Structured Review

Thermo Fisher dtt
BQ-induced enzyme inactivation and covalent modification of purified <t>Trx1</t> protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. <t>DTT-reduced</t> Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p
Dtt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2501 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dtt/product/Thermo Fisher
Average 99 stars, based on 2501 article reviews
Price from $9.99 to $1999.99
dtt - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway"

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

Journal: Redox Biology

doi: 10.1016/j.redox.2019.101400

BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p
Figure Legend Snippet: BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p

Techniques Used: Modification, Purification, Concentration Assay, Inhibition, Activity Assay, Incubation, SDS Page, Staining

Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).
Figure Legend Snippet: Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).

Techniques Used: Modification, Incubation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p
Figure Legend Snippet: Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p

Techniques Used: Activity Assay, Modification, Incubation, SDS Page, Silver Staining

BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.
Figure Legend Snippet: BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.

Techniques Used: Incubation, SDS Page, Silver Staining

2) Product Images from "A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions"

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1633250100

Oligomeric status and the regulation of CFTR channel activity by GST-PDZ1 and GST-PDZ2. ( A ) Analysis of chemically cross-linked proteins under nonreducing (-DTT) and reducing (+DTT) conditions by SDS/PAGE. In the absence of DTT ( Left ), the top bands (double arrowheads) represent cross-linked dimers of GST-PDZ1 and GST-PDZ2, and the (faint) bottom band (single arrowhead) represents uncross-linked monomer. In contrast, no bands corresponding to dimers of individual PDZ domains are seen, suggesting that they exist as monomers. The dimers migrate as doublets due to the presence of intramolecular cross-links. In the presence of DTT ( Right ), only monomeric species are seen. ( B ) Functional effects of GST-PDZ1 and GST-PDZ2 on CFTR channel activity. Representative experiment containing four CFTR channels and their stimulation by addition of GST-PDZ1 and effect of subsequent addition of PKC on CFTR P o . Numbers indicate number of open channel levels. Summary of CFTR P o under various experimental conditions using GST-PDZ1 ( C ) and GST-PDZ2 ( D ). * and ** indicate significant difference of P o after addition of PDZ1–2 peptide and after addition of PKC, respectively.
Figure Legend Snippet: Oligomeric status and the regulation of CFTR channel activity by GST-PDZ1 and GST-PDZ2. ( A ) Analysis of chemically cross-linked proteins under nonreducing (-DTT) and reducing (+DTT) conditions by SDS/PAGE. In the absence of DTT ( Left ), the top bands (double arrowheads) represent cross-linked dimers of GST-PDZ1 and GST-PDZ2, and the (faint) bottom band (single arrowhead) represents uncross-linked monomer. In contrast, no bands corresponding to dimers of individual PDZ domains are seen, suggesting that they exist as monomers. The dimers migrate as doublets due to the presence of intramolecular cross-links. In the presence of DTT ( Right ), only monomeric species are seen. ( B ) Functional effects of GST-PDZ1 and GST-PDZ2 on CFTR channel activity. Representative experiment containing four CFTR channels and their stimulation by addition of GST-PDZ1 and effect of subsequent addition of PKC on CFTR P o . Numbers indicate number of open channel levels. Summary of CFTR P o under various experimental conditions using GST-PDZ1 ( C ) and GST-PDZ2 ( D ). * and ** indicate significant difference of P o after addition of PDZ1–2 peptide and after addition of PKC, respectively.

Techniques Used: Activity Assay, SDS Page, Functional Assay

3) Product Images from "Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway"

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

Journal: Redox Biology

doi: 10.1016/j.redox.2019.101400

BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p
Figure Legend Snippet: BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p

Techniques Used: Modification, Purification, Concentration Assay, Inhibition, Activity Assay, Incubation, SDS Page, Staining

Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).
Figure Legend Snippet: Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).

Techniques Used: Modification, Incubation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p
Figure Legend Snippet: Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p

Techniques Used: Activity Assay, Modification, Incubation, SDS Page, Silver Staining

BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.
Figure Legend Snippet: BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.

Techniques Used: Incubation, SDS Page, Silver Staining

4) Product Images from "Characterization of Polyethylene Glycol–Reinforced Alginate Microcapsules for Mechanically Stable Cell Immunoisolation"

Article Title: Characterization of Polyethylene Glycol–Reinforced Alginate Microcapsules for Mechanically Stable Cell Immunoisolation

Journal: Macromolecular materials and engineering

doi: 10.1002/mame.201800679

Microcapsule Permeability Analysis and Extrapolated Diffusion Coefficients. A–E) 4 and 10 kDa FITC-Dextran release curves for the ALG, MM-DTT, MM-PEGSH, PEG-DTT, and PEG-PEGSH capsules, respectively. FITC diffusion into solution was sampled periodically over time from t = 0 h to t = 24 h. F) Theoretical diffusion coefficients for the materials were extrapolated from the experimental data.
Figure Legend Snippet: Microcapsule Permeability Analysis and Extrapolated Diffusion Coefficients. A–E) 4 and 10 kDa FITC-Dextran release curves for the ALG, MM-DTT, MM-PEGSH, PEG-DTT, and PEG-PEGSH capsules, respectively. FITC diffusion into solution was sampled periodically over time from t = 0 h to t = 24 h. F) Theoretical diffusion coefficients for the materials were extrapolated from the experimental data.

Techniques Used: Permeability, Diffusion-based Assay

Related Articles

Centrifugation:

Article Title: Defining the right diluent for intravenous infusion of therapeutic antibodies
Article Snippet: Reduction and alkylation of cysteine residues were achieved by adding 1 µL 0.5 M DTT and incubation at 37°C for 30 minutes followed by adding 6 µL 375 mM iodoacetamide (ThermoFisher, cat. no. A39271) and incubating for an additional 30 minutes in dark. .. After centrifugation at 4°C and 21,000 g for 3 minutes, guanidine in the resultant pellets was removed by washing three times with an ice-cold 0.5 mL 1:1 (v/v) mixture of ethanol and ethyl acetate.

Article Title: Proteomic phenotyping of metastatic melanoma reveals putative signatures of MEK inhibitor response and prognosis
Article Snippet: By adding 1 µL formic acid (FA, Ajax Finchem) the digestion was quenched and the SDC precipitated and removed by centrifugation (14.000 rpm) for 5 min. .. The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel.

Synthesized:

Article Title: Effect of NS398 on metastasis-associated gene expression in a human colon cancer cell line
Article Snippet: First strand cDNA was synthesized by priming 10mg total RNA with 6 mg random hexamers (Life Technologies Inc., Rockville, MD, USA) by heating at 70°C for 10 min, snap-cooling on ice for 30 s and placed at room temperature for additional 5-10 min. .. Reverse transcription was performed in the presence of 500 mmol/L each of dATP, dCTP and dGTP, 200 mmol/L aminoallyl-dUTP (Sigma Chemical Co., St. Louis, MO, USA), 300 mmol/L dTTP, 1 first strand buffer, 10 mmol/L dithiolthreitol, and 400 U superscript II (Life Technologies) in 30 mL reaction at 42°C overnight.

Autoradiography:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: After drying, phosphorylated proteins were detected by autoradiography and quantified by densitometric analysis using a PhosphorImager system or by scanning films. .. Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen).

SYBR Green Assay:

Article Title: Human sperm displays rapid responses to diet
Article Snippet: Samples were then immediately placed on ice for 2 minutes, followed by the addition of 6.45 μl of RT mix, 4 μl 5X First Strand buffer, 2 μl 0.1M DTT, 0.2 μl RNase OUT, and 0.25 μl Superscript III (Thermo Scientific, Waltham, MA). .. Resulting cDNA was diluted 1:5, before qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (BioRad, Hercules, CA), with tsRNA specific forward primer (LysCTT: TGGGACTCTTAATCCCAGGG; MT_SerTGA: AAAGTCATGGAGGCCATGGG) and a universal reverse primer on the stem loop adapter (GTGCAGGGTCCGAGGT).

Incubation:

Article Title: The DEAD-box protein Dbp2p is linked to noncoding RNAs, the helicase Sen1p, and R-loops
Article Snippet: .. Next, 0.8 μL 5× first-strand buffer, 0.2 μL 1 M DTT, 0.2 μL RNase inhibitor, 0.2 μL Superscript III (Invitrogen) were added and incubated for 60 min at 50°C. .. RNA was degraded by alkaline hydrolysis (after the addition of 0.5 μL of 1 N NaOH and incubation at 98°C for 15 min).

Article Title: Effect of NS398 on metastasis-associated gene expression in a human colon cancer cell line
Article Snippet: Reverse transcription was performed in the presence of 500 mmol/L each of dATP, dCTP and dGTP, 200 mmol/L aminoallyl-dUTP (Sigma Chemical Co., St. Louis, MO, USA), 300 mmol/L dTTP, 1 first strand buffer, 10 mmol/L dithiolthreitol, and 400 U superscript II (Life Technologies) in 30 mL reaction at 42°C overnight. .. Aliquot of Cy3 NHS ester dye (Amersham Pharmacia Biotech, UK) was dissolved in 4.5 mL Me2 SO (1mg dye from one tube was dissolved in 73 mL of Me2 SO and aliquot in 16 tubes, dried in speed vacuum and stored at 4°C) and added to the resuspended cDNA and reactions were incubated at room temperature in the dark for 1 h. Coupling reactions were quenched by addition of 41 mL 0.1 mol/L sodium acetate (pH 5.2), and unincorporated dye was removed using QIAquick PCR purification kit (Qiagen, Germany) following manufacturer's instructions.

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen). .. Purified WT and mutant (S162D) GST-PDZ2 proteins at various concentrations in 0.5 ml of PBS were incubated with a biotinylated peptide (1 μM) corresponding to the terminal 18 aa of CFTR for 1 h at 37°C.

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway
Article Snippet: .. 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT. .. Samples were loaded on to 12-well SDS-PAGE gels (4–12% Bis-Tris Gel, Invitrogen) and subjected to electrophoresis using NuPAGE MES SDS running buffer (Invitrogen) at 200 V for 40 min.

Article Title: Defining the right diluent for intravenous infusion of therapeutic antibodies
Article Snippet: .. Reduction and alkylation of cysteine residues were achieved by adding 1 µL 0.5 M DTT and incubation at 37°C for 30 minutes followed by adding 6 µL 375 mM iodoacetamide (ThermoFisher, cat. no. A39271) and incubating for an additional 30 minutes in dark. .. After adding 2 µL 0.5 M DTT and incubation at room temperature for 5 minutes to terminate the reaction, 110 µL ice cold 20% trichloroacetic acid was mixed with the solution on ice for 5 minutes to allow precipitation of both proteins and guanidine.

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: The plate was read at 340 nm to establish background absorbance before hexokinase (25 μL of 10 U/mL) was added to each well and incubated for 25 min. Absorbance was read again at 340 nm and [glucose] was calculated according to the standard curve. .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison.

Article Title: Characterization of Polyethylene Glycol–Reinforced Alginate Microcapsules for Mechanically Stable Cell Immunoisolation
Article Snippet: Fabrication of 800 μm-diameter 5% PEG (PEG-maleimide 10 kDa 8 arms, Jenkem)—1.2% MVG (Pronova) ALG hybrid MicroMix capsules was also performed with an electrostatic droplet generator and 50 m M CaCl2 incubation as previously described. .. [ ] PEG crosslinking was achieved by further incubating capsules with 4:1 molar ratio of either DTT or PEGSH solutions for 1 min. MicroMix capsules were then washed three times in Hank’s balanced salt solution containing Ca2+ and Mg2+ (HBSS++ ) (Invitrogen).

Article Title: Human sperm displays rapid responses to diet
Article Snippet: In brief, 20 ng of sperm total RNA was incubated at 65 °C for 5 minutes with 0.5 μl 10 mM dNTPs and 1 μl tsRNA specific stem-loop RT primer (LysCTT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA ; MT_SerTGA: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACCC ). .. Samples were then immediately placed on ice for 2 minutes, followed by the addition of 6.45 μl of RT mix, 4 μl 5X First Strand buffer, 2 μl 0.1M DTT, 0.2 μl RNase OUT, and 0.25 μl Superscript III (Thermo Scientific, Waltham, MA).

Mass Spectrometry:

Article Title: Defining the right diluent for intravenous infusion of therapeutic antibodies
Article Snippet: Paragraph title: Liquid chromatography–tandem mass spectrometry ... Reduction and alkylation of cysteine residues were achieved by adding 1 µL 0.5 M DTT and incubation at 37°C for 30 minutes followed by adding 6 µL 375 mM iodoacetamide (ThermoFisher, cat. no. A39271) and incubating for an additional 30 minutes in dark.

Real-time Polymerase Chain Reaction:

Article Title: Human sperm displays rapid responses to diet
Article Snippet: Paragraph title: tsRNA validation using qPCR ... Samples were then immediately placed on ice for 2 minutes, followed by the addition of 6.45 μl of RT mix, 4 μl 5X First Strand buffer, 2 μl 0.1M DTT, 0.2 μl RNase OUT, and 0.25 μl Superscript III (Thermo Scientific, Waltham, MA).

Chromatography:

Article Title: Defining the right diluent for intravenous infusion of therapeutic antibodies
Article Snippet: Paragraph title: Liquid chromatography–tandem mass spectrometry ... Reduction and alkylation of cysteine residues were achieved by adding 1 µL 0.5 M DTT and incubation at 37°C for 30 minutes followed by adding 6 µL 375 mM iodoacetamide (ThermoFisher, cat. no. A39271) and incubating for an additional 30 minutes in dark.

Serial Dilution:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison. .. We blocked membranes overnight at 4 ° C in 5% w/v fat-free milk powder dissolved in TBS-T (Tris, 20 mM; NaCl, 137 mM; Tween-20, 0.1%v/v ), then incubated in 1:10 000 rabbit anti-HSP70 antibody for 1 h (Agrisera AS05_083A; recognizes both constitutive and inducible isoforms) and finally in 1:20 000 goat anti-rabbit IgG HRP conjugated antibody (Abcam ab6721) for 1 h. Membranes were rinsed with TBS-T solution five times after each antibody incubation.

Protein Concentration:

Article Title: Proteomic phenotyping of metastatic melanoma reveals putative signatures of MEK inhibitor response and prognosis
Article Snippet: The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel. .. The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel.

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: We used a PowerGen125 homogenizer at 50% power to subject the samples to 20 s bursts, and then spun solutions at 14 800 x g for 10 min. We assayed the supernatants for soluble protein concentration using the detergent-compatible DC assay against a BSA standard (Bio-Rad). .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison.

Sequencing:

Article Title: Proteomic phenotyping of metastatic melanoma reveals putative signatures of MEK inhibitor response and prognosis
Article Snippet: Trypsin (Promega, sequencing grade) was added in a 1:50 ration and proteins were enzymatically degraded overnight at 37 °C. .. The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel.

Recombinant:

Article Title: Evaluating the susceptibility of AGO2-loaded microRNAs to degradation by nucleases in vitro
Article Snippet: .. 100 mM creatine phosphate (Sigma Catalog # 27920G) 300 μg/ml creatine kinase (prepared in 1X PBS) (Roche Catalog # 10127566001) 4 mM ATP (Roche Catalog #11140965001) 1 mM GTP (Sigma, Catalog #45-G3776–25UMO) 20 mM DTT 1.2 U/μ1 RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific; Catalog # 10777019) Loading Buffer should be prepared just prior to use. .. 50 mM Tris-HCl, pH 7.4 150 mM NaCl 0.1% Nonidet P-40 (NP-40) cOmplete Mini EDTA-free Protease Inhibitor Cocktail Tablets (Roche/Millipore Sigma; Catalog # 11836170001); added according to manufacturer’s instructions.

DC Protein Assay:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: We used a PowerGen125 homogenizer at 50% power to subject the samples to 20 s bursts, and then spun solutions at 14 800 x g for 10 min. We assayed the supernatants for soluble protein concentration using the detergent-compatible DC assay against a BSA standard (Bio-Rad). .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison.

Mutagenesis:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen). .. Purified WT and mutant (S162D) GST-PDZ2 proteins at various concentrations in 0.5 ml of PBS were incubated with a biotinylated peptide (1 μM) corresponding to the terminal 18 aa of CFTR for 1 h at 37°C.

Bicinchoninic Acid Protein Assay:

Article Title: Proteomic phenotyping of metastatic melanoma reveals putative signatures of MEK inhibitor response and prognosis
Article Snippet: The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel. .. The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel.

Purification:

Article Title: The DEAD-box protein Dbp2p is linked to noncoding RNAs, the helicase Sen1p, and R-loops
Article Snippet: Purified RNAs were re-suspended in 89 μL RNase-free water, 11 μL 10× DNase I Buffer, 5 μL RNasin, 5 μL RQ1 DNase (all Promega) and incubated for 20 min at 37°C. .. Next, 0.8 μL 5× first-strand buffer, 0.2 μL 1 M DTT, 0.2 μL RNase inhibitor, 0.2 μL Superscript III (Invitrogen) were added and incubated for 60 min at 50°C.

Article Title: Effect of NS398 on metastasis-associated gene expression in a human colon cancer cell line
Article Snippet: Reverse transcription was performed in the presence of 500 mmol/L each of dATP, dCTP and dGTP, 200 mmol/L aminoallyl-dUTP (Sigma Chemical Co., St. Louis, MO, USA), 300 mmol/L dTTP, 1 first strand buffer, 10 mmol/L dithiolthreitol, and 400 U superscript II (Life Technologies) in 30 mL reaction at 42°C overnight. .. Reactions were neutralized with 10 mL 1 mol/L HCl and cDNA was purified with Amicon Microcon YM100 (Millipore Corporation, Bedford, MA, USA) according to the manufacturer's protocol. cDNA was dried in speed vacuum concentrator 5301 (Eppendorf, Germany) and resuspended in 4.5 mL 0.1 mol/L (pH 9.0) sodium carbonate buffer.

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: PBS (50 μl, pH 7.5) containing 1 μg of purified PDZ domains or purified GST-PDZ fusion proteins was treated with 1 mM (final concentration) of the thiol-cleavable cross-linker 3,3′-dithiobis(sulfosuccinimidyl propionate) (Pierce) for 1 h on ice. .. Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen).

Polymerase Chain Reaction:

Article Title: Effect of NS398 on metastasis-associated gene expression in a human colon cancer cell line
Article Snippet: Reverse transcription was performed in the presence of 500 mmol/L each of dATP, dCTP and dGTP, 200 mmol/L aminoallyl-dUTP (Sigma Chemical Co., St. Louis, MO, USA), 300 mmol/L dTTP, 1 first strand buffer, 10 mmol/L dithiolthreitol, and 400 U superscript II (Life Technologies) in 30 mL reaction at 42°C overnight. .. Aliquot of Cy3 NHS ester dye (Amersham Pharmacia Biotech, UK) was dissolved in 4.5 mL Me2 SO (1mg dye from one tube was dissolved in 73 mL of Me2 SO and aliquot in 16 tubes, dried in speed vacuum and stored at 4°C) and added to the resuspended cDNA and reactions were incubated at room temperature in the dark for 1 h. Coupling reactions were quenched by addition of 41 mL 0.1 mol/L sodium acetate (pH 5.2), and unincorporated dye was removed using QIAquick PCR purification kit (Qiagen, Germany) following manufacturer's instructions.

Polyacrylamide Gel Electrophoresis:

Article Title: The DEAD-box protein Dbp2p is linked to noncoding RNAs, the helicase Sen1p, and R-loops
Article Snippet: Next, 0.8 μL 5× first-strand buffer, 0.2 μL 1 M DTT, 0.2 μL RNase inhibitor, 0.2 μL Superscript III (Invitrogen) were added and incubated for 60 min at 50°C. .. After the addition of loading buffer, cDNA was applied to 10% denaturing polyacrylamide gel electrophoresis (PAGE) and stained with SYBR Gold.

Lysis:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: After rocking (4°C, 1 h), 40 μl of protein G-agarose (50%) was added, and the samples were rocked at 4°C for 1 h. The beads were washed three times with lysis buffer. .. Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen).

Silver Staining:

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway
Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT. .. The proteins were subsequently developed using silver staining [ ] and scanned using a flatbed scanner.

SDS Page:

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway
Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT. .. Samples were loaded on to 12-well SDS-PAGE gels (4–12% Bis-Tris Gel, Invitrogen) and subjected to electrophoresis using NuPAGE MES SDS running buffer (Invitrogen) at 200 V for 40 min.

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison. .. We blocked membranes overnight at 4 ° C in 5% w/v fat-free milk powder dissolved in TBS-T (Tris, 20 mM; NaCl, 137 mM; Tween-20, 0.1%v/v ), then incubated in 1:10 000 rabbit anti-HSP70 antibody for 1 h (Agrisera AS05_083A; recognizes both constitutive and inducible isoforms) and finally in 1:20 000 goat anti-rabbit IgG HRP conjugated antibody (Abcam ab6721) for 1 h. Membranes were rinsed with TBS-T solution five times after each antibody incubation.

Software:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison. .. Band densities for samples were determined against the standard curve using the ImageLab software (v 4.0, Bio-Rad).

Electrophoresis:

Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway
Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT. .. Samples were loaded on to 12-well SDS-PAGE gels (4–12% Bis-Tris Gel, Invitrogen) and subjected to electrophoresis using NuPAGE MES SDS running buffer (Invitrogen) at 200 V for 40 min.

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison. .. We blocked membranes overnight at 4 ° C in 5% w/v fat-free milk powder dissolved in TBS-T (Tris, 20 mM; NaCl, 137 mM; Tween-20, 0.1%v/v ), then incubated in 1:10 000 rabbit anti-HSP70 antibody for 1 h (Agrisera AS05_083A; recognizes both constitutive and inducible isoforms) and finally in 1:20 000 goat anti-rabbit IgG HRP conjugated antibody (Abcam ab6721) for 1 h. Membranes were rinsed with TBS-T solution five times after each antibody incubation.

Binding Assay:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen). .. In Vitro Binding Assays.

Agarose Gel Electrophoresis:

Article Title: Human sperm displays rapid responses to diet
Article Snippet: Samples were then immediately placed on ice for 2 minutes, followed by the addition of 6.45 μl of RT mix, 4 μl 5X First Strand buffer, 2 μl 0.1M DTT, 0.2 μl RNase OUT, and 0.25 μl Superscript III (Thermo Scientific, Waltham, MA). .. Product specificity was validated by agarose gel electrophoresis and by absence of signal in no-template and no-RT controls.

In Vitro:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen). .. In Vitro Binding Assays.

Homogenization:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: All five tissues collected were ground in liquid nitrogen to a fine powder, and a 15x weight-to-volume ratio was used to dilute the samples in 1x homogenisation buffer (50 mM Tris Base, 70 mM SDS) with the addition of 1X Protease Inhibitor Cocktail (PIC004.1, Bioshop Canada). .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison.

Quantitation Assay:

Article Title: Human sperm displays rapid responses to diet
Article Snippet: tsRNA validation using qPCR Quantitation of tsRNA using stem-loop retro-transcription (RT) has been described elsewhere [ ]. .. Samples were then immediately placed on ice for 2 minutes, followed by the addition of 6.45 μl of RT mix, 4 μl 5X First Strand buffer, 2 μl 0.1M DTT, 0.2 μl RNase OUT, and 0.25 μl Superscript III (Thermo Scientific, Waltham, MA).

Concentration Assay:

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: PBS (50 μl, pH 7.5) containing 1 μg of purified PDZ domains or purified GST-PDZ fusion proteins was treated with 1 mM (final concentration) of the thiol-cleavable cross-linker 3,3′-dithiobis(sulfosuccinimidyl propionate) (Pierce) for 1 h on ice. .. Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen).

Protease Inhibitor:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: All five tissues collected were ground in liquid nitrogen to a fine powder, and a 15x weight-to-volume ratio was used to dilute the samples in 1x homogenisation buffer (50 mM Tris Base, 70 mM SDS) with the addition of 1X Protease Inhibitor Cocktail (PIC004.1, Bioshop Canada). .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison.

Staining:

Article Title: The DEAD-box protein Dbp2p is linked to noncoding RNAs, the helicase Sen1p, and R-loops
Article Snippet: Next, 0.8 μL 5× first-strand buffer, 0.2 μL 1 M DTT, 0.2 μL RNase inhibitor, 0.2 μL Superscript III (Invitrogen) were added and incubated for 60 min at 50°C. .. After the addition of loading buffer, cDNA was applied to 10% denaturing polyacrylamide gel electrophoresis (PAGE) and stained with SYBR Gold.

Article Title: A kinase-regulated mechanism controls CFTR channel gating by disrupting bivalent PDZ domain interactions
Article Snippet: .. Cross-linked products were split into two aliquots (3:2) and were denatured and analyzed in a 4–12% gradient gel (Nu/PAGE) under nonreducing conditions (without DTT) or after cleaving the cross-linker by treatment with DTT (100 mM) for 10 min; they were then visualized by Simply Blue safe stain (Invitrogen). .. In Vitro Binding Assays.

Article Title: Proteomic phenotyping of metastatic melanoma reveals putative signatures of MEK inhibitor response and prognosis
Article Snippet: The tissue samples (20 µg) were mixed with the equivalent amount of 4× NuPAGE loading buffer (Thermo Fisher Scientific) with DTT, were loaded onto a 4–12% polyacrylamide gel (Thermo Fisher Scientific) and run for 1 cm into the gel. .. Gels were stained for an hour in Coomassie blue G-250.

Fluorescence In Situ Hybridization:

Article Title: The endemic and endangered Maugean Skate (Zearaja maugeana) exhibits short-term severe hypoxia tolerance
Article Snippet: .. Protein extracts were prepared for electrophoresis based on equivalent total protein content (15 μg/well) using 1x sample buffer (Life Technologies) and 50 mM DTT, then heated 5 min at 70 ° C. We separated proteins in a Bolt 4–12% Bis Tris SDS-PAGE gel (Life Technologies) with 200 V power for 34 min, then transferred to polyvinylidene difluoride (PVDF, Bio-Rad) membrane for 60 min at 30 V. Each gel had a three-point serial dilution of a reference fish to give a standard curve for comparison. .. We blocked membranes overnight at 4 ° C in 5% w/v fat-free milk powder dissolved in TBS-T (Tris, 20 mM; NaCl, 137 mM; Tween-20, 0.1%v/v ), then incubated in 1:10 000 rabbit anti-HSP70 antibody for 1 h (Agrisera AS05_083A; recognizes both constitutive and inducible isoforms) and finally in 1:20 000 goat anti-rabbit IgG HRP conjugated antibody (Abcam ab6721) for 1 h. Membranes were rinsed with TBS-T solution five times after each antibody incubation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher dtt
    Dynamic range of <t>roGFP2-Orp1</t> and HyPer-3 in transfected parasites within intact RBCs and after host cell lysis. After 15 s baseline monitoring, 3D7 parasites with intact or lysed host cells and transfected with roGFP2-Orp1 ( A ) or HyPer-3 ( C ) were exposed to 1 mM DIA and monitored for 2 min before adding 10 mM <t>DTT</t> at the CLSM. The fluorescence ratios (405/488 nm, 3D7 [roGFP2-Orp1] and 488/405 nm, 3D7 [HyPer-3] ) ( A, C ) at different time points are plotted against time. 3D7 [HyPer-3] ( C ) showed a higher DIA sensitivity than 3D7 [roGFP2-Orp1] ( A ) in both parasites residing in intact RBCs and those deprived of their host cell. Data from at least three trophozoites in three independent experiments were analyzed per data point. For measuring the dynamic range of both redox sensors in the parasites, the 405/488 nm ratio (3D7 [roGFP2-Orp1] ) ( B ) and the 488/405 nm ratio (3D7 [HyPer-3] ) ( D ) of fully oxidized and reduced probes were computed. The basal ratio, the ratio for 1 mM DIA, and 10 mM DTT after 2 min incubation (n > 27) of 3 independent experiments are shown. 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) with intact RBCs exhibited dynamic ranges of 5 and 7.3, respectively. The dynamic ranges for parasites after RBC lysis of 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) were 5.5 and 12.6, respectively. Mean values and standard error of the mean (SEM) are shown for all experiments. A one-way ANOVA test with 95% confidence intervals with the Dunnett’s Multiple Comparison Test was applied for statistical analysis of significance (*, p
    Dtt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2501 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dtt/product/Thermo Fisher
    Average 99 stars, based on 2501 article reviews
    Price from $9.99 to $1999.99
    dtt - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher m dithiothreitol
    Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) <t>dithiothreitol.</t> Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.
    M Dithiothreitol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m dithiothreitol/product/Thermo Fisher
    Average 93 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    m dithiothreitol - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    Dynamic range of roGFP2-Orp1 and HyPer-3 in transfected parasites within intact RBCs and after host cell lysis. After 15 s baseline monitoring, 3D7 parasites with intact or lysed host cells and transfected with roGFP2-Orp1 ( A ) or HyPer-3 ( C ) were exposed to 1 mM DIA and monitored for 2 min before adding 10 mM DTT at the CLSM. The fluorescence ratios (405/488 nm, 3D7 [roGFP2-Orp1] and 488/405 nm, 3D7 [HyPer-3] ) ( A, C ) at different time points are plotted against time. 3D7 [HyPer-3] ( C ) showed a higher DIA sensitivity than 3D7 [roGFP2-Orp1] ( A ) in both parasites residing in intact RBCs and those deprived of their host cell. Data from at least three trophozoites in three independent experiments were analyzed per data point. For measuring the dynamic range of both redox sensors in the parasites, the 405/488 nm ratio (3D7 [roGFP2-Orp1] ) ( B ) and the 488/405 nm ratio (3D7 [HyPer-3] ) ( D ) of fully oxidized and reduced probes were computed. The basal ratio, the ratio for 1 mM DIA, and 10 mM DTT after 2 min incubation (n > 27) of 3 independent experiments are shown. 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) with intact RBCs exhibited dynamic ranges of 5 and 7.3, respectively. The dynamic ranges for parasites after RBC lysis of 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) were 5.5 and 12.6, respectively. Mean values and standard error of the mean (SEM) are shown for all experiments. A one-way ANOVA test with 95% confidence intervals with the Dunnett’s Multiple Comparison Test was applied for statistical analysis of significance (*, p

    Journal: PLoS ONE

    Article Title: H2O2 dynamics in the malaria parasite Plasmodium falciparum

    doi: 10.1371/journal.pone.0174837

    Figure Lengend Snippet: Dynamic range of roGFP2-Orp1 and HyPer-3 in transfected parasites within intact RBCs and after host cell lysis. After 15 s baseline monitoring, 3D7 parasites with intact or lysed host cells and transfected with roGFP2-Orp1 ( A ) or HyPer-3 ( C ) were exposed to 1 mM DIA and monitored for 2 min before adding 10 mM DTT at the CLSM. The fluorescence ratios (405/488 nm, 3D7 [roGFP2-Orp1] and 488/405 nm, 3D7 [HyPer-3] ) ( A, C ) at different time points are plotted against time. 3D7 [HyPer-3] ( C ) showed a higher DIA sensitivity than 3D7 [roGFP2-Orp1] ( A ) in both parasites residing in intact RBCs and those deprived of their host cell. Data from at least three trophozoites in three independent experiments were analyzed per data point. For measuring the dynamic range of both redox sensors in the parasites, the 405/488 nm ratio (3D7 [roGFP2-Orp1] ) ( B ) and the 488/405 nm ratio (3D7 [HyPer-3] ) ( D ) of fully oxidized and reduced probes were computed. The basal ratio, the ratio for 1 mM DIA, and 10 mM DTT after 2 min incubation (n > 27) of 3 independent experiments are shown. 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) with intact RBCs exhibited dynamic ranges of 5 and 7.3, respectively. The dynamic ranges for parasites after RBC lysis of 3D7 [roGFP2-Orp1] ( B ) and 3D7 [HyPer-3] ( D ) were 5.5 and 12.6, respectively. Mean values and standard error of the mean (SEM) are shown for all experiments. A one-way ANOVA test with 95% confidence intervals with the Dunnett’s Multiple Comparison Test was applied for statistical analysis of significance (*, p

    Article Snippet: Purified recombinant roGFP2-Orp1 and HyPer-3/SypHer proteins were reduced with 5 mM DTT for 10 min and 20 mM DTT for 30 min, respectively, at 4°C, desalinated (ZebaTM Spin Desalting Columns, Thermo Scientific), and diluted in reaction buffer to a final concentration of 5 μ M. A 5-fold drug/redox-active compound dilution (25 μ l) was mixed with 100 μ l of 5 μ M roGFP2-Orp1/HyPer in a 96-well microplate (black, half-area, Greiner Bio-One, Frickenhausen).

    Techniques: Transfection, Lysis, Confocal Laser Scanning Microscopy, Fluorescence, Incubation

    Dynamic range of roGFP2-Orp1 and Mito-roGFP2-Orp1 in transfected NF54- attB parasites. NF54- attB parasites transfected with roGFP2-Orp1 or Mito-roGFP2-Orp1 were exposed to 1 mM DIA or 10 mM DTT for 2 min before blocking with 2 mM NEM. Fluorescence ratios of 405/488 nm were detected with CLSM. NF54 [roGFP2-Orp1] - attB parasites showed a slightly higher DIA sensitivity than NF54 [Mito-roGFP2-Orp1] - attB parasites. CLSM data were composed of values from at least 10–20 trophozoites analyzed per experiment. Mean values and standard errors of the means (±SEM) are shown for three independent experiments. A one-way ANOVA test with 95% confidence intervals with the Dunnett’s Multiple Comparison Test was applied for statistical analysis of significance (***p

    Journal: Scientific Reports

    Article Title: Hydrogen peroxide dynamics in subcellular compartments of malaria parasites using genetically encoded redox probes

    doi: 10.1038/s41598-017-10093-8

    Figure Lengend Snippet: Dynamic range of roGFP2-Orp1 and Mito-roGFP2-Orp1 in transfected NF54- attB parasites. NF54- attB parasites transfected with roGFP2-Orp1 or Mito-roGFP2-Orp1 were exposed to 1 mM DIA or 10 mM DTT for 2 min before blocking with 2 mM NEM. Fluorescence ratios of 405/488 nm were detected with CLSM. NF54 [roGFP2-Orp1] - attB parasites showed a slightly higher DIA sensitivity than NF54 [Mito-roGFP2-Orp1] - attB parasites. CLSM data were composed of values from at least 10–20 trophozoites analyzed per experiment. Mean values and standard errors of the means (±SEM) are shown for three independent experiments. A one-way ANOVA test with 95% confidence intervals with the Dunnett’s Multiple Comparison Test was applied for statistical analysis of significance (***p

    Article Snippet: Purified recombinant roGFP2-Orp1 protein was reduced with 20 mM DTT for 30 min at 4 °C, desalinated (ZebaTM Spin Desalting Columns, Thermo Scientific), and diluted in reaction buffer to a final concentration of 5 µM.

    Techniques: Transfection, Blocking Assay, Fluorescence, Confocal Laser Scanning Microscopy

    BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p

    Journal: Redox Biology

    Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

    doi: 10.1016/j.redox.2019.101400

    Figure Lengend Snippet: BQ-induced enzyme inactivation and covalent modification of purified Trx1 protein. (A) Concentration-dependent inhibition of Trx1 activity by BQ. DTT-reduced Trx1 (2.5 μM) was incubated with BQ (0.5–10 μM) in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), with Trx1 activity determined after 5 min of treatment. (B) BQ-induced quinoprotein detection. DTT-reduced Trx1 (10 μM) was incubated with BQ (5–40 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed by SDS-PAGE followed by NBT redox staining. (C) Free thiol detection using BEI labelling. DTT-reduced Trx1 (5 μM) was incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by incubation with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection. * p

    Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT.

    Techniques: Modification, Purification, Concentration Assay, Inhibition, Activity Assay, Incubation, SDS Page, Staining

    Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).

    Journal: Redox Biology

    Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

    doi: 10.1016/j.redox.2019.101400

    Figure Lengend Snippet: Identification of BQ-modified Cys residues in Trx1. DTT-reduced Trx1 (10 μM) was incubated with BQ (50 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The BQ-treated Trx1 was then digested using Lys-C at 37 °C overnight and analysed by LC-MS/MS (seen Materials and methods for further details). (A) Peptide 1, (B) Peptide 2, (C) Peptide 3 (cf. Table 1 ).

    Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT.

    Techniques: Modification, Incubation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p

    Journal: Redox Biology

    Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

    doi: 10.1016/j.redox.2019.101400

    Figure Lengend Snippet: Effect of GSH on BQ-induced enzyme activity loss, protein cross-linking and modification. Panels A, C, E: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) in the presence of GSH (5–1000 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). The samples were split into three portions. The remaining Trx activity was measured (panel A), samples were analysed by SDS-PAGE followed by silver staining (panel C), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel E). Panels B, D, F: DTT-reduced Trx1 (2.5 μM) was incubated with BQ (20 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6), then GSH (5–1000 μM) was added and incubated for another 5 min. The samples were then split into three portions and analysed, as described above, for remaining Trx activity (panel B), by SDS-PAGE followed by silver staining (panel D), or incubated with BEI (250 μM) in dark for 30 min at 37 °C, then analysed by SDS-PAGE followed by treatment with horseradish peroxidase-conjugated streptavidin and enhanced chemiluminescence detection (panel F). Data (mean ± standard deviations) from 3 independent experiments are presented in panels A and B. Representative images from 3 independent experiments are shown in panels (C - F). * p

    Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT.

    Techniques: Activity Assay, Modification, Incubation, SDS Page, Silver Staining

    BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.

    Journal: Redox Biology

    Article Title: Modification of Cys residues in human thioredoxin-1 by p-benzoquinone causes inhibition of its catalytic activity and activation of the ASK1/p38-MAPK signalling pathway

    doi: 10.1016/j.redox.2019.101400

    Figure Lengend Snippet: BQ-induced protein cross-linking. Human Trx1 (5 μM, A and B) and E. coli Trx (5 μM, C and D), pre-treated with DTT, were incubated with BQ (2–80 μM) for 5 min in 50 mM Tris-HCl containing 2 mM EDTA (pH 7.6). Samples were analysed under non-reducing (A and C) and reducing (B and D) conditions, and then analysed by SDS-PAGE with silver staining. Representative images from 3 independent experiments are shown in each panel.

    Article Snippet: 2.4 Assessment of Trx1 oligomerization Trx (human or E. coli ) was reduced using DTT as described above, then 5 μM protein was incubated with different concentrations of BQ (2–80 μM) for 5 min. Aliquots of samples were then removed and diluted 4-fold with loading buffer (LDS Sample Buffer (4X) from Thermo Fisher, containing lithium dodecyl sulfate at pH 8.5 with SERVA Blue G250 and phenol red) with or without DTT.

    Techniques: Incubation, SDS Page, Silver Staining

    Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) dithiothreitol. Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.

    Journal: The Journal of Biological Chemistry

    Article Title: Redox Regulation of Methionine Aminopeptidase 2 Activity *

    doi: 10.1074/jbc.M114.554253

    Figure Lengend Snippet: Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) dithiothreitol. Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.

    Article Snippet: Just before use, the active site disulfide bond of the oxidoreductase was reduced with 50 m m dithiothreitol and 50 m m tris-(2-carboxyethyl)phosphine (TCEP) for 1 h at 25 °C, and the reducing agents were removed by two passes through Zeba spin desalting columns equilibrated with phosphate-buffered saline (Thermo Scientific).

    Techniques: Labeling, SDS Page