards with respect to reproducibility both within and between batches and automation ability and drives reliability for your results Binding capacityThe size of the molecule and the biotinylation procedure will affect the binding capacity The capacity also depends on steric availability and charge interaction between bead and molecule and between molecules There are two or three biotin binding sites available for each streptavidin molecule on the surface of the bead after immobilization One mg of Dynabeads M 270 Streptavidin typically binds • 950 pmoles free biotin• 200 pmol biotinylated peptides• 10 µg biotinylated IgG• 10 µg ds DNA• 200 pmol ss oligonucleotides
    Catalog Number:
    65305
    Price:
    None
    Applications:
    ChIP-on-Chip|Chromatin Immunoprecipitation (ChIP)|DNA & RNA Purification & Analysis|DNA Extraction|Immunoprecipitation|Protein Assays and Analysis|Protein Biology|Protein Purification|Protein Purification & Isolation|RNAi, Epigenetics & Non-Coding RNA Research|Sequence-Specific DNA or RNA Purification|Viral RNA⁄DNA Purification|Chromatin Biology
    Category:
    Beads Microspheres
    Buy from Supplier


    Structured Review

    Thermo Fisher dynabeads m 270 streptavidin coated magnetic beads
    Dynabeads M 270 Streptavidin the gold standard for isolation and handling of biotinylated nucleic acids antibodies or other biotinylated ligands and targets The very high binding affinity of the streptavidin biotin interaction Kd 10 15 is used in a vast number of applications Benefits and features • Direct and fast isolation of any biotinylated molecule• Flexible protocols with gentle and efficient liquid phase reaction kinetics• Very low nonspecific binding of nucleotides and nucleic acids• Very low aggregation in high salt hybridization buffers• Well suited for nucleic acid applications with extreme demands• Low nonspecific binding of small and negatively charged proteins• Production follows a validated process in compliance with cGMP for medical devices• Well suited for automated protocolsAbout Dynabeads M 270 StreptavidinThese uniform and superparamagnetic beads are 2 8 µm in diameter with a monolayer not a multilayer of recombinant streptavidin covalently coupled to the surface This leaves the vast majority of the biotin binding sites sterically available for binding not only of free biotin but also for binding of biotinylated ligands targets They are hydrophilic negatively charged and show rapid liquid phase reaction kinetics Their specific and defined surface allow for efficient capture separation and downstream handling The streptavidin monolayer ensures negligible leakage and the lack of excess adsorbed streptavidin ensures batch consistency and reproducibility of your results ApplicationsOver the past 15 years streptavidin coupled Dynabeads have been used and cited for a very wide variety of applications Examples include direct indirect isolation and downstream handling of nucleic acids proteins peptides and other target molecules Ideal for sequence specific DNA RNA capture in nucleic acid based diagnostics specifically with samples with a high chaotropic salt concentration immunoassays involving small biotinylated antigens and applications that are not compatible with BSA these beads are not blocked with BSA Easily adaptated to automated processes Dynabeads are used on more than 25 000 routine IVD instruments worldwide The product holds high standards with respect to reproducibility both within and between batches and automation ability and drives reliability for your results Binding capacityThe size of the molecule and the biotinylation procedure will affect the binding capacity The capacity also depends on steric availability and charge interaction between bead and molecule and between molecules There are two or three biotin binding sites available for each streptavidin molecule on the surface of the bead after immobilization One mg of Dynabeads M 270 Streptavidin typically binds • 950 pmoles free biotin• 200 pmol biotinylated peptides• 10 µg biotinylated IgG• 10 µg ds DNA• 200 pmol ss oligonucleotides
    https://www.bioz.com/result/dynabeads m 270 streptavidin coated magnetic beads/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dynabeads m 270 streptavidin coated magnetic beads - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: Intracellular targets of RGDS peptide in melanoma cells
    Article Snippet: .. Precipitation with streptavidin-coated Dynabeads Streptavidin-coated Dynabeads (M-270, 2.8 μm, Dynal) were re-suspended, washed in PBS three times, using a magnetic holder, re-suspended and 1 × 103 pmoles of bt-RGDS, BSA or bt-RGES per mg beads were added, incubated for 1 h at 4°C and washed in PBS for five times. .. Growing SK-MEL-110 were lysed as reported [ ], pre-incubated with 10 μl RGDS as specific competitor (1 mM) and incubated with activated beads, at 4°C overnight with unidirectional mixing.

    Article Title: CtIP Protein Dimerization Is Critical for Its Recruitment to Chromosomal DNA Double-stranded Breaks *
    Article Snippet: .. 200 ng of DNA fragments were first incubated with 10 μl of M-270 streptavidin Dynabeads (Invitrogen) in PBS with 0.1% Tween 20. .. After washing with binding buffer containing 50 m m HEPES, pH 7.5, 50 m m potassium chloride, and 5 m m magnesium chloride.

    Binding Assay:

    Article Title: Dual 3’Seq using deepSuperSAGE uncovers transcriptomes of interacting Salmonella enterica Typhimurium and human host cells
    Article Snippet: .. Reverse-transcribed cDNAs were random-fragmented (Bioruptor, Diagenode) to an average size of approximately 200 nucleotides, and subsequently enriched for 3′ fragments through binding to streptavidin-coated paramagnetic beads (Dynabeads M-270 Streptavidin, Invitrogen). .. A second barcoding adaptor was ligated to the enriched 3′ fragments, and the adaptor-ligated cDNA fragments were PCR-amplified, PAGE-purified, and sequenced as described for deepSuperSAGE libraries.

    Labeling:

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: .. Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Magnetic Beads:

    Article Title: Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy
    Article Snippet: .. Pre-enrichment of BRAF gene fragment Pre-enrichment of genomic DNA was carried out using xGen Lockdown kit (IDT), 120mer BRAF -specific probe labeled with biotin (IDT), and streptavidin-coated magnetic beads (Dynabeads-M270, LifeTechnologies). .. The 120mer probe was designed to overlap the BRAF V600E region (position of V600E mutation is underlined): 5’-ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC A CTGTAGCTAGACCAA AATCACCTATTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGG-(biotin-C6)-3’ Pre-digested genomic DNA and biotinylated 120mer probe were incubated for 5 h at 60°C followed by attachment to magnetic beads, multiple washing steps and detachment by heat as suggested by the supplier (IDT; heating to 92°C for 10 min).

    Article Title: Molecular insights into the surface-specific arrangement of complement C5 convertase enzymes
    Article Snippet: .. Preparation of C3b-coated beads Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen (Carlsbad, CA, USA), 2.8 μm diameter) were washed twice and suspended in VBS-T+ (veronal buffered saline: 2 mM veronal, 145 mM NaCl, pH 7.4 (VBS, pH 7.4) containing 2.5 mM MgCl2 and 0.05 % Tween). ..

    Article Title: Functional Characterization of Alternative and Classical Pathway C3/C5 Convertase Activity and Inhibition Using Purified Models
    Article Snippet: .. C3 and C5 Conversion in AP Model Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Invitrogen) were washed once in VBS-T/Mg [Veronal Buffered Saline pH 7.4, 2.5 mM MgCl2 , 0.05% (v/v) Tween]. .. To prepare fully loaded C3b-beads, beads (4 µl/sample) were resuspended in 0.4 ml VBS-T/Mg per sample with C3b-PEG11-biotin (1 µg/ml) and incubated for 1 h at 4°C on roller.

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins
    Article Snippet: .. Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). .. Beads were incubated with the lysate overnight at 4 °C with gentle rocking agitation to bind biotinylated proteins.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher streptavidin coated magnetic beads
    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by <t>StreptAvidin-Alexa488)</t> in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.
    Streptavidin Coated Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated magnetic beads/product/Thermo Fisher
    Average 99 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated magnetic beads - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Journal: Proteomes

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins

    doi: 10.3390/proteomes6040048

    Figure Lengend Snippet: SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Techniques: Labeling, Sequencing, Staining, Expressing

    SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ) APEX2 or HRP (image RCSB PDB [ 53 , 54 ] ( www.rcsb.org ) of PDB ID 1HCH [ 54 ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Journal: Proteomes

    Article Title: Mapping the Proteome of the Synaptic Cleft through Proximity Labeling Reveals New Cleft Proteins

    doi: 10.3390/proteomes6040048

    Figure Lengend Snippet: SynCAM 1-peroxidase fusion protein peroxidase-mediated proximity labeling in the synaptic cleft. ( A ) APEX2 or HRP (image RCSB PDB [ 53 , 54 ] ( www.rcsb.org ) of PDB ID 1HCH [ 54 ]) peroxidase was inserted at the base of the SynCAM 1 extracellular domain, with immunoglobulin (Ig) domains, trans-membrane (TM) region, and intracellular PDZ domain interaction sequence indicated. APEX2 or HRP catalyzes the formation of a short-lived biotin-AEEA-phenoxyl radical (red dot) after exogenous addition of H 2 O 2 and membrane-impermeable biotin-AEEA-phenol (blue dot). ( B ) Exogenous biotin-AEEA-phenol induced biotinylation only at the cell surface. Staining for biotin (visualized by StreptAvidin-Alexa488) in HEK293T cells expressing SynCAM 1-APEX2 in presence (+) but not in absence (−) of H 2 O 2 . ( C ) Exogenous biotin-AEEA-phenol did not induce biotinylation in HEK293T cells expressing cytosolic APEX2-NES.

    Article Snippet: Streptavidin-coated magnetic beads (Dynabeads M-270, Thermo Fisher Scientific, 65305) were equilibrated to room temperature and 50 μL resuspended bead slurry was washed twice with 1× RIPA buffer 50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.2% SDS, 0.5% sodium deoxycholate, 1% Triton X-100).

    Techniques: Labeling, Sequencing, Staining, Expressing