Structured Review

Corning Life Sciences dulbecco s modified eagle s medium
TCDD suppresses colony formation in RKO human colorectal cancer cells in vitro . Cells (1×10 3 cells/well) were seeded into 6-well plates and cultured in <t>Dulbecco’s</t> modified <t>Eagle’s</t> medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (1 or 10 nM) for 5 days when visible clones formed. The colonies were washed with PBS, fixed with methanol and then stained with 0.5% crystal violet. (A) Stained cells are presented as images (×10), and (B) the colonies containing > 50 cells were counted under a microscope. * P
Dulbecco S Modified Eagle S Medium, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dulbecco s modified eagle s medium/product/Corning Life Sciences
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dulbecco s modified eagle s medium - by Bioz Stars, 2021-03
86/100 stars

Images

1) Product Images from "2,3,7,8-tetrachlorodibenzo-p-dioxin suppresses the growth of human colorectal cancer cells in vitro: Implication of the aryl hydrocarbon receptor signaling"

Article Title: 2,3,7,8-tetrachlorodibenzo-p-dioxin suppresses the growth of human colorectal cancer cells in vitro: Implication of the aryl hydrocarbon receptor signaling

Journal: International Journal of Oncology

doi: 10.3892/ijo.2019.4703

TCDD suppresses colony formation in RKO human colorectal cancer cells in vitro . Cells (1×10 3 cells/well) were seeded into 6-well plates and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (1 or 10 nM) for 5 days when visible clones formed. The colonies were washed with PBS, fixed with methanol and then stained with 0.5% crystal violet. (A) Stained cells are presented as images (×10), and (B) the colonies containing > 50 cells were counted under a microscope. * P
Figure Legend Snippet: TCDD suppresses colony formation in RKO human colorectal cancer cells in vitro . Cells (1×10 3 cells/well) were seeded into 6-well plates and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (1 or 10 nM) for 5 days when visible clones formed. The colonies were washed with PBS, fixed with methanol and then stained with 0.5% crystal violet. (A) Stained cells are presented as images (×10), and (B) the colonies containing > 50 cells were counted under a microscope. * P

Techniques Used: In Vitro, Cell Culture, Modification, Clone Assay, Staining, Microscopy

TCDD suppresses the proliferation of RKO human colorectal cancer cells in vitro . The cells (1×10 5 cells/well in 24-well plates) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (0.01-100 nM) for (A) 3 or (B) 7 days. After culture, the numbers of attached cells were counted. Data are presented as mean ± standard deviation obtained from 8 wells of 2 replicate plates per dataset using different dishes and cell preparations. * P
Figure Legend Snippet: TCDD suppresses the proliferation of RKO human colorectal cancer cells in vitro . The cells (1×10 5 cells/well in 24-well plates) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (0.01-100 nM) for (A) 3 or (B) 7 days. After culture, the numbers of attached cells were counted. Data are presented as mean ± standard deviation obtained from 8 wells of 2 replicate plates per dataset using different dishes and cell preparations. * P

Techniques Used: In Vitro, Cell Culture, Modification, Standard Deviation

The TCDD-induced increase in CYP1A1 levels are suppressed in the regucalcin-overexpressing RKO human colorectal cancer cells in vitro . The wild-type RKO cells or regucalcin-overexpressing transfectants (1×10 6 cells/dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence or absence of vehicle (1% dimethyl sulfoxide) or TCDD (10 nM) for 3 days and then cell lysates were centrifuged. Subsequently, 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies against the indicated proteins. Representative data from three independent experiments using different cell preparations are presented, and data are presented as mean ± standard deviation. (A) Representative film images of the TCDD effect. (B) Presented relative to β-actin of the TCDD effect. * P
Figure Legend Snippet: The TCDD-induced increase in CYP1A1 levels are suppressed in the regucalcin-overexpressing RKO human colorectal cancer cells in vitro . The wild-type RKO cells or regucalcin-overexpressing transfectants (1×10 6 cells/dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence or absence of vehicle (1% dimethyl sulfoxide) or TCDD (10 nM) for 3 days and then cell lysates were centrifuged. Subsequently, 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies against the indicated proteins. Representative data from three independent experiments using different cell preparations are presented, and data are presented as mean ± standard deviation. (A) Representative film images of the TCDD effect. (B) Presented relative to β-actin of the TCDD effect. * P

Techniques Used: In Vitro, Cell Culture, Modification, SDS Page, Western Blot, Standard Deviation

TCDD regulates the expression of proteins associated with AHR signaling in RKO human colorectal cancer cells in vitro . The cells (1×10 6 cells/dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (10 nM) for 3 days. Cell lysates were prepared and centrifuged, and 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies against various proteins as indicated. Data represent a typical figure of three independent experiments using different cell preparations, and also are presented as mean ± standard deviation. (A) Representative film image for cell signaling-associated proteins. (B) Relative to β-actin cell signaling-associated protein levels. (C) Representative film image of tumor suppressor proteins.(D) Relative to β-actin tumor suppressor proteins. * P
Figure Legend Snippet: TCDD regulates the expression of proteins associated with AHR signaling in RKO human colorectal cancer cells in vitro . The cells (1×10 6 cells/dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence of vehicle (1% dimethyl sulfoxide) or TCDD (10 nM) for 3 days. Cell lysates were prepared and centrifuged, and 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies against various proteins as indicated. Data represent a typical figure of three independent experiments using different cell preparations, and also are presented as mean ± standard deviation. (A) Representative film image for cell signaling-associated proteins. (B) Relative to β-actin cell signaling-associated protein levels. (C) Representative film image of tumor suppressor proteins.(D) Relative to β-actin tumor suppressor proteins. * P

Techniques Used: Expressing, In Vitro, Cell Culture, Modification, SDS Page, Western Blot, Standard Deviation

AHR and CYP1A1 levels are suppressed in regucalcin-overexpressing RKO human colorectal cancer cells in vitro . The wild-type RKO cells or regucalcin-overexpressing RKO cells (1×10 6 cells/per dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence or absence of vehicle (1% dimethyl sulfoxide) for 3 days. After culture, resulting cell lysates were centrifuged, and 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies as indicated. Data represent a typical figure obtained from three independent experiments using different cell preparations, and also are presented as mean ± standard deviation. (A) Representative film image for regucalcin. (B) Relative to β-actin regucalcin level. (C) Representative film image of AHR and CYP1A1. (D) Relative to β-actin AHR and CYP1A1 levels. * P
Figure Legend Snippet: AHR and CYP1A1 levels are suppressed in regucalcin-overexpressing RKO human colorectal cancer cells in vitro . The wild-type RKO cells or regucalcin-overexpressing RKO cells (1×10 6 cells/per dish) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 1% penicillin/streptomycin and 1% fungizone in the presence or absence of vehicle (1% dimethyl sulfoxide) for 3 days. After culture, resulting cell lysates were centrifuged, and 40 µ g of the supernatant protein per lane were separated by SDS-PAGE and transferred to nylon membranes for western blotting using specific antibodies as indicated. Data represent a typical figure obtained from three independent experiments using different cell preparations, and also are presented as mean ± standard deviation. (A) Representative film image for regucalcin. (B) Relative to β-actin regucalcin level. (C) Representative film image of AHR and CYP1A1. (D) Relative to β-actin AHR and CYP1A1 levels. * P

Techniques Used: In Vitro, Cell Culture, Modification, SDS Page, Western Blot, Standard Deviation

Related Articles

Modification:

Article Title: Distinct CRC-associated Apc mutations dictate response to Tankyrase inhibition
Article Snippet: .. Cells HEK293T (ATCC CRL-3216) and DLD1 cells (ATCC CCL-221) were purchased from ATCC and maintained in Dulbecco’s Modified Eagle’s Medium (Corning) supplemented with 10% (v/v) fetal bovine serum (FBS), at 37° with 5% CO2. .. NIH/3T3 (ATCC CRL-1658) were maintained in Dulbecco’s Modified Eagle’s Medium (Corning) supplemented with 10% (v/v) bovine calf serum.

Article Title: Dephosphorylation of Plk1 occurs through PP2A-B55/ENSA/Greatwall pathway during mitotic DNA damage recovery
Article Snippet: In this study, we demonstrate how dephosphorylation of Plk1 occurs during the mitotic DNA damage response and how ATM/Chk activation is linked to the functionality of PP2A, which causes Plk1 dephosphorylation. .. Cell culture and treatmentsWild-type HCT116 cells were cultured in Dulbecco’s modified Eagle’s medium containing 10% FBS (Corning). .. To synchronize cells during prometaphase, they were treated with 100 ng/ml nocodazole (Sigma) for 16 h and collected by shaking.

Article Title: MgrA Negatively Impacts Staphylococcus aureus Invasion by Regulating Capsule and FnbA
Article Snippet: .. Confluent HeLa cell (ATCC CCL-2) monolayers (approximately 4 × 105 /well) seeded in 24-well tissue culture plates were infected with approximately 1 × 107 stationary-phase bacteria (MOI of 25) in Dulbecco’s modified Eagle’s medium (Corning, New York, NY) supplemented with 10% heat-inactivated fetal bovine serum (HyClone, ThermoFischer Scientific) and 2 mM l -glutamine (Gibco, Waltham, MA) for 1 h at 37°C in a 5% CO2 atmosphere. .. The wells were then replaced with the same tissue culture medium containing 20 μg/ml lysostaphin (AMBI Products, LLC, New York, NY) and 100 μg/ml gentamicin (Gibco) for 30 min at 37°C in 5% CO2.

Article Title: Zika Virus-Induction of the Suppressor of Cytokine Signaling 1/3 Contributes to the Modulation of Viral Replication
Article Snippet: A549 and JAr cells were cultured at 37 °C in RPMI 1640 medium (Corning Mediatech, Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS; Corning Mediatech) and 1% antibiotics. .. Vero cells were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM; Corning Mediatech) supplemented with 10% FBS and 1% antibiotics. .. Human neural progenitor cells (hNPCs) were generated as previously described [ ].

Article Title: Structural basis of the target-binding mode of the G protein–coupled receptor kinase–interacting protein in the regulation of focal adhesion dynamics
Article Snippet: The procedure follows the protocol used for analytical gel filtration analysis. .. Cell culture, transfection, and fluorescence imagingCOS7 cells were cultured in Dulbecco's modified Eagle's medium (Corning, 10-013-CVR) supplemented with 10% fetal bovine serum (Pan Biotech) and 50 units/ml penicillin and streptomycin. .. Transfections of either WT or mutant GIT1/EGFP-expressing plasmids were performed with polyethyleneimine-25,000 (Polyscience) according to the manufacturer's instructions.

Article Title: A neurodevelopmental disorder caused by mutations in the VPS51 subunit of the GARP and EARP complexes
Article Snippet: A plasmid encoding VPS50-13myc was previously described ( ). p3HA-N1 vector was generated by replacing the EGFP sequence of pEGFP-N1 with a 3HA sequence, followed by sub-cloning of codon-optimized human VPS51 into the HA and EGFP vector (for C-terminally tagged VPS51) using a PCR amplicon (forward primer, 5′ CCTCGAGAATTCGCCACCATGGCCGCAGCCGCAGCGGCAGGG; reverse primer, 5′ CGCGGTACCGTGCCGCGCTCGCAGATGACCT) digested with EcoRI-KpnI and ligated into an EcoRI-KpnI-digested vector backbone. .. Cell culture and transfection HeLa cells (ATCC, Manassas, VA) were cultured in complete Dulbecco's Modified Eagle's Medium [supplemented with 10% fetal bovine serum (FBS), l -glutamine, penicillin-streptomycin (all from Corning, Corning, NY)], at 37°C, 5% CO2 and 95% relative humidity. .. HeLa cells were transfected with either Lipofectamine 2000 (Thermo Fisher Scientific) or Fugene 6 (Promega) according to the manufacturer's instructions.

Article Title: FACS-mediated isolation of neuronal cell populations from virus infected human embryonic stem cell derived cerebral organoid cultures
Article Snippet: .. Dulbecco’s modified Eagle’s medium, DMEM (Corning, cat. no. 10-013-CV) 10% fetal bovine serum 1:100 Penicillin/Streptomycin (Sigma, cat. no. P4333) Sterilize by filtration and store at 4˚C for up to four weeks. ..

Article Title: Non-canonical proline-tyrosine interactions with multiple host proteins regulate Ebola virus infection
Article Snippet: It remains to be determined whether VP30 interaction modulates the functions of these host proteins and what impact this might have on virus infection. .. Cell linesHEK293T (human embryonic kidney SV40 Tag transformed; ATCC, CRL-3216), Huh7 (generous gift from the Gordan lab at UCSF) and HeLa cells (ATCC, CCL-2) were maintained in Dulbecco’s modified Eagle’s medium (Corning Cellgro or ThermoFisher scientific) with 10% fetal calf serum (Gibco or Gemini Bio-Products) at 37°C in a humidified atmosphere with 5% CO2. .. AntibodiesThe antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam, ab32680), monoclonal rabbit anti-hnRNPUL1 (Abcam, ab134954), monoclonal rabbit anti-PEG10 (Abcam, ab215035), monoclonal mouse anti-FLAG M2 antibody (Sigma Aldrich, F1804), polyclonal rabbit anti-FLAG antibody (Sigma Aldrich, F7425), monoclonal mouse anti-HA antibody (Sigma Aldrich, H3663), polyclonal rabbit anti-HA antibody (Sigma Aldrich, H6908), monoclonal mouse anti-β-tubulin antibody (Sigma Aldrich, T8328), anti-Ebola GP antibody clone 4F3 (IBT Bioservices, 0201-020), goat IgG (H+L) anti-mouse Alexa Flour 546 conjugate (ThermoFisher scientific, A11030), rabbit anti-peptide serum raised against EBOV VP30 (2-25aa) and NP (97-119aa) and anti-VP30 pSer VP30 ( ).

Cell Culture:

Article Title: Dephosphorylation of Plk1 occurs through PP2A-B55/ENSA/Greatwall pathway during mitotic DNA damage recovery
Article Snippet: In this study, we demonstrate how dephosphorylation of Plk1 occurs during the mitotic DNA damage response and how ATM/Chk activation is linked to the functionality of PP2A, which causes Plk1 dephosphorylation. .. Cell culture and treatmentsWild-type HCT116 cells were cultured in Dulbecco’s modified Eagle’s medium containing 10% FBS (Corning). .. To synchronize cells during prometaphase, they were treated with 100 ng/ml nocodazole (Sigma) for 16 h and collected by shaking.

Article Title: Zika Virus-Induction of the Suppressor of Cytokine Signaling 1/3 Contributes to the Modulation of Viral Replication
Article Snippet: A549 and JAr cells were cultured at 37 °C in RPMI 1640 medium (Corning Mediatech, Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS; Corning Mediatech) and 1% antibiotics. .. Vero cells were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM; Corning Mediatech) supplemented with 10% FBS and 1% antibiotics. .. Human neural progenitor cells (hNPCs) were generated as previously described [ ].

Article Title: Structural basis of the target-binding mode of the G protein–coupled receptor kinase–interacting protein in the regulation of focal adhesion dynamics
Article Snippet: The procedure follows the protocol used for analytical gel filtration analysis. .. Cell culture, transfection, and fluorescence imagingCOS7 cells were cultured in Dulbecco's modified Eagle's medium (Corning, 10-013-CVR) supplemented with 10% fetal bovine serum (Pan Biotech) and 50 units/ml penicillin and streptomycin. .. Transfections of either WT or mutant GIT1/EGFP-expressing plasmids were performed with polyethyleneimine-25,000 (Polyscience) according to the manufacturer's instructions.

Article Title: A neurodevelopmental disorder caused by mutations in the VPS51 subunit of the GARP and EARP complexes
Article Snippet: A plasmid encoding VPS50-13myc was previously described ( ). p3HA-N1 vector was generated by replacing the EGFP sequence of pEGFP-N1 with a 3HA sequence, followed by sub-cloning of codon-optimized human VPS51 into the HA and EGFP vector (for C-terminally tagged VPS51) using a PCR amplicon (forward primer, 5′ CCTCGAGAATTCGCCACCATGGCCGCAGCCGCAGCGGCAGGG; reverse primer, 5′ CGCGGTACCGTGCCGCGCTCGCAGATGACCT) digested with EcoRI-KpnI and ligated into an EcoRI-KpnI-digested vector backbone. .. Cell culture and transfection HeLa cells (ATCC, Manassas, VA) were cultured in complete Dulbecco's Modified Eagle's Medium [supplemented with 10% fetal bovine serum (FBS), l -glutamine, penicillin-streptomycin (all from Corning, Corning, NY)], at 37°C, 5% CO2 and 95% relative humidity. .. HeLa cells were transfected with either Lipofectamine 2000 (Thermo Fisher Scientific) or Fugene 6 (Promega) according to the manufacturer's instructions.

Infection:

Article Title: MgrA Negatively Impacts Staphylococcus aureus Invasion by Regulating Capsule and FnbA
Article Snippet: .. Confluent HeLa cell (ATCC CCL-2) monolayers (approximately 4 × 105 /well) seeded in 24-well tissue culture plates were infected with approximately 1 × 107 stationary-phase bacteria (MOI of 25) in Dulbecco’s modified Eagle’s medium (Corning, New York, NY) supplemented with 10% heat-inactivated fetal bovine serum (HyClone, ThermoFischer Scientific) and 2 mM l -glutamine (Gibco, Waltham, MA) for 1 h at 37°C in a 5% CO2 atmosphere. .. The wells were then replaced with the same tissue culture medium containing 20 μg/ml lysostaphin (AMBI Products, LLC, New York, NY) and 100 μg/ml gentamicin (Gibco) for 30 min at 37°C in 5% CO2.

Transfection:

Article Title: Structural basis of the target-binding mode of the G protein–coupled receptor kinase–interacting protein in the regulation of focal adhesion dynamics
Article Snippet: The procedure follows the protocol used for analytical gel filtration analysis. .. Cell culture, transfection, and fluorescence imagingCOS7 cells were cultured in Dulbecco's modified Eagle's medium (Corning, 10-013-CVR) supplemented with 10% fetal bovine serum (Pan Biotech) and 50 units/ml penicillin and streptomycin. .. Transfections of either WT or mutant GIT1/EGFP-expressing plasmids were performed with polyethyleneimine-25,000 (Polyscience) according to the manufacturer's instructions.

Article Title: A neurodevelopmental disorder caused by mutations in the VPS51 subunit of the GARP and EARP complexes
Article Snippet: A plasmid encoding VPS50-13myc was previously described ( ). p3HA-N1 vector was generated by replacing the EGFP sequence of pEGFP-N1 with a 3HA sequence, followed by sub-cloning of codon-optimized human VPS51 into the HA and EGFP vector (for C-terminally tagged VPS51) using a PCR amplicon (forward primer, 5′ CCTCGAGAATTCGCCACCATGGCCGCAGCCGCAGCGGCAGGG; reverse primer, 5′ CGCGGTACCGTGCCGCGCTCGCAGATGACCT) digested with EcoRI-KpnI and ligated into an EcoRI-KpnI-digested vector backbone. .. Cell culture and transfection HeLa cells (ATCC, Manassas, VA) were cultured in complete Dulbecco's Modified Eagle's Medium [supplemented with 10% fetal bovine serum (FBS), l -glutamine, penicillin-streptomycin (all from Corning, Corning, NY)], at 37°C, 5% CO2 and 95% relative humidity. .. HeLa cells were transfected with either Lipofectamine 2000 (Thermo Fisher Scientific) or Fugene 6 (Promega) according to the manufacturer's instructions.

Fluorescence:

Article Title: Structural basis of the target-binding mode of the G protein–coupled receptor kinase–interacting protein in the regulation of focal adhesion dynamics
Article Snippet: The procedure follows the protocol used for analytical gel filtration analysis. .. Cell culture, transfection, and fluorescence imagingCOS7 cells were cultured in Dulbecco's modified Eagle's medium (Corning, 10-013-CVR) supplemented with 10% fetal bovine serum (Pan Biotech) and 50 units/ml penicillin and streptomycin. .. Transfections of either WT or mutant GIT1/EGFP-expressing plasmids were performed with polyethyleneimine-25,000 (Polyscience) according to the manufacturer's instructions.

Filtration:

Article Title: FACS-mediated isolation of neuronal cell populations from virus infected human embryonic stem cell derived cerebral organoid cultures
Article Snippet: .. Dulbecco’s modified Eagle’s medium, DMEM (Corning, cat. no. 10-013-CV) 10% fetal bovine serum 1:100 Penicillin/Streptomycin (Sigma, cat. no. P4333) Sterilize by filtration and store at 4˚C for up to four weeks. ..

Transformation Assay:

Article Title: Non-canonical proline-tyrosine interactions with multiple host proteins regulate Ebola virus infection
Article Snippet: It remains to be determined whether VP30 interaction modulates the functions of these host proteins and what impact this might have on virus infection. .. Cell linesHEK293T (human embryonic kidney SV40 Tag transformed; ATCC, CRL-3216), Huh7 (generous gift from the Gordan lab at UCSF) and HeLa cells (ATCC, CCL-2) were maintained in Dulbecco’s modified Eagle’s medium (Corning Cellgro or ThermoFisher scientific) with 10% fetal calf serum (Gibco or Gemini Bio-Products) at 37°C in a humidified atmosphere with 5% CO2. .. AntibodiesThe antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam, ab32680), monoclonal rabbit anti-hnRNPUL1 (Abcam, ab134954), monoclonal rabbit anti-PEG10 (Abcam, ab215035), monoclonal mouse anti-FLAG M2 antibody (Sigma Aldrich, F1804), polyclonal rabbit anti-FLAG antibody (Sigma Aldrich, F7425), monoclonal mouse anti-HA antibody (Sigma Aldrich, H3663), polyclonal rabbit anti-HA antibody (Sigma Aldrich, H6908), monoclonal mouse anti-β-tubulin antibody (Sigma Aldrich, T8328), anti-Ebola GP antibody clone 4F3 (IBT Bioservices, 0201-020), goat IgG (H+L) anti-mouse Alexa Flour 546 conjugate (ThermoFisher scientific, A11030), rabbit anti-peptide serum raised against EBOV VP30 (2-25aa) and NP (97-119aa) and anti-VP30 pSer VP30 ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Corning Life Sciences dmem
    A2B receptors are expressed in Schwann cells. (A) Western blot image of A2B expression in RSC-96 cells. GAPDH is used as a housekeeping control. Relative expression of A2B protein in RSC-96 cells co-cultured with <t>DOK</t> or HSC-3 is presented as fold change over <t>DMEM</t> treated RSC-96 cells. (B) Western blot quantification of A2B protein expression in RSC-96 cells. (C) Immunofluorescence labeling of the A2B receptor (green) and nucleus (DAPI, blue) in RSC-96 cells co-cultured with either DOK or HSC-3. Scale: 100 μm. (D) Relative A2B mRNA fold change in RSC-96 cells co-cultured with either DOK or HSC-3 over control RSC-96 cells. No differences are detected across different groups. Kruskal-Wallis test followed by Dunn's multiple comparison analysis.
    Dmem, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dmem/product/Corning Life Sciences
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dmem - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    86
    Corning Life Sciences dmem f12 media
    Role of noncanonical Wnt pathway in the migration of mMSCs. The horizontal migration of mMSCs incubated in 2% <t>DMEM/F12</t> media supplemented with 500 ng/ml Wnt5a or 500 ng/ml Wnt5a plus 2.5 µmol/L GF109203X or 5 µmol/L SP600125 was examined by wound healing assay ( A ×200; n = 3; # P
    Dmem F12 Media, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dmem f12 media/product/Corning Life Sciences
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dmem f12 media - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    86
    Corning Life Sciences dulbecco s modified eagle medium dmem medium
    LY inhibits TGF-β1-induced activation of NOF cells, suppresses SMAD signaling and reduces the expression of HGSOC stroma-associated genes. ( A ) NOF cells were treated with increasing concentrations of TGF-β1 for 24 h and cell lysates were collected to measure the α-SMA expression by western blot. ( B ) NOF cells were pre-treated with indicated concentrations of LY for 12 h followed by the induction of TGF-β1 (5 ng/mL) for 24 h and α-SMA expression was analyzed by Western blot. ( C ) TGF-β1-activated NOF (NOF-CAF) cells were grown in TGF-β1-free <t>Dulbecco’s</t> modified eagle medium <t>(DMEM).</t> Cell lysates were collected from the 1, 3, 5, 7, and 10 days and α-SMA expression was analyzed by Western blot. ( D ) NOF-CAF cells were treated with LY (1 μM) for 24 h and TGF-βR1 expression was analyzed by qPCR. ( E ) NOF-CAF cells were treated with LY for 48 h and p-SMAD2 and p-SMAD3 expression were analyzed by Western blot. Total SMAD2 and SMAD3 were used as loading controls. ( F ) NOF-CAF cells were co-cultured with OVCAR8 cells using the Transwell system. TGF-β1 was added with or without the pre-treatment with LY and total RNA from TGF-β1-activated NOF cells collected to determine the expression of COL5A1 , COL11A1 , TIMP3 , and VCAN by qPCR.
    Dulbecco S Modified Eagle Medium Dmem Medium, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dulbecco s modified eagle medium dmem medium/product/Corning Life Sciences
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dulbecco s modified eagle medium dmem medium - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    86
    Corning Life Sciences serum free dmem
    Effect of TGFα on <t>KGN</t> cell proliferation. A ) KGN cells were treated without (CTL) or with TGFα (10 ng/ml) in <t>DMEM</t> supplied with increasing amounts of serum for 48 hours and cell numbers were counted. B ) KGN cells were treated without (Control) or with TGFα and/or different kinase inhibitors in DMEM for 48 hours and cell numbers were counted. Bars represented means ± SEM, Bars with different letters are significantly different ( P
    Serum Free Dmem, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/serum free dmem/product/Corning Life Sciences
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    serum free dmem - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    Image Search Results


    A2B receptors are expressed in Schwann cells. (A) Western blot image of A2B expression in RSC-96 cells. GAPDH is used as a housekeeping control. Relative expression of A2B protein in RSC-96 cells co-cultured with DOK or HSC-3 is presented as fold change over DMEM treated RSC-96 cells. (B) Western blot quantification of A2B protein expression in RSC-96 cells. (C) Immunofluorescence labeling of the A2B receptor (green) and nucleus (DAPI, blue) in RSC-96 cells co-cultured with either DOK or HSC-3. Scale: 100 μm. (D) Relative A2B mRNA fold change in RSC-96 cells co-cultured with either DOK or HSC-3 over control RSC-96 cells. No differences are detected across different groups. Kruskal-Wallis test followed by Dunn's multiple comparison analysis.

    Journal: Heliyon

    Article Title: Reciprocal interactions between cancer and Schwann cells contribute to oral cancer progression and pain

    doi: 10.1016/j.heliyon.2019.e01223

    Figure Lengend Snippet: A2B receptors are expressed in Schwann cells. (A) Western blot image of A2B expression in RSC-96 cells. GAPDH is used as a housekeeping control. Relative expression of A2B protein in RSC-96 cells co-cultured with DOK or HSC-3 is presented as fold change over DMEM treated RSC-96 cells. (B) Western blot quantification of A2B protein expression in RSC-96 cells. (C) Immunofluorescence labeling of the A2B receptor (green) and nucleus (DAPI, blue) in RSC-96 cells co-cultured with either DOK or HSC-3. Scale: 100 μm. (D) Relative A2B mRNA fold change in RSC-96 cells co-cultured with either DOK or HSC-3 over control RSC-96 cells. No differences are detected across different groups. Kruskal-Wallis test followed by Dunn's multiple comparison analysis.

    Article Snippet: To study the effect of cancer cells on Schwann cell intracellular Ca2+ levels, RSC-96 cells were seeded onto glass coverslips and co-cultured with either inserts (3-μm pore size, Corning) containing DMEM alone, inserts with DOK culture, or inserts with HSC-3 culture ( A).

    Techniques: Western Blot, Expressing, Cell Culture, Immunofluorescence, Labeling

    Oral SCC induces Schwann cell hypertrophy and increased Ca 2+ influx. (A) Co-culture model. To study Schwann cell morphology and basal intracellular Ca 2+ levels following exposure to cancer cells, RSC-96 cells were cultured in the lower chamber, while either DOK or HSC-3 cells were cultured in the cell inserts. The inserts have 3 μm-sized pores that allow free exchange of media but do not allow cells to migrate through. (B) Representative images of RSC-96 cells cultured with inserts containing DMEM, DOK or HSC-3. Scale: 100 μm. (C) The mean size of RSC-96 cells was greater when co-cultured with HSC-3 cells, compared to RSC-96 cells co-culture with DOK or with DMEM alone. (D) Intracellular Ca 2+ concentration was higher in Schwann cells co-cultured with HSC-3 cells compared with co-culture with DOK or with DMEM alone. (E) Representative Ca 2+ responses of RSC-96 cells to DMEM, HSC-3 supernatant, and 100 μM ATP. Each color represents a different cell. One-way ANOVA with Tukey's post hoc analysis.

    Journal: Heliyon

    Article Title: Reciprocal interactions between cancer and Schwann cells contribute to oral cancer progression and pain

    doi: 10.1016/j.heliyon.2019.e01223

    Figure Lengend Snippet: Oral SCC induces Schwann cell hypertrophy and increased Ca 2+ influx. (A) Co-culture model. To study Schwann cell morphology and basal intracellular Ca 2+ levels following exposure to cancer cells, RSC-96 cells were cultured in the lower chamber, while either DOK or HSC-3 cells were cultured in the cell inserts. The inserts have 3 μm-sized pores that allow free exchange of media but do not allow cells to migrate through. (B) Representative images of RSC-96 cells cultured with inserts containing DMEM, DOK or HSC-3. Scale: 100 μm. (C) The mean size of RSC-96 cells was greater when co-cultured with HSC-3 cells, compared to RSC-96 cells co-culture with DOK or with DMEM alone. (D) Intracellular Ca 2+ concentration was higher in Schwann cells co-cultured with HSC-3 cells compared with co-culture with DOK or with DMEM alone. (E) Representative Ca 2+ responses of RSC-96 cells to DMEM, HSC-3 supernatant, and 100 μM ATP. Each color represents a different cell. One-way ANOVA with Tukey's post hoc analysis.

    Article Snippet: To study the effect of cancer cells on Schwann cell intracellular Ca2+ levels, RSC-96 cells were seeded onto glass coverslips and co-cultured with either inserts (3-μm pore size, Corning) containing DMEM alone, inserts with DOK culture, or inserts with HSC-3 culture ( A).

    Techniques: Co-Culture Assay, Cell Culture, Concentration Assay

    Oral SCC promotes Schwann cell proliferation, migration, and invasion. (A) To study the effect of HSC-3 or DOK cells on Schwann cell proliferation, RSC-96 cells were cultured in the lower chamber, while either DOK or HSC-3 cells were cultured in the cell inserts. (B) Growth rate of RSC-96 cells measured by the RTCA, increased with HSC-3 cell number. (C) Optical density (OD) measured using the MTS assay increased when RSC-96 cells were co-cultured with DOK or HSC-3 cells compared to DMEM alone. Kruskal-Wallis with Dunn's test. (D) To study the effect of HSC-3 or DOK cells on RSC-96 migration, RSC-96 cells were cultured in a migration chamber. Either HSC-3 or DOK cells were seeded in the bottom chamber. (E) Migration of RSC-96 cells towards HSC-3 cells increased in a cell number dependent manner. (F) Increased numbers of RSC-96 cells migrated toward HSC-3 cells compared to DOK or DMEM. (G) To study effect of HSC-3 or DOK cells on RSC-96 invasion, RSC-96 cells were cultured in invasion chambers. Either HSC-3 or DOK cells were seeded in the bottom chamber. (H) Increased numbers of invaded RSC-96 cells towards HSC-3 compared to DOK or DMEM. One-way ANOVA with Tukey's post hoc analysis.

    Journal: Heliyon

    Article Title: Reciprocal interactions between cancer and Schwann cells contribute to oral cancer progression and pain

    doi: 10.1016/j.heliyon.2019.e01223

    Figure Lengend Snippet: Oral SCC promotes Schwann cell proliferation, migration, and invasion. (A) To study the effect of HSC-3 or DOK cells on Schwann cell proliferation, RSC-96 cells were cultured in the lower chamber, while either DOK or HSC-3 cells were cultured in the cell inserts. (B) Growth rate of RSC-96 cells measured by the RTCA, increased with HSC-3 cell number. (C) Optical density (OD) measured using the MTS assay increased when RSC-96 cells were co-cultured with DOK or HSC-3 cells compared to DMEM alone. Kruskal-Wallis with Dunn's test. (D) To study the effect of HSC-3 or DOK cells on RSC-96 migration, RSC-96 cells were cultured in a migration chamber. Either HSC-3 or DOK cells were seeded in the bottom chamber. (E) Migration of RSC-96 cells towards HSC-3 cells increased in a cell number dependent manner. (F) Increased numbers of RSC-96 cells migrated toward HSC-3 cells compared to DOK or DMEM. (G) To study effect of HSC-3 or DOK cells on RSC-96 invasion, RSC-96 cells were cultured in invasion chambers. Either HSC-3 or DOK cells were seeded in the bottom chamber. (H) Increased numbers of invaded RSC-96 cells towards HSC-3 compared to DOK or DMEM. One-way ANOVA with Tukey's post hoc analysis.

    Article Snippet: To study the effect of cancer cells on Schwann cell intracellular Ca2+ levels, RSC-96 cells were seeded onto glass coverslips and co-cultured with either inserts (3-μm pore size, Corning) containing DMEM alone, inserts with DOK culture, or inserts with HSC-3 culture ( A).

    Techniques: Migration, Cell Culture, MTS Assay

    Schwann cells promote oral SCC proliferation, migration, and invasion. (A) To study the effect of RSC-96 cells on proliferation, HSC-3 or DOK cells were cultured in the lower chamber, and RSC-96 cells were cultured in the cell inserts. Cell culture media DMEM in the lower chamber was used as control. (B) Growth rate of HSC-3 cells, measured with the RTCA, increased with RSC-96 cell number. (C) HSC-3 cells proliferated more than DOK when co-cultured with RSC-96 cells. Data are presented as a percentage increase in OD from DMEM treated controls. (D) To study the effect of RSC-96 on cancer cell migration, HSC-3 or DOK cells were cultured in migration chambers with RSC-96 cells or DMEM (control) in the bottom chamber. (E) HSC-3 cells migrated towards RSC-96 cells in a cell number dependent manner. (F) HSC-3 cells migrated more than DOK towards RSC-96 cells. Data are presented as a percentage increase in number of migrated cells towards RSC-96 relative to DMEM controls. (G) To study effect of RSC-96 cells on cancer cell invasion, HSC-3 and DOK cells were cultured in invasion chambers with RSC-96 cells seeded at the bottom chamber. Bottom chambers containing DMEM alone were used as controls. (H) Increased invasion of HSC-3 cells compared to DOK cells in the presence of RSC-96 cells. Data are presented as percentage increase in number of invaded cells towards RSC-96 relative to DMEM treated controls. B, E, one-way ANOVA with Tukey's post hoc analysis; C, Mann-Whitney U-test, F, H, student's t-test.

    Journal: Heliyon

    Article Title: Reciprocal interactions between cancer and Schwann cells contribute to oral cancer progression and pain

    doi: 10.1016/j.heliyon.2019.e01223

    Figure Lengend Snippet: Schwann cells promote oral SCC proliferation, migration, and invasion. (A) To study the effect of RSC-96 cells on proliferation, HSC-3 or DOK cells were cultured in the lower chamber, and RSC-96 cells were cultured in the cell inserts. Cell culture media DMEM in the lower chamber was used as control. (B) Growth rate of HSC-3 cells, measured with the RTCA, increased with RSC-96 cell number. (C) HSC-3 cells proliferated more than DOK when co-cultured with RSC-96 cells. Data are presented as a percentage increase in OD from DMEM treated controls. (D) To study the effect of RSC-96 on cancer cell migration, HSC-3 or DOK cells were cultured in migration chambers with RSC-96 cells or DMEM (control) in the bottom chamber. (E) HSC-3 cells migrated towards RSC-96 cells in a cell number dependent manner. (F) HSC-3 cells migrated more than DOK towards RSC-96 cells. Data are presented as a percentage increase in number of migrated cells towards RSC-96 relative to DMEM controls. (G) To study effect of RSC-96 cells on cancer cell invasion, HSC-3 and DOK cells were cultured in invasion chambers with RSC-96 cells seeded at the bottom chamber. Bottom chambers containing DMEM alone were used as controls. (H) Increased invasion of HSC-3 cells compared to DOK cells in the presence of RSC-96 cells. Data are presented as percentage increase in number of invaded cells towards RSC-96 relative to DMEM treated controls. B, E, one-way ANOVA with Tukey's post hoc analysis; C, Mann-Whitney U-test, F, H, student's t-test.

    Article Snippet: To study the effect of cancer cells on Schwann cell intracellular Ca2+ levels, RSC-96 cells were seeded onto glass coverslips and co-cultured with either inserts (3-μm pore size, Corning) containing DMEM alone, inserts with DOK culture, or inserts with HSC-3 culture ( A).

    Techniques: Migration, Cell Culture, MANN-WHITNEY

    Role of noncanonical Wnt pathway in the migration of mMSCs. The horizontal migration of mMSCs incubated in 2% DMEM/F12 media supplemented with 500 ng/ml Wnt5a or 500 ng/ml Wnt5a plus 2.5 µmol/L GF109203X or 5 µmol/L SP600125 was examined by wound healing assay ( A ×200; n = 3; # P

    Journal: PLoS ONE

    Article Title: Wnt5a through Noncanonical Wnt/JNK or Wnt/PKC Signaling Contributes to the Differentiation of Mesenchymal Stem Cells into Type II Alveolar Epithelial Cells In Vitro

    doi: 10.1371/journal.pone.0090229

    Figure Lengend Snippet: Role of noncanonical Wnt pathway in the migration of mMSCs. The horizontal migration of mMSCs incubated in 2% DMEM/F12 media supplemented with 500 ng/ml Wnt5a or 500 ng/ml Wnt5a plus 2.5 µmol/L GF109203X or 5 µmol/L SP600125 was examined by wound healing assay ( A ×200; n = 3; # P

    Article Snippet: Briefly, 1×104 mMSCs and MLE-12 cells in 1.5 ml or 1 ml DMEM/F12 media supplemented with 10% FBS were, respectively, seeded in the lower or upper chambers of Transwell inserts (0.4-µm pore size, 4.5 cm2 , Corning, Inc., Corning, NY, USA) to establish the co-culture system.

    Techniques: Migration, Incubation, Wound Healing Assay

    Role of noncanonical Wnt signaling in the proliferation of mMSCs. The proliferation of mMSCs was evaluated using MTT assay after incubation in 2% FBS-DMEM/F12 media supplemented with increasing concentrations of Wnt5a ( A ) or 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X ( B ) for 72 h. ( n = 4; # P

    Journal: PLoS ONE

    Article Title: Wnt5a through Noncanonical Wnt/JNK or Wnt/PKC Signaling Contributes to the Differentiation of Mesenchymal Stem Cells into Type II Alveolar Epithelial Cells In Vitro

    doi: 10.1371/journal.pone.0090229

    Figure Lengend Snippet: Role of noncanonical Wnt signaling in the proliferation of mMSCs. The proliferation of mMSCs was evaluated using MTT assay after incubation in 2% FBS-DMEM/F12 media supplemented with increasing concentrations of Wnt5a ( A ) or 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X ( B ) for 72 h. ( n = 4; # P

    Article Snippet: Briefly, 1×104 mMSCs and MLE-12 cells in 1.5 ml or 1 ml DMEM/F12 media supplemented with 10% FBS were, respectively, seeded in the lower or upper chambers of Transwell inserts (0.4-µm pore size, 4.5 cm2 , Corning, Inc., Corning, NY, USA) to establish the co-culture system.

    Techniques: MTT Assay, Incubation

    Modulation of noncanonical Wnt signaling in mMSCs with the supplementation of Wnt5a, SP600125 or GF109203X in general culture conditions. The p-PKC (pan) (β II Ser660), p-PKCα/β II (Thr638/641), PKC pan, p-SAPK/JNK (Thr183/Tyr185), SAPK/JNK, p-CamK II, CamK II β/γ/δ, and nuclear β-catenin levels in mMSCs cultured in 10% FBS-DMEM/F12 media added with different concentrations of Wnt5a ( A ) or 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X for 2 hours were evaluated through western blotting ( B ). (n = 3; * P

    Journal: PLoS ONE

    Article Title: Wnt5a through Noncanonical Wnt/JNK or Wnt/PKC Signaling Contributes to the Differentiation of Mesenchymal Stem Cells into Type II Alveolar Epithelial Cells In Vitro

    doi: 10.1371/journal.pone.0090229

    Figure Lengend Snippet: Modulation of noncanonical Wnt signaling in mMSCs with the supplementation of Wnt5a, SP600125 or GF109203X in general culture conditions. The p-PKC (pan) (β II Ser660), p-PKCα/β II (Thr638/641), PKC pan, p-SAPK/JNK (Thr183/Tyr185), SAPK/JNK, p-CamK II, CamK II β/γ/δ, and nuclear β-catenin levels in mMSCs cultured in 10% FBS-DMEM/F12 media added with different concentrations of Wnt5a ( A ) or 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X for 2 hours were evaluated through western blotting ( B ). (n = 3; * P

    Article Snippet: Briefly, 1×104 mMSCs and MLE-12 cells in 1.5 ml or 1 ml DMEM/F12 media supplemented with 10% FBS were, respectively, seeded in the lower or upper chambers of Transwell inserts (0.4-µm pore size, 4.5 cm2 , Corning, Inc., Corning, NY, USA) to establish the co-culture system.

    Techniques: Cell Culture, Western Blot

    Role of noncanonical Wnt pathway in the H 2 O 2 -induced cellular toxicity of mMSCs. The viability of mMSCs after treatment with increasing concentrations of H 2 O 2 supplemented in 2% FBS-DMEM/F12 growth media for 12 hours was determined using an MTT assay ( A , n = 4). The expressions of p-PKCα/β II (Thr638/641), p-PKC (pan) (β II Ser660), p-SAPK/JNK (Thr183/Tyr185), p- CamK II, PKC pan, SAPK/JNK, CamK II β/γ/δ in mMSCs with 0.2 mmol/L H 2 O 2 treatment for 12 hours were analyzed using western blotting ( B , n = 3). The effect of pretreatment mMSCs with 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X for 1 hour on mMSC survival ( C , n = 4) and the expression of Bcl-2 and Bax ( D , n = 3) influenced by 0.2 mmol/L H 2 O 2 for 12 hours were analyzed using MTT assay and western blotting. (# P

    Journal: PLoS ONE

    Article Title: Wnt5a through Noncanonical Wnt/JNK or Wnt/PKC Signaling Contributes to the Differentiation of Mesenchymal Stem Cells into Type II Alveolar Epithelial Cells In Vitro

    doi: 10.1371/journal.pone.0090229

    Figure Lengend Snippet: Role of noncanonical Wnt pathway in the H 2 O 2 -induced cellular toxicity of mMSCs. The viability of mMSCs after treatment with increasing concentrations of H 2 O 2 supplemented in 2% FBS-DMEM/F12 growth media for 12 hours was determined using an MTT assay ( A , n = 4). The expressions of p-PKCα/β II (Thr638/641), p-PKC (pan) (β II Ser660), p-SAPK/JNK (Thr183/Tyr185), p- CamK II, PKC pan, SAPK/JNK, CamK II β/γ/δ in mMSCs with 0.2 mmol/L H 2 O 2 treatment for 12 hours were analyzed using western blotting ( B , n = 3). The effect of pretreatment mMSCs with 500 ng/ml Wnt5a plus 5 µmol/L SP600125 or 2.5 µmol/L GF109203X for 1 hour on mMSC survival ( C , n = 4) and the expression of Bcl-2 and Bax ( D , n = 3) influenced by 0.2 mmol/L H 2 O 2 for 12 hours were analyzed using MTT assay and western blotting. (# P

    Article Snippet: Briefly, 1×104 mMSCs and MLE-12 cells in 1.5 ml or 1 ml DMEM/F12 media supplemented with 10% FBS were, respectively, seeded in the lower or upper chambers of Transwell inserts (0.4-µm pore size, 4.5 cm2 , Corning, Inc., Corning, NY, USA) to establish the co-culture system.

    Techniques: MTT Assay, Western Blot, Expressing

    LY inhibits TGF-β1-induced activation of NOF cells, suppresses SMAD signaling and reduces the expression of HGSOC stroma-associated genes. ( A ) NOF cells were treated with increasing concentrations of TGF-β1 for 24 h and cell lysates were collected to measure the α-SMA expression by western blot. ( B ) NOF cells were pre-treated with indicated concentrations of LY for 12 h followed by the induction of TGF-β1 (5 ng/mL) for 24 h and α-SMA expression was analyzed by Western blot. ( C ) TGF-β1-activated NOF (NOF-CAF) cells were grown in TGF-β1-free Dulbecco’s modified eagle medium (DMEM). Cell lysates were collected from the 1, 3, 5, 7, and 10 days and α-SMA expression was analyzed by Western blot. ( D ) NOF-CAF cells were treated with LY (1 μM) for 24 h and TGF-βR1 expression was analyzed by qPCR. ( E ) NOF-CAF cells were treated with LY for 48 h and p-SMAD2 and p-SMAD3 expression were analyzed by Western blot. Total SMAD2 and SMAD3 were used as loading controls. ( F ) NOF-CAF cells were co-cultured with OVCAR8 cells using the Transwell system. TGF-β1 was added with or without the pre-treatment with LY and total RNA from TGF-β1-activated NOF cells collected to determine the expression of COL5A1 , COL11A1 , TIMP3 , and VCAN by qPCR.

    Journal: Cancers

    Article Title: LY2157299 Monohydrate, a TGF-βR1 Inhibitor, Suppresses Tumor Growth and Ascites Development in Ovarian Cancer

    doi: 10.3390/cancers10080260

    Figure Lengend Snippet: LY inhibits TGF-β1-induced activation of NOF cells, suppresses SMAD signaling and reduces the expression of HGSOC stroma-associated genes. ( A ) NOF cells were treated with increasing concentrations of TGF-β1 for 24 h and cell lysates were collected to measure the α-SMA expression by western blot. ( B ) NOF cells were pre-treated with indicated concentrations of LY for 12 h followed by the induction of TGF-β1 (5 ng/mL) for 24 h and α-SMA expression was analyzed by Western blot. ( C ) TGF-β1-activated NOF (NOF-CAF) cells were grown in TGF-β1-free Dulbecco’s modified eagle medium (DMEM). Cell lysates were collected from the 1, 3, 5, 7, and 10 days and α-SMA expression was analyzed by Western blot. ( D ) NOF-CAF cells were treated with LY (1 μM) for 24 h and TGF-βR1 expression was analyzed by qPCR. ( E ) NOF-CAF cells were treated with LY for 48 h and p-SMAD2 and p-SMAD3 expression were analyzed by Western blot. Total SMAD2 and SMAD3 were used as loading controls. ( F ) NOF-CAF cells were co-cultured with OVCAR8 cells using the Transwell system. TGF-β1 was added with or without the pre-treatment with LY and total RNA from TGF-β1-activated NOF cells collected to determine the expression of COL5A1 , COL11A1 , TIMP3 , and VCAN by qPCR.

    Article Snippet: Cell Culture and Reagents All OC cell lines were maintained in Dulbecco’s modified eagle medium (DMEM) medium (Corning) with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 μg/mL of streptomycin in humidified air with 5% CO2 at 37 °C.

    Techniques: Activation Assay, Expressing, Western Blot, Modification, Real-time Polymerase Chain Reaction, Cell Culture

    Effect of TGFα on KGN cell proliferation. A ) KGN cells were treated without (CTL) or with TGFα (10 ng/ml) in DMEM supplied with increasing amounts of serum for 48 hours and cell numbers were counted. B ) KGN cells were treated without (Control) or with TGFα and/or different kinase inhibitors in DMEM for 48 hours and cell numbers were counted. Bars represented means ± SEM, Bars with different letters are significantly different ( P

    Journal: PLoS ONE

    Article Title: Transforming Growth Factor Alpha (TGF?) Regulates Granulosa Cell Tumor (GCT) Cell Proliferation and Migration through Activation of Multiple Pathways

    doi: 10.1371/journal.pone.0048299

    Figure Lengend Snippet: Effect of TGFα on KGN cell proliferation. A ) KGN cells were treated without (CTL) or with TGFα (10 ng/ml) in DMEM supplied with increasing amounts of serum for 48 hours and cell numbers were counted. B ) KGN cells were treated without (Control) or with TGFα and/or different kinase inhibitors in DMEM for 48 hours and cell numbers were counted. Bars represented means ± SEM, Bars with different letters are significantly different ( P

    Article Snippet: KGN cells (4×105 ) in 250 µl of serum-free DMEM with or without 10 ng/ml of TGFα were placed in a Transwell® insert (8 µm pore size, Corning-Costar, Lowell, MA).

    Techniques: CTL Assay