dsdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs dsdna
    Schematic of a RecBCD-dependent repair of a double-strand break and a genomic rearrangement that might result. ( A ) i . The <t>dsDNA</t> sequences are identical. The DSB is indicated by the gray arrow. ii . The bright green triangles indicate the Chi sites on each strand that are oriented so that they would be recognized by RecBCD as it proceeds along the dsDNA from the DSB. The L χleft and L χright are the separations between the position of the DSB and the nearest appropriately oriented Chi site on each initiating strand. iii . RecBCD creates the two initiating ssDNAs, while the complementary strands are degraded or looped (dotted circles). L left and L right are the distances separating the DSB from the 3′ end of each initiating strand. Note that L left ≥ L χleft and L right ≥ L χright . iv . RecA mediated strand exchange creates heteroduplex products that reach the 3′ ends of the filaments . v . DNA polymerase (orange rectangles) extends both initiating ssDNAs by copying the complementary strands beginning at the 3′ end of an initiating strand in a RecA filament. ( B ) The red and blue lines represent two identical dsDNAs that include two copies of a repeated sequence, Copy 1 and Copy 2 separated by a non-repeated region. i . A DSB occurs near the center of Copy 1. ii . After the DSB, RecBCD creates two <t>ssDNA–RecA</t> filaments by loading RecA onto the initiating ssDNA created by RecBCD. The two ssDNA–RecA filaments are indicated by the green horizontal arrows pointing toward the 3′ end. iii . Both filaments pair with the sequence matched regions in Copy 2 and form sequence matched heteroduplex products that extend to the 3′ ends of the initiating strands. DNA synthesis then completes two dsDNAs. The sequence region that includes the heteroduplex products and the newly synthesized DNA is shown in purple. The completion of the dsDNA is followed by Holliday junction resolution that is a crossover on the right side. As a result, the upper dsDNA lacks the sequence region between the two copies, and the lower dsDNA has two copies of the region between the two repeats. The duplicated regions are highlighted by the yellow rectangles. ( C ) Schematic of a DSB that occurs in Copy 1 of a repeated sequence. The appropriately oriented Chi sites are indicated by the bright green triangles, and the direction of RecBCD is shown by the black arrows. Copy 1 only includes appropriately oriented Chi sites in the dark red strand, so only the dark red strand can terminate in a region of Copy 1. ( D ) Same as C), but the DSB occurs to the left of Copy 1, which changes the number of correctly oriented Chi site in this region. The light pink filament cannot include a region of Copy 1 because RecBCD moves away from the DSB. ( E ) In a different sequence than C), Copy 1 includes appropriately oriented Chi sites on both strands, allowing the rearrangement shown in B); however, this never occurs in any of the 12 enteric bacteria we studied in this work.
    Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements"

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1252

    Schematic of a RecBCD-dependent repair of a double-strand break and a genomic rearrangement that might result. ( A ) i . The dsDNA sequences are identical. The DSB is indicated by the gray arrow. ii . The bright green triangles indicate the Chi sites on each strand that are oriented so that they would be recognized by RecBCD as it proceeds along the dsDNA from the DSB. The L χleft and L χright are the separations between the position of the DSB and the nearest appropriately oriented Chi site on each initiating strand. iii . RecBCD creates the two initiating ssDNAs, while the complementary strands are degraded or looped (dotted circles). L left and L right are the distances separating the DSB from the 3′ end of each initiating strand. Note that L left ≥ L χleft and L right ≥ L χright . iv . RecA mediated strand exchange creates heteroduplex products that reach the 3′ ends of the filaments . v . DNA polymerase (orange rectangles) extends both initiating ssDNAs by copying the complementary strands beginning at the 3′ end of an initiating strand in a RecA filament. ( B ) The red and blue lines represent two identical dsDNAs that include two copies of a repeated sequence, Copy 1 and Copy 2 separated by a non-repeated region. i . A DSB occurs near the center of Copy 1. ii . After the DSB, RecBCD creates two ssDNA–RecA filaments by loading RecA onto the initiating ssDNA created by RecBCD. The two ssDNA–RecA filaments are indicated by the green horizontal arrows pointing toward the 3′ end. iii . Both filaments pair with the sequence matched regions in Copy 2 and form sequence matched heteroduplex products that extend to the 3′ ends of the initiating strands. DNA synthesis then completes two dsDNAs. The sequence region that includes the heteroduplex products and the newly synthesized DNA is shown in purple. The completion of the dsDNA is followed by Holliday junction resolution that is a crossover on the right side. As a result, the upper dsDNA lacks the sequence region between the two copies, and the lower dsDNA has two copies of the region between the two repeats. The duplicated regions are highlighted by the yellow rectangles. ( C ) Schematic of a DSB that occurs in Copy 1 of a repeated sequence. The appropriately oriented Chi sites are indicated by the bright green triangles, and the direction of RecBCD is shown by the black arrows. Copy 1 only includes appropriately oriented Chi sites in the dark red strand, so only the dark red strand can terminate in a region of Copy 1. ( D ) Same as C), but the DSB occurs to the left of Copy 1, which changes the number of correctly oriented Chi site in this region. The light pink filament cannot include a region of Copy 1 because RecBCD moves away from the DSB. ( E ) In a different sequence than C), Copy 1 includes appropriately oriented Chi sites on both strands, allowing the rearrangement shown in B); however, this never occurs in any of the 12 enteric bacteria we studied in this work.
    Figure Legend Snippet: Schematic of a RecBCD-dependent repair of a double-strand break and a genomic rearrangement that might result. ( A ) i . The dsDNA sequences are identical. The DSB is indicated by the gray arrow. ii . The bright green triangles indicate the Chi sites on each strand that are oriented so that they would be recognized by RecBCD as it proceeds along the dsDNA from the DSB. The L χleft and L χright are the separations between the position of the DSB and the nearest appropriately oriented Chi site on each initiating strand. iii . RecBCD creates the two initiating ssDNAs, while the complementary strands are degraded or looped (dotted circles). L left and L right are the distances separating the DSB from the 3′ end of each initiating strand. Note that L left ≥ L χleft and L right ≥ L χright . iv . RecA mediated strand exchange creates heteroduplex products that reach the 3′ ends of the filaments . v . DNA polymerase (orange rectangles) extends both initiating ssDNAs by copying the complementary strands beginning at the 3′ end of an initiating strand in a RecA filament. ( B ) The red and blue lines represent two identical dsDNAs that include two copies of a repeated sequence, Copy 1 and Copy 2 separated by a non-repeated region. i . A DSB occurs near the center of Copy 1. ii . After the DSB, RecBCD creates two ssDNA–RecA filaments by loading RecA onto the initiating ssDNA created by RecBCD. The two ssDNA–RecA filaments are indicated by the green horizontal arrows pointing toward the 3′ end. iii . Both filaments pair with the sequence matched regions in Copy 2 and form sequence matched heteroduplex products that extend to the 3′ ends of the initiating strands. DNA synthesis then completes two dsDNAs. The sequence region that includes the heteroduplex products and the newly synthesized DNA is shown in purple. The completion of the dsDNA is followed by Holliday junction resolution that is a crossover on the right side. As a result, the upper dsDNA lacks the sequence region between the two copies, and the lower dsDNA has two copies of the region between the two repeats. The duplicated regions are highlighted by the yellow rectangles. ( C ) Schematic of a DSB that occurs in Copy 1 of a repeated sequence. The appropriately oriented Chi sites are indicated by the bright green triangles, and the direction of RecBCD is shown by the black arrows. Copy 1 only includes appropriately oriented Chi sites in the dark red strand, so only the dark red strand can terminate in a region of Copy 1. ( D ) Same as C), but the DSB occurs to the left of Copy 1, which changes the number of correctly oriented Chi site in this region. The light pink filament cannot include a region of Copy 1 because RecBCD moves away from the DSB. ( E ) In a different sequence than C), Copy 1 includes appropriately oriented Chi sites on both strands, allowing the rearrangement shown in B); however, this never occurs in any of the 12 enteric bacteria we studied in this work.

    Techniques Used: Sequencing, DNA Synthesis, Synthesized

    DNA synthesis is required for a DNA polymerase to stabilize strand exchange products. ( A ) Schematic for experiments with M 3 ′ values of 0, 3, 5. ( B ) Graphic representation of the change in fluorescence (Δ F ) versus time curves from single trial experiments performed with dATP–ssDNA–RecA filaments and DNA Pol IV in which the blue, pink, and light-blue curves correspond to M 3′ values of 0, 3 and 5 base mismatches, respectively. Δ F is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. ( C ) Analogous experiments as (B), but with LF-Bsu polymerase instead of DNA Pol IV.
    Figure Legend Snippet: DNA synthesis is required for a DNA polymerase to stabilize strand exchange products. ( A ) Schematic for experiments with M 3 ′ values of 0, 3, 5. ( B ) Graphic representation of the change in fluorescence (Δ F ) versus time curves from single trial experiments performed with dATP–ssDNA–RecA filaments and DNA Pol IV in which the blue, pink, and light-blue curves correspond to M 3′ values of 0, 3 and 5 base mismatches, respectively. Δ F is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. ( C ) Analogous experiments as (B), but with LF-Bsu polymerase instead of DNA Pol IV.

    Techniques Used: DNA Synthesis, Fluorescence

    The presence of a second filament rescues instability caused by an ssDNA outgoing strand and a long homoduplex dsDNA (180 bp) that extends beyond the 3′ end of a filament. ( A ) Schematic of experiments with 66 bp of homoduplex dsDNA on the 3′ end of the filament and N values of 5, 20, 50 and 82 bp. ( B ) Graphic representation of the change in fluorescence (ΔΔ F ) versus time curves of the experiment represented in (A) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F is calculated as the difference between the measured fluorescence and the fluorescence for N = 5. The purple, red, and black curves correspond to N 2 = 82, 50 and 20 nt, respectively. ( C ) Schematic for experiments performed involving two filaments. In all of these experiments N 1 = 42. ( D ) Graphic representation of the change in fluorescence ΔΔ F versus time curves for single trials of the experiment represented in (C) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F was calculated as indicated above. Different N 2 values are represented with different curve colors, where purple, red and black correspond to N 2 = 82, 50 and 20 nt, respectively.
    Figure Legend Snippet: The presence of a second filament rescues instability caused by an ssDNA outgoing strand and a long homoduplex dsDNA (180 bp) that extends beyond the 3′ end of a filament. ( A ) Schematic of experiments with 66 bp of homoduplex dsDNA on the 3′ end of the filament and N values of 5, 20, 50 and 82 bp. ( B ) Graphic representation of the change in fluorescence (ΔΔ F ) versus time curves of the experiment represented in (A) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F is calculated as the difference between the measured fluorescence and the fluorescence for N = 5. The purple, red, and black curves correspond to N 2 = 82, 50 and 20 nt, respectively. ( C ) Schematic for experiments performed involving two filaments. In all of these experiments N 1 = 42. ( D ) Graphic representation of the change in fluorescence ΔΔ F versus time curves for single trials of the experiment represented in (C) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F was calculated as indicated above. Different N 2 values are represented with different curve colors, where purple, red and black correspond to N 2 = 82, 50 and 20 nt, respectively.

    Techniques Used: Fluorescence

    DNA synthesis stabilizes DSB repair occurring at a repeat. ( A ) Experimental schematic showing a typical ssDNA–RecA filament (orange line with blue ellipses) and 90 bp dsDNA. Δ L = D label – D init = 5 bp. The labeled dsDNA used in all of the experiments was the same, so each N value corresponds to a different filament sequence. For each N value, the green brackets highlight the green regions of the dsDNA that are homologous to the N bases at the 3′ end of the ssDNA. The other bases in the dsDNA are heterologous to the initiating ssDNA. The yellow region indicates D init = 15 bp. The remaining dsDNA is shown in magenta. The red circle and black star represent the rhodamine and fluorescein labels, respectively. They are positioned on the complementary (purple line) and outgoing (blue line) strands, respectively. ( B ) Graph representing the average over three trials of the change in fluorescence (Δ F ) versus time curves in experiments with dATP–ssDNA–RecA filaments and DNA Pol IV represented in A) for N = 75 (dark blue), 50 (red), 36 (gray), 20 (black), and heterologous filament (light blue). Δ F in counts per second (cps) is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. The error bars show the standard deviation based on three trials. ( C ) Same as B) in the presence of ATP–ssDNA–RecA filaments and LF-Bsu polymerase.
    Figure Legend Snippet: DNA synthesis stabilizes DSB repair occurring at a repeat. ( A ) Experimental schematic showing a typical ssDNA–RecA filament (orange line with blue ellipses) and 90 bp dsDNA. Δ L = D label – D init = 5 bp. The labeled dsDNA used in all of the experiments was the same, so each N value corresponds to a different filament sequence. For each N value, the green brackets highlight the green regions of the dsDNA that are homologous to the N bases at the 3′ end of the ssDNA. The other bases in the dsDNA are heterologous to the initiating ssDNA. The yellow region indicates D init = 15 bp. The remaining dsDNA is shown in magenta. The red circle and black star represent the rhodamine and fluorescein labels, respectively. They are positioned on the complementary (purple line) and outgoing (blue line) strands, respectively. ( B ) Graph representing the average over three trials of the change in fluorescence (Δ F ) versus time curves in experiments with dATP–ssDNA–RecA filaments and DNA Pol IV represented in A) for N = 75 (dark blue), 50 (red), 36 (gray), 20 (black), and heterologous filament (light blue). Δ F in counts per second (cps) is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. The error bars show the standard deviation based on three trials. ( C ) Same as B) in the presence of ATP–ssDNA–RecA filaments and LF-Bsu polymerase.

    Techniques Used: DNA Synthesis, Labeling, Sequencing, Fluorescence, Standard Deviation

    ΔΔ F versus time curves obtained with ATP–ssDNA–RecA filaments, LF-Bsu polymerase, and 180 bp labeled dsDNA construct. The purple, red and black curves correspond to N = 82, 50 and 20, respectively. ( A ) ΔΔ F versus time curves for one filament experiments with LF-Bsu, represented by the schematic shown in Figure 5A and after subtracting the heterologous DNA curve shown in Supplementary Figure S5A . ( B ) ΔΔ F versus time curves for two filament experiments in the presence of LF-Bsu, represented by the schematic shown in Figure 5C and after subtracting the heterologous DNA curve shown in Supplementary Figure S5B .
    Figure Legend Snippet: ΔΔ F versus time curves obtained with ATP–ssDNA–RecA filaments, LF-Bsu polymerase, and 180 bp labeled dsDNA construct. The purple, red and black curves correspond to N = 82, 50 and 20, respectively. ( A ) ΔΔ F versus time curves for one filament experiments with LF-Bsu, represented by the schematic shown in Figure 5A and after subtracting the heterologous DNA curve shown in Supplementary Figure S5A . ( B ) ΔΔ F versus time curves for two filament experiments in the presence of LF-Bsu, represented by the schematic shown in Figure 5C and after subtracting the heterologous DNA curve shown in Supplementary Figure S5B .

    Techniques Used: Labeling, Construct

    2) Product Images from "Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway"

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky943

    Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).
    Figure Legend Snippet: Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).

    Techniques Used: Modification, DNA Binding Assay, Incubation, Magnetic Beads, Western Blot, Binding Assay

    3) Product Images from "IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome"

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome

    Journal: JCI Insight

    doi: 10.1172/jci.insight.120179

    Autoantibody Immunoprecipitation of IFI16 is enhanced in the presence of dsDNA. ( A and B ) Serum samples from 56 Sjögren’s Syndrome patients positive for IFI16 antibodies by ELISA were used to immunoprecipitate IFI16 in the absence or presence of 150 bp dsDNA in 10:1 IFI16/dsDNA molar ratio. Immunoprecipitation products were electrophoresed and Western Blotted with a commercial IFI16 antibody. ( A ) Representative data from immunoprecipitations performed with 16 patients’ sera and an N-terminal mouse monoclonal antibody (MM) are shown. Sera 1 and 4 were negative for anti-IFI16 antibodies by ELISA and were included as negative controls. Input lanes contain one-fourth protein used in each serum immunoprecipitation. ( B ) All 56 immunoprecipitations were quantified by densitometry. For each, the ratio of immunoprecipitated IFI16 detected in the presence versus absence of dsDNA was calculated. The dotted line indicates a ratio of 1, denoting unchanged immunoprecipitation with or without dsDNA. Median with interquartile range are indicated with solid lines.
    Figure Legend Snippet: Autoantibody Immunoprecipitation of IFI16 is enhanced in the presence of dsDNA. ( A and B ) Serum samples from 56 Sjögren’s Syndrome patients positive for IFI16 antibodies by ELISA were used to immunoprecipitate IFI16 in the absence or presence of 150 bp dsDNA in 10:1 IFI16/dsDNA molar ratio. Immunoprecipitation products were electrophoresed and Western Blotted with a commercial IFI16 antibody. ( A ) Representative data from immunoprecipitations performed with 16 patients’ sera and an N-terminal mouse monoclonal antibody (MM) are shown. Sera 1 and 4 were negative for anti-IFI16 antibodies by ELISA and were included as negative controls. Input lanes contain one-fourth protein used in each serum immunoprecipitation. ( B ) All 56 immunoprecipitations were quantified by densitometry. For each, the ratio of immunoprecipitated IFI16 detected in the presence versus absence of dsDNA was calculated. The dotted line indicates a ratio of 1, denoting unchanged immunoprecipitation with or without dsDNA. Median with interquartile range are indicated with solid lines.

    Techniques Used: Immunoprecipitation, Enzyme-linked Immunosorbent Assay, Western Blot

    Generation of IFI16 cytoplasmic filaments in response to dsDNA transfection in epithelial cells in vitro. ( A–C ) Human salivary gland (HSG) cells were treated with recombinant IFNα prior to transfection with empty plasmid DNA. Cells were then fixed, permeabilized, and stained with anti-IFI16 antibody (green) and DAPI (blue). Representative confocal images at 100× magnification are shown. Camera settings were held constant between experiments. ( D ) Keratinocyte cultures were transfected with Rhodamine labeled Poly(dA:dT) (red) and then stained for IFI16 (green) and counterstained with DAPI (blue). A 3-dimensional rendering of a Z-stack series is shown. ( E ) DNA titration was performed in HSG cultures using increasing concentrations of plasmid DNA, followed by staining with anti-IFI16 (green) and DAPI (blue). Cells with cytoplasmic IFI16 were counted in 4 fields imaged at 40×. Mean values with standard deviation are indicated. * P
    Figure Legend Snippet: Generation of IFI16 cytoplasmic filaments in response to dsDNA transfection in epithelial cells in vitro. ( A–C ) Human salivary gland (HSG) cells were treated with recombinant IFNα prior to transfection with empty plasmid DNA. Cells were then fixed, permeabilized, and stained with anti-IFI16 antibody (green) and DAPI (blue). Representative confocal images at 100× magnification are shown. Camera settings were held constant between experiments. ( D ) Keratinocyte cultures were transfected with Rhodamine labeled Poly(dA:dT) (red) and then stained for IFI16 (green) and counterstained with DAPI (blue). A 3-dimensional rendering of a Z-stack series is shown. ( E ) DNA titration was performed in HSG cultures using increasing concentrations of plasmid DNA, followed by staining with anti-IFI16 (green) and DAPI (blue). Cells with cytoplasmic IFI16 were counted in 4 fields imaged at 40×. Mean values with standard deviation are indicated. * P

    Techniques Used: Transfection, In Vitro, Recombinant, Plasmid Preparation, Staining, Labeling, Titration, Standard Deviation

    4) Product Images from "RecA homology search is promoted by mechanical stress along the scanned duplex DNA"

    Article Title: RecA homology search is promoted by mechanical stress along the scanned duplex DNA

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr855

    RecA–ssDNA filaments bind to non-homologous dsDNA pulled by 3′5′ ends. Confocal microscope visualization (linearly enhanced for brightness and contrast) of fluorescent RecA–ssDNA filaments (white arrows) bound to λ dsDNA. The force applied to the bead is indicated by the yellow arrows.
    Figure Legend Snippet: RecA–ssDNA filaments bind to non-homologous dsDNA pulled by 3′5′ ends. Confocal microscope visualization (linearly enhanced for brightness and contrast) of fluorescent RecA–ssDNA filaments (white arrows) bound to λ dsDNA. The force applied to the bead is indicated by the yellow arrows.

    Techniques Used: Microscopy

    RecA–ssDNA binding to dsDNA. ( A ) Schematic representation of RecA-mediated reactions: incoming ssDNA (red line), outgoing strand (green line), complementary strand (purple line), Watson–Crick pairing (orange) and RecA: site I (gray region of oval) and site II (blue region of oval). ( B ) Schematic representation of the extension and tension on dsDNA bound to RecA–ssDNA filaments with pink highlighting base pairs under tension and yellow triangles indicating regions occupied by the L1 and L2 loops and their attached alpha helices which interact strongly with the incoming strand (i) dsDNA bound to the pre-synaptic filament (ii) dsDNA bound to a RecA–ssDNA filament in the post-strand exchange state ( C ) Schematic representation of the extension and tension on dsDNA with the same color scheme used in (B) (i) in the absence of external force (ii) with external force applied to the 3′5′-ends of one strand (iii) shear force applied to opposite ends of opposite strands (3′3′ or 5′5′ pulling) (iv) with external force applied to both strands at both ends (v) with external force applied to the 3′5′-ends of the complementary strand in the homology searching complex ( D ) Schematic representation of the extension-based assay for measuring the extension of dsDNA due to the binding of RecA–ssDNA filaments (i) λ dsDNA tethered between a capillary tube and a magnetic bead under force (arrow) that is extended without [Δ L , (i)] and with [Δ L RecA (ii–vi)] binding of non-homologous RecA–ssDNA filaments.
    Figure Legend Snippet: RecA–ssDNA binding to dsDNA. ( A ) Schematic representation of RecA-mediated reactions: incoming ssDNA (red line), outgoing strand (green line), complementary strand (purple line), Watson–Crick pairing (orange) and RecA: site I (gray region of oval) and site II (blue region of oval). ( B ) Schematic representation of the extension and tension on dsDNA bound to RecA–ssDNA filaments with pink highlighting base pairs under tension and yellow triangles indicating regions occupied by the L1 and L2 loops and their attached alpha helices which interact strongly with the incoming strand (i) dsDNA bound to the pre-synaptic filament (ii) dsDNA bound to a RecA–ssDNA filament in the post-strand exchange state ( C ) Schematic representation of the extension and tension on dsDNA with the same color scheme used in (B) (i) in the absence of external force (ii) with external force applied to the 3′5′-ends of one strand (iii) shear force applied to opposite ends of opposite strands (3′3′ or 5′5′ pulling) (iv) with external force applied to both strands at both ends (v) with external force applied to the 3′5′-ends of the complementary strand in the homology searching complex ( D ) Schematic representation of the extension-based assay for measuring the extension of dsDNA due to the binding of RecA–ssDNA filaments (i) λ dsDNA tethered between a capillary tube and a magnetic bead under force (arrow) that is extended without [Δ L , (i)] and with [Δ L RecA (ii–vi)] binding of non-homologous RecA–ssDNA filaments.

    Techniques Used: Binding Assay

    Interaction of RecA–ssDNA filaments with ssDNA during DNA ‘unzipping’. Representation of unzipping experiment: One λ dsDNA molecule (λ sp ) acts as spacer and the second λ dsDNA (λ µ ) is unzipped by force. λ µ contains a hairpin connecting its two constituent ssDNA strands at one terminus and a magnetic bead at the free terminus between λ sp and λµ. i is the extension distance for forces between ∼ 2 and 12 pN at which λ sp B-form duplex molecule is stretched out, but the λ µ molecule remains fully zipped. ii is the extension distance at which λ µ is fully unzipped, but the λ sp remains in B-form. ( A ) The initial extension before unzipping. ( B ) The extension after unzipping while a force > 15 pN is maintained. ( C ) The extension after the force has been lowered to ∼5 pN. ( D ) Extension versus force curves for unzipping. The force was first increased and then decreased. ( a ) No added protein or nucleoprotein filaments ( b ) ‘unrezippable’ control curve constructed by taking the sum of the extension versus force curves for λ sp alone and two times that for a λ ssDNA strand obtained by thermal melting of dsDNA. (Note: in this case rezipping is impossible because the complementary strand is not present.) ( c ) Unzipping in the presence of RecA–ssDNA filaments (M13 ssDNA). ( d ) Unzipping in the presence of free RecA protein. In (a), (c) and (d) curves generated by increasing force differed from those generated by decreasing force. In these cases, upturned arrowheads mark the ascending curves and down-turned arrowheads the descending ones.
    Figure Legend Snippet: Interaction of RecA–ssDNA filaments with ssDNA during DNA ‘unzipping’. Representation of unzipping experiment: One λ dsDNA molecule (λ sp ) acts as spacer and the second λ dsDNA (λ µ ) is unzipped by force. λ µ contains a hairpin connecting its two constituent ssDNA strands at one terminus and a magnetic bead at the free terminus between λ sp and λµ. i is the extension distance for forces between ∼ 2 and 12 pN at which λ sp B-form duplex molecule is stretched out, but the λ µ molecule remains fully zipped. ii is the extension distance at which λ µ is fully unzipped, but the λ sp remains in B-form. ( A ) The initial extension before unzipping. ( B ) The extension after unzipping while a force > 15 pN is maintained. ( C ) The extension after the force has been lowered to ∼5 pN. ( D ) Extension versus force curves for unzipping. The force was first increased and then decreased. ( a ) No added protein or nucleoprotein filaments ( b ) ‘unrezippable’ control curve constructed by taking the sum of the extension versus force curves for λ sp alone and two times that for a λ ssDNA strand obtained by thermal melting of dsDNA. (Note: in this case rezipping is impossible because the complementary strand is not present.) ( c ) Unzipping in the presence of RecA–ssDNA filaments (M13 ssDNA). ( d ) Unzipping in the presence of free RecA protein. In (a), (c) and (d) curves generated by increasing force differed from those generated by decreasing force. In these cases, upturned arrowheads mark the ascending curves and down-turned arrowheads the descending ones.

    Techniques Used: Construct, Generated

    Binding of RecA–ssDNA filaments to dsDNA pulled from different ends. ( A ) Δ L RecA versus force for 1000-nt filaments (magenta circles). λ dsDNAs are pulled on (i) 3′5′-ends of one strand, (ii) 3′3′-ends, (iii) 5′5′-ends, (iv) both ends of each of the two constituent strands of the dsDNA, respectively, and controls for each pulling technique in the absence of RecA (gray triangles). ( B ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′ends, 5′5′-ends, and both ends of each of the two constituent strands of the dsDNA; force range: 52-55 pN and negative controls shown in gray. ( C ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′-ends, 5′5′-ends and both ends of each of the two constituent strands of the dsDNA: force range: 52–57 pN; negative controls shown in gray. ( D ) Bar graphs for Δ L RecA values between 52 and 55 pN and 52 and 57 pN, for 1000-nt filaments. λ dsDNAs are pulled 3′5′-, 3′3′-, 5′5′- and both ends of both strands: positives (magenta) and controls (gray). In these experiments filaments were prepared in a buffer containing ATPγS and measured in a buffer containing ATPγS.
    Figure Legend Snippet: Binding of RecA–ssDNA filaments to dsDNA pulled from different ends. ( A ) Δ L RecA versus force for 1000-nt filaments (magenta circles). λ dsDNAs are pulled on (i) 3′5′-ends of one strand, (ii) 3′3′-ends, (iii) 5′5′-ends, (iv) both ends of each of the two constituent strands of the dsDNA, respectively, and controls for each pulling technique in the absence of RecA (gray triangles). ( B ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′ends, 5′5′-ends, and both ends of each of the two constituent strands of the dsDNA; force range: 52-55 pN and negative controls shown in gray. ( C ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′-ends, 5′5′-ends and both ends of each of the two constituent strands of the dsDNA: force range: 52–57 pN; negative controls shown in gray. ( D ) Bar graphs for Δ L RecA values between 52 and 55 pN and 52 and 57 pN, for 1000-nt filaments. λ dsDNAs are pulled 3′5′-, 3′3′-, 5′5′- and both ends of both strands: positives (magenta) and controls (gray). In these experiments filaments were prepared in a buffer containing ATPγS and measured in a buffer containing ATPγS.

    Techniques Used: Binding Assay

    RecA–ssDNA filaments extend non-homologous dsDNA pulled by 3′5′ ends. ( A ) Δ L RecA 's for λ dsDNAs controls with free ssDNA or λ dsDNA only (red, N = 87) and λ dsDNAs with RecA–ssDNA filaments (blue, N = 454). ( B ) Single molecule extension profiles for non-homologous binding. Different colors are used to represent the response for each different single molecule. The curves ending at positions corresponding to 1, 3 and 4 filaments are 57.0, 59.0 and 60.9 pN, respectively. The red and green curves ending at two-filament lengths correspond to 58.9 and 57.2 pN, respectively. The filaments were prepared in a buffer containing ATPγS, but measured in a buffer containing ATP Pauses at full filament lengths are indicated by horizontal bars the same color as the curve. ( C ) Δ L RecA probability distributions for periods of ≥2 s constant λ dsDNA length, for all filaments of 400–800 nt at 50–62 pN. ( D ) DNA extensions within homology search complexes on dsDNA (color) or λ ssDNA.
    Figure Legend Snippet: RecA–ssDNA filaments extend non-homologous dsDNA pulled by 3′5′ ends. ( A ) Δ L RecA 's for λ dsDNAs controls with free ssDNA or λ dsDNA only (red, N = 87) and λ dsDNAs with RecA–ssDNA filaments (blue, N = 454). ( B ) Single molecule extension profiles for non-homologous binding. Different colors are used to represent the response for each different single molecule. The curves ending at positions corresponding to 1, 3 and 4 filaments are 57.0, 59.0 and 60.9 pN, respectively. The red and green curves ending at two-filament lengths correspond to 58.9 and 57.2 pN, respectively. The filaments were prepared in a buffer containing ATPγS, but measured in a buffer containing ATP Pauses at full filament lengths are indicated by horizontal bars the same color as the curve. ( C ) Δ L RecA probability distributions for periods of ≥2 s constant λ dsDNA length, for all filaments of 400–800 nt at 50–62 pN. ( D ) DNA extensions within homology search complexes on dsDNA (color) or λ ssDNA.

    Techniques Used: Binding Assay

    5) Product Images from "Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA"

    Article Title: Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr013

    Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 , and 1 mM ATP at 10 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are several times higher than the minimum rate are indicated with the black lines next to each curve. A few lines labeled as 0× show absence of growth at the lowest forces or pauses at higher forces.
    Figure Legend Snippet: Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 , and 1 mM ATP at 10 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are several times higher than the minimum rate are indicated with the black lines next to each curve. A few lines labeled as 0× show absence of growth at the lowest forces or pauses at higher forces.

    Techniques Used: Labeling

    RecA polymerization in the absence of hydrolysis or negligible hydrolysis: elongation of one single dsDNA molecule in 1 mM ATP and 10 mM CaCl 2 , pH 7.6 at 21 pN, 32 pN, 44 pN and 54 pN (bottom curve to top curve, respectively).
    Figure Legend Snippet: RecA polymerization in the absence of hydrolysis or negligible hydrolysis: elongation of one single dsDNA molecule in 1 mM ATP and 10 mM CaCl 2 , pH 7.6 at 21 pN, 32 pN, 44 pN and 54 pN (bottom curve to top curve, respectively).

    Techniques Used:

    Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 and 1 mM ATPgS at 10 pN, 20 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are twice, three and six times the average rate, are indicated with the black lines next to each curve. In addition, periods where no growth is observed are indicated as 0×.
    Figure Legend Snippet: Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 and 1 mM ATPgS at 10 pN, 20 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are twice, three and six times the average rate, are indicated with the black lines next to each curve. In addition, periods where no growth is observed are indicated as 0×.

    Techniques Used:

    Nucleation through overstretching. ( A ) Overstretching curve for lambda-phage dsDNA. ( B ) Absence of growth without overstretching and constant force of 50 pN (black curve); however, a fast increase in force through the overstretching transition (sharp peak) can start RecA polymerization showing linear growth at 50 pN on dsDNA at pH 7.6, 10 mM MgCl 2 , 1 mM ATP and 1 µM RecA (gray and black curve). A rapid change in force between 47 and 55 pN is indicated by the arrow.
    Figure Legend Snippet: Nucleation through overstretching. ( A ) Overstretching curve for lambda-phage dsDNA. ( B ) Absence of growth without overstretching and constant force of 50 pN (black curve); however, a fast increase in force through the overstretching transition (sharp peak) can start RecA polymerization showing linear growth at 50 pN on dsDNA at pH 7.6, 10 mM MgCl 2 , 1 mM ATP and 1 µM RecA (gray and black curve). A rapid change in force between 47 and 55 pN is indicated by the arrow.

    Techniques Used:

    6) Product Images from "Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway"

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky943

    Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).
    Figure Legend Snippet: Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).

    Techniques Used: Modification, DNA Binding Assay, Incubation, Magnetic Beads, Western Blot, Binding Assay

    7) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    8) Product Images from "A novel nuclease-ATPase (Nar71) from archaea is part of a proposed thermophilic DNA repair system"

    Article Title: A novel nuclease-ATPase (Nar71) from archaea is part of a proposed thermophilic DNA repair system

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkh960

    ( A ) ATPase activity of Nar71 measured in malachite green assays. Reactions contained (i) 50 nM or (ii) 100 nM Nar71 and (iii) 3.3 mM Mg 2+ and 5 mM ATP. dsDNA or ssDNA (100 ng) was added as indicated. RecG (50 nM) was used as a comparison in 5 mM Mg 2+ and 5 mM ATP. In each panel, data are a mean of reactions in duplicate. ( B ) Time course reaction on 100 nM Nar71 containing 100 nM Nar71 and 100 ng ssDNA in 3.3 mM Mg 2+ and 5 mM ATP. Data are a mean of reactions in duplicate. ( C ) Effect of pre-incubating His-tag monoclonal antibody with tagged Nar71 (250 nM) prior to mixing with 5 nM 3′ flap DNA in 10 mM Mg 2+ and 15 mM ATP.
    Figure Legend Snippet: ( A ) ATPase activity of Nar71 measured in malachite green assays. Reactions contained (i) 50 nM or (ii) 100 nM Nar71 and (iii) 3.3 mM Mg 2+ and 5 mM ATP. dsDNA or ssDNA (100 ng) was added as indicated. RecG (50 nM) was used as a comparison in 5 mM Mg 2+ and 5 mM ATP. In each panel, data are a mean of reactions in duplicate. ( B ) Time course reaction on 100 nM Nar71 containing 100 nM Nar71 and 100 ng ssDNA in 3.3 mM Mg 2+ and 5 mM ATP. Data are a mean of reactions in duplicate. ( C ) Effect of pre-incubating His-tag monoclonal antibody with tagged Nar71 (250 nM) prior to mixing with 5 nM 3′ flap DNA in 10 mM Mg 2+ and 15 mM ATP.

    Techniques Used: Activity Assay

    9) Product Images from "Efficient assembly of very short oligonucleotides using T4 DNA Ligase"

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-3-291

    Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.
    Figure Legend Snippet: Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.

    Techniques Used: Activity Assay, Ligation

    10) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    11) Product Images from "Dynamics and stability of polymorphic human telomeric G-quadruplex under tension"

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku581

    Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.
    Figure Legend Snippet: Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.

    Techniques Used: Sequencing, Construct, Proton NMR

    12) Product Images from "Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates"

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkz810

    BLM is a fast and highly processive dsDNA helicase. ( A) Schematic illustration of the double-tethered DNA curtains assay. ( B ) Schematic showing experimental rational for the detection of dsDNA unwinding activity for unlabeled BLM as revealed by the binding of RPA-mCherry to the resulting ssDNA products. ( C ) Kymograph showing BLM (unlabeled) unwinding dsDNA (unlabeled) as revealed by the binding of RPA-mCherry (magenta); note that buffer flow was OFF during data collection. Arrowheads indicate the sites where BLM initiated dsDNA unwinding based upon the appearance of RPA-mCherry. Reactions contained 0.2 nM unlabeled BLM and 1 nM RPA-mCherry. ( D ) Distribution of sites where BLM initiated dsDNA unwinding; error bars represent 95% confidence intervals calculated from bootstrap analysis. (E) Quantification of BLM translocation direction in reactions with 1 nM RPA-mCherry. ‘Towards pedestal’ indicates BLM movement in the direction from the barrier to the pedestal, and ‘towards barrier’ indicates movement in the opposite direction. ( F ) Velocity distribution of BLM unwinding rates in reactions with 1 nM RPA-mCherry on double-tethered dsDNA. The solid blue line represents a Gaussian fit to the data. Error bars represent 95% confidence intervals calculated from bootstrap analysis. ( G ) Survival probability plot of BLM translocation with 1 nM RPA-mCherry on double-tethered dsDNA. Error bars represent 95% confidence intervals calculated from bootstrap analysis.
    Figure Legend Snippet: BLM is a fast and highly processive dsDNA helicase. ( A) Schematic illustration of the double-tethered DNA curtains assay. ( B ) Schematic showing experimental rational for the detection of dsDNA unwinding activity for unlabeled BLM as revealed by the binding of RPA-mCherry to the resulting ssDNA products. ( C ) Kymograph showing BLM (unlabeled) unwinding dsDNA (unlabeled) as revealed by the binding of RPA-mCherry (magenta); note that buffer flow was OFF during data collection. Arrowheads indicate the sites where BLM initiated dsDNA unwinding based upon the appearance of RPA-mCherry. Reactions contained 0.2 nM unlabeled BLM and 1 nM RPA-mCherry. ( D ) Distribution of sites where BLM initiated dsDNA unwinding; error bars represent 95% confidence intervals calculated from bootstrap analysis. (E) Quantification of BLM translocation direction in reactions with 1 nM RPA-mCherry. ‘Towards pedestal’ indicates BLM movement in the direction from the barrier to the pedestal, and ‘towards barrier’ indicates movement in the opposite direction. ( F ) Velocity distribution of BLM unwinding rates in reactions with 1 nM RPA-mCherry on double-tethered dsDNA. The solid blue line represents a Gaussian fit to the data. Error bars represent 95% confidence intervals calculated from bootstrap analysis. ( G ) Survival probability plot of BLM translocation with 1 nM RPA-mCherry on double-tethered dsDNA. Error bars represent 95% confidence intervals calculated from bootstrap analysis.

    Techniques Used: Activity Assay, Binding Assay, Recombinase Polymerase Amplification, Flow Cytometry, Translocation Assay

    BLM cannot dismantle RAD51-bound heteroduplex DNA joints. ( A ) Schematic illustration of heteroduplex joints prepared with RAD51–ssDNA curtains and an Atto565-labeled dsDNA oligonucleotide (70-bp) bearing 15-nts of sequence homologous to the M13-derived ssDNA substrate. ( B ) Percent of GFP–BLM (15 nM) molecules bound the Atto565-labeled heteroduplex DNA joints or bound elsewhere on the RAD51–ssDNA ( N = 116). (C) Kymograph showing outcomes of reactions containing GFP–BLM (15 nM) with RAD51–ssDNA curtains preassembled with the Atto565-labeled heteroduplex DNA joints; note that buffer flow was OFF during data collection. The Asterix highlights an example of bound GFP–BLM that did not co-localize with the heteroduplex DNA joint.
    Figure Legend Snippet: BLM cannot dismantle RAD51-bound heteroduplex DNA joints. ( A ) Schematic illustration of heteroduplex joints prepared with RAD51–ssDNA curtains and an Atto565-labeled dsDNA oligonucleotide (70-bp) bearing 15-nts of sequence homologous to the M13-derived ssDNA substrate. ( B ) Percent of GFP–BLM (15 nM) molecules bound the Atto565-labeled heteroduplex DNA joints or bound elsewhere on the RAD51–ssDNA ( N = 116). (C) Kymograph showing outcomes of reactions containing GFP–BLM (15 nM) with RAD51–ssDNA curtains preassembled with the Atto565-labeled heteroduplex DNA joints; note that buffer flow was OFF during data collection. The Asterix highlights an example of bound GFP–BLM that did not co-localize with the heteroduplex DNA joint.

    Techniques Used: Labeling, Sequencing, Derivative Assay, Flow Cytometry

    13) Product Images from "RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin"

    Article Title: RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin

    Journal: eLife

    doi: 10.7554/eLife.25299

    Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009
    Figure Legend Snippet: Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009

    Techniques Used: RNA Binding Assay, In Vitro, Competitive Binding Assay, Labeling, Binding Assay, Purification, Sequencing, Standard Deviation

    14) Product Images from "Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters"

    Article Title: Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2017.12.030

    DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.
    Figure Legend Snippet: DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.

    Techniques Used: Binding Assay, Methylation, Activity Assay, Real-time Polymerase Chain Reaction, Pull Down Assay

    15) Product Images from "Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters"

    Article Title: Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2017.12.030

    DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.
    Figure Legend Snippet: DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.

    Techniques Used: Binding Assay, Methylation, Activity Assay, Real-time Polymerase Chain Reaction, Pull Down Assay

    16) Product Images from "Complementary strand relocation may play vital roles in RecA-based homology recognition"

    Article Title: Complementary strand relocation may play vital roles in RecA-based homology recognition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks769

    Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.
    Figure Legend Snippet: Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.

    Techniques Used:

    Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.
    Figure Legend Snippet: Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.

    Techniques Used: Binding Assay

    Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).
    Figure Legend Snippet: Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).

    Techniques Used: Binding Assay, Concentration Assay

    Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.
    Figure Legend Snippet: Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.

    Techniques Used: Binding Assay, Construct

    17) Product Images from "Polymerization and mechanical properties of single RecA-DNA filaments"

    Article Title: Polymerization and mechanical properties of single RecA-DNA filaments

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Polymerization of RecA on dsDNA with or without force feedback. ( a ) Polymerization speed of two different RecA dsDNA fibers (●, ▴) polymerized at constant force of 64 pN in the presence of ATP[γS]. The time between points is 0.8 s, and a running average of 30 points was applied. Frame-grabber jitter of ≈20 nm probably causes the fast fluctuations. Both experiments shown, eventually covered the full length of the DNA. ( b ) Polymerization speed of three different RecA fibers without force feedback (see text). The figure shows the polymerization rate vs. the force applied to the growing DNA RecA fiber. ( Inset ) ln(rate) vs. force analysis of the slope allows one to extract the step size of the polymerization.
    Figure Legend Snippet: Polymerization of RecA on dsDNA with or without force feedback. ( a ) Polymerization speed of two different RecA dsDNA fibers (●, ▴) polymerized at constant force of 64 pN in the presence of ATP[γS]. The time between points is 0.8 s, and a running average of 30 points was applied. Frame-grabber jitter of ≈20 nm probably causes the fast fluctuations. Both experiments shown, eventually covered the full length of the DNA. ( b ) Polymerization speed of three different RecA fibers without force feedback (see text). The figure shows the polymerization rate vs. the force applied to the growing DNA RecA fiber. ( Inset ) ln(rate) vs. force analysis of the slope allows one to extract the step size of the polymerization.

    Techniques Used:

    F vs. extension plot for dsDNA–RecA ATP filaments. Fully coated dsDNA–RecA ATP form (empty circles correspond to the extension cycle and filled circles indicate the relaxation cycle). After RecA was depleted from the surrounding buffer an intermediate dsDNA–RecA ATP filament (triangles) that did not show any hysteresis as in the fully coated version showed up. The small dots correspond to dsDNA, shown here for reference.
    Figure Legend Snippet: F vs. extension plot for dsDNA–RecA ATP filaments. Fully coated dsDNA–RecA ATP form (empty circles correspond to the extension cycle and filled circles indicate the relaxation cycle). After RecA was depleted from the surrounding buffer an intermediate dsDNA–RecA ATP filament (triangles) that did not show any hysteresis as in the fully coated version showed up. The small dots correspond to dsDNA, shown here for reference.

    Techniques Used:

    18) Product Images from "Upgrading SELEX Technology by Using Lambda Exonuclease Digestion for Single-Stranded DNA Generation"

    Article Title: Upgrading SELEX Technology by Using Lambda Exonuclease Digestion for Single-Stranded DNA Generation

    Journal: Molecules

    doi: 10.3390/molecules15010001

    Digestion of the phosphorylated strand of dsDNA with 25 U lambda exonuclease after PCR with 1 ng template per reaction.
    Figure Legend Snippet: Digestion of the phosphorylated strand of dsDNA with 25 U lambda exonuclease after PCR with 1 ng template per reaction.

    Techniques Used: Polymerase Chain Reaction

    19) Product Images from "The poor homology stringency in the heteroduplex allows strand exchange to incorporate desirable mismatches without sacrificing recognition in vivo"

    Article Title: The poor homology stringency in the heteroduplex allows strand exchange to incorporate desirable mismatches without sacrificing recognition in vivo

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv610

    Molecular Dynamics simulation for poly dA-dT and poly dG-dT dsDNA in site I. ( A ) Schematic of the molecular dynamics simulation system. The solvation water is shown as the transparent box and the sodium and chloride ions are shown as pink and purple sphere, respectively. The molecule in surface representation is the RecA-DNA complex. ( B ) Structure of the matched and mismatched DNA in site I at the end of the 15 ns conventional MD simulation. The initiating, and matched and mismatched complementary strands are shown in yellow, cyan and green, respectively. The overlapping structures are obtained from the last 10 ns of the simulation with 1 ns gap. ( C and D ). Detail illustrations of the stable nucleotide triplet at the end of the simulation for matched and mismatched strands.
    Figure Legend Snippet: Molecular Dynamics simulation for poly dA-dT and poly dG-dT dsDNA in site I. ( A ) Schematic of the molecular dynamics simulation system. The solvation water is shown as the transparent box and the sodium and chloride ions are shown as pink and purple sphere, respectively. The molecule in surface representation is the RecA-DNA complex. ( B ) Structure of the matched and mismatched DNA in site I at the end of the 15 ns conventional MD simulation. The initiating, and matched and mismatched complementary strands are shown in yellow, cyan and green, respectively. The overlapping structures are obtained from the last 10 ns of the simulation with 1 ns gap. ( C and D ). Detail illustrations of the stable nucleotide triplet at the end of the simulation for matched and mismatched strands.

    Techniques Used:

    20) Product Images from "DIDS, a chemical compound that inhibits RAD51-mediated homologous pairing and strand exchange"

    Article Title: DIDS, a chemical compound that inhibits RAD51-mediated homologous pairing and strand exchange

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp200

    The strand-exchange assay with human RAD51. ( A ) A schematic diagram of the strand-exchange assay. ( B ) The strand exchange activity of RAD51 under the three different conditions. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecules and nicked circular DNA are indicated by jm and nc, respectively. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate experiments with RAD51 in the absence and presence of 0.2 M KCl, respectively. Lane 4 indicates an experiment with 5% methanol in the absence of 0.2 M KCl.
    Figure Legend Snippet: The strand-exchange assay with human RAD51. ( A ) A schematic diagram of the strand-exchange assay. ( B ) The strand exchange activity of RAD51 under the three different conditions. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecules and nicked circular DNA are indicated by jm and nc, respectively. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate experiments with RAD51 in the absence and presence of 0.2 M KCl, respectively. Lane 4 indicates an experiment with 5% methanol in the absence of 0.2 M KCl.

    Techniques Used: Activity Assay, Incubation, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Staining, Negative Control

    Effects of the DIDS reaction order on RAD51-mediated strand exchange. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA containing 2 μM 32 P-labeled ϕX174 linear dsDNA, in the absence of 0.2 M KCl. The reactions were stopped and deproteinized at the indicated times, and the products were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The jm products and dsDNA labeled by 32 P were visualized and quantified using an FLA-7000 imaging analyzer (Fujifilm). ( A ) RAD51 was incubated with DIDS (10 μM) at 37°C for 10 min. After the addition of the ϕX174 circular ssDNA, RPA was added to the reaction mixture. The ϕX174 linear dsDNA was then added to initiate the reaction. The reactions were continued for the indicated times. Lanes 1–4 indicate positive control experiments with RAD51 and 5% methanol. Lanes 5–8 indicate experiments with RAD51 and DIDS (and 5% methanol). Reaction times were 0 min (lanes 1 and 5), 30 min (lanes 2 and 6), 60 min (lanes 3 and 7) and 90 min (lanes 4 and 8). ( B ) Graphic representation of the experiments shown in (A). Closed and open circles indicate experiments with and without DIDS, respectively. ( C ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min. After this incubation, DIDS (10 μM) was added, followed by the addition of RPA. The ϕX174 linear dsDNA was then added to initiate the reaction. ( D ) Graphic representation of the experiments shown in (C). Closed and open circles indicate experiments with and without DIDS, respectively. ( E ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min, and RPA was added. DIDS was added, and then ϕX174 linear dsDNA was added to initiate the reaction. ( F ) Graphic representation of the experiments shown in (E). Closed and open circles indicate experiments with and without DIDS, respectively.
    Figure Legend Snippet: Effects of the DIDS reaction order on RAD51-mediated strand exchange. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA containing 2 μM 32 P-labeled ϕX174 linear dsDNA, in the absence of 0.2 M KCl. The reactions were stopped and deproteinized at the indicated times, and the products were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The jm products and dsDNA labeled by 32 P were visualized and quantified using an FLA-7000 imaging analyzer (Fujifilm). ( A ) RAD51 was incubated with DIDS (10 μM) at 37°C for 10 min. After the addition of the ϕX174 circular ssDNA, RPA was added to the reaction mixture. The ϕX174 linear dsDNA was then added to initiate the reaction. The reactions were continued for the indicated times. Lanes 1–4 indicate positive control experiments with RAD51 and 5% methanol. Lanes 5–8 indicate experiments with RAD51 and DIDS (and 5% methanol). Reaction times were 0 min (lanes 1 and 5), 30 min (lanes 2 and 6), 60 min (lanes 3 and 7) and 90 min (lanes 4 and 8). ( B ) Graphic representation of the experiments shown in (A). Closed and open circles indicate experiments with and without DIDS, respectively. ( C ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min. After this incubation, DIDS (10 μM) was added, followed by the addition of RPA. The ϕX174 linear dsDNA was then added to initiate the reaction. ( D ) Graphic representation of the experiments shown in (C). Closed and open circles indicate experiments with and without DIDS, respectively. ( E ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min, and RPA was added. DIDS was added, and then ϕX174 linear dsDNA was added to initiate the reaction. ( F ) Graphic representation of the experiments shown in (E). Closed and open circles indicate experiments with and without DIDS, respectively.

    Techniques Used: Incubation, Recombinase Polymerase Amplification, Labeling, Agarose Gel Electrophoresis, Imaging, Positive Control

    DIDS efficiently inhibits RAD51-mediated strand exchange. ( A ) DIDS titration experiments in the absence of 0.2 M KCl. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) in the presence of DIDS at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecule is indicated by jm. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 and 5% methanol in the absence of DIDS. DIDS concentrations were 0.01 μM (lane 3), 0.1 μM (lane 4), 1 μM (lane 5) and 10 μM (lane 6). Lane 7 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( B ) Graphic representation of the experiments shown in (A). The band intensities of the jm product were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (A, lane 2) were plotted against the DIDS concentration. ( C ) The strand-exchange assay in the presence of 0.2 M KCl. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate control experiments without DIDS with RAD51 in the absence and presence of 5% methanol, respectively. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( D ) Graphic representation of the experiments shown in (C). The band intensities of the jm products were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (C, lane 3) were plotted against the DIDS concentration.
    Figure Legend Snippet: DIDS efficiently inhibits RAD51-mediated strand exchange. ( A ) DIDS titration experiments in the absence of 0.2 M KCl. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) in the presence of DIDS at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecule is indicated by jm. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 and 5% methanol in the absence of DIDS. DIDS concentrations were 0.01 μM (lane 3), 0.1 μM (lane 4), 1 μM (lane 5) and 10 μM (lane 6). Lane 7 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( B ) Graphic representation of the experiments shown in (A). The band intensities of the jm product were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (A, lane 2) were plotted against the DIDS concentration. ( C ) The strand-exchange assay in the presence of 0.2 M KCl. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate control experiments without DIDS with RAD51 in the absence and presence of 5% methanol, respectively. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( D ) Graphic representation of the experiments shown in (C). The band intensities of the jm products were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (C, lane 3) were plotted against the DIDS concentration.

    Techniques Used: Titration, Incubation, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Staining, Negative Control, Concentration Assay

    The strand-exchange assay in the presence of chemical compounds. ( A ) Each chemical compound (10 μM, lanes 1–185) was incubated with RAD51 (6 μM), and the strand-exchange reaction was performed under the conditions containing 5% methanol at 37°C for 1 h with 20 μM ssDNA, 20 μM dsDNA and 2 μM RPA. Lanes C, R and M indicate negative control reactions without RAD51, complete reactions and complete reactions with 5% methanol, respectively. The chemical compounds are listed in Supplementary Table 1 . ( B ) Structure of 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS).
    Figure Legend Snippet: The strand-exchange assay in the presence of chemical compounds. ( A ) Each chemical compound (10 μM, lanes 1–185) was incubated with RAD51 (6 μM), and the strand-exchange reaction was performed under the conditions containing 5% methanol at 37°C for 1 h with 20 μM ssDNA, 20 μM dsDNA and 2 μM RPA. Lanes C, R and M indicate negative control reactions without RAD51, complete reactions and complete reactions with 5% methanol, respectively. The chemical compounds are listed in Supplementary Table 1 . ( B ) Structure of 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS).

    Techniques Used: Incubation, Recombinase Polymerase Amplification, Negative Control

    DIDS inhibits DNA binding by RAD51. ( A ) The ssDNA-binding experiments in the presence of ATP. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) in the presence of DIDS at 37°C for 15 min. The samples were analyzed by 0.8% agarose gel electrophoresis in 1× TAE buffer. The bands were visualized by ethidium bromide staining. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lane 7). Lane 8 indicates an experiment with 20 μM DIDS in the absence of RAD51. ( B ) The dsDNA-binding experiments in the presence of ATP. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( C ) The ssDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) at 37°C for 15 min. Lanes 1–4, lanes 5–8 and lanes 9–12 represent experiments with ATP, AMPPNP and ATPγS, respectively. Lanes 1, 5 and 9 indicate negative control experiments without RAD51. Lanes 2, 6 and 10 indicate experiments with RAD51 alone. Lanes 3, 7 and 11 indicate experiments with RAD51 and 5% methanol. Lanes 4, 8 and 12 indicate experiments with RAD51 and DIDS (20 μM). ( D ) The dsDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lanes correspond to those in (C). The DIDS concentration was 10 μM. ( E ) Effect of DIDS on the ssDNA binding of RPA. The ϕX174 circular ssDNA (40 μM) was incubated with RPA (0.5 μM) in the presence of DIDS at 37°C for 15 min. Lanes 1 and 8 indicate negative control experiments without RPA. Lanes 2 and 3 indicate experiments with RPA in the absence and presence of 5% methanol, respectively. The DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lanes 7 and 8). ( F ) The ssDNA-binding and dsDNA-binding experiments with RAD51 were performed in the presence of methanol. Lanes 1–6 and lanes 7–12 indicate experiments with ssDNA and dsDNA, respectively. Lanes 1, 6, 7 and 12 are negative controls without RAD51, and lanes 2 and 8 are positive controls with RAD51 in the absence of methanol. Methanol concentrations were 2.5% (lanes 3 and 9), 5% (lanes 4 and 10) and 10% (lanes 5, 6, 11 and 12).
    Figure Legend Snippet: DIDS inhibits DNA binding by RAD51. ( A ) The ssDNA-binding experiments in the presence of ATP. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) in the presence of DIDS at 37°C for 15 min. The samples were analyzed by 0.8% agarose gel electrophoresis in 1× TAE buffer. The bands were visualized by ethidium bromide staining. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lane 7). Lane 8 indicates an experiment with 20 μM DIDS in the absence of RAD51. ( B ) The dsDNA-binding experiments in the presence of ATP. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( C ) The ssDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) at 37°C for 15 min. Lanes 1–4, lanes 5–8 and lanes 9–12 represent experiments with ATP, AMPPNP and ATPγS, respectively. Lanes 1, 5 and 9 indicate negative control experiments without RAD51. Lanes 2, 6 and 10 indicate experiments with RAD51 alone. Lanes 3, 7 and 11 indicate experiments with RAD51 and 5% methanol. Lanes 4, 8 and 12 indicate experiments with RAD51 and DIDS (20 μM). ( D ) The dsDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lanes correspond to those in (C). The DIDS concentration was 10 μM. ( E ) Effect of DIDS on the ssDNA binding of RPA. The ϕX174 circular ssDNA (40 μM) was incubated with RPA (0.5 μM) in the presence of DIDS at 37°C for 15 min. Lanes 1 and 8 indicate negative control experiments without RPA. Lanes 2 and 3 indicate experiments with RPA in the absence and presence of 5% methanol, respectively. The DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lanes 7 and 8). ( F ) The ssDNA-binding and dsDNA-binding experiments with RAD51 were performed in the presence of methanol. Lanes 1–6 and lanes 7–12 indicate experiments with ssDNA and dsDNA, respectively. Lanes 1, 6, 7 and 12 are negative controls without RAD51, and lanes 2 and 8 are positive controls with RAD51 in the absence of methanol. Methanol concentrations were 2.5% (lanes 3 and 9), 5% (lanes 4 and 10) and 10% (lanes 5, 6, 11 and 12).

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis, Staining, Negative Control, Concentration Assay, Recombinase Polymerase Amplification

    21) Product Images from "Complementary strand relocation may play vital roles in RecA-based homology recognition"

    Article Title: Complementary strand relocation may play vital roles in RecA-based homology recognition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks769

    Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.
    Figure Legend Snippet: Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.

    Techniques Used:

    Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.
    Figure Legend Snippet: Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.

    Techniques Used: Binding Assay

    Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).
    Figure Legend Snippet: Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).

    Techniques Used: Binding Assay, Concentration Assay

    Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.
    Figure Legend Snippet: Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.

    Techniques Used: Binding Assay, Construct

    22) Product Images from "RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin"

    Article Title: RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin

    Journal: eLife

    doi: 10.7554/eLife.25299

    Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009
    Figure Legend Snippet: Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009

    Techniques Used: RNA Binding Assay, In Vitro, Competitive Binding Assay, Labeling, Binding Assay, Purification, Sequencing, Standard Deviation

    23) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    Competitive fluorescence quenching of ethidium bromide bound to calf thymus (ct-DNA) by opioid drugs MC3, HC3 and OC3 , viscosity properties of MC3 , ethidium bromide and spermine ( SPM ) exposed to salmon testes dsDNA, and turbidity profiles of CT-DNA in the presence of titrated C 3 opioids and spermine. Data points being displayed as an average of triplicate measurement for fluorescence quenching and turbidity measurements.
    Figure Legend Snippet: Competitive fluorescence quenching of ethidium bromide bound to calf thymus (ct-DNA) by opioid drugs MC3, HC3 and OC3 , viscosity properties of MC3 , ethidium bromide and spermine ( SPM ) exposed to salmon testes dsDNA, and turbidity profiles of CT-DNA in the presence of titrated C 3 opioids and spermine. Data points being displayed as an average of triplicate measurement for fluorescence quenching and turbidity measurements.

    Techniques Used: Fluorescence

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.
    Figure Legend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Techniques Used: Generated, Incubation

    Related Articles

    Amplification:

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site
    Article Snippet: .. The competitors used for competition between ssRNA and dsRNA and between ssDNA and dsDNA were as follows: ssRNA, full-length in vitro -transcribed S9 RNA transcript; dsRNA, annealing product of the plus and minus strands of the full-length S9 RNA; ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplification product of full-length RBSDV S9. ..

    DNA Synthesis:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: .. DNA synthesis using non-phosphorylated octamer precursors Simultaneous phosphorylation-ligation reactions consisted of 1.5 μM immobilized dsDNA on beads, 22.5 μM of each octamer, 1× T4 DNA ligase buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM Dithiothreitol, pH 7.5 @ 25°C), 0.5 units/μL of T4 Polynucleotide Kinase (NEB) and 0.5 units/μL of T4 DNA Ligase. ..

    Construct:

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: Paragraph title: DNA construct and NMR ... Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB).

    Adsorption:

    Article Title: Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA
    Article Snippet: After an aliquot of dsDNA in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) was mixed with RecA (New England Biolabs), ATP or ATPγS, and the beads, it was placed in a square micro-cell with cross-section of 0.8 mm × 0.8 mm containing a round inner capillary, 0.55 mm in diameter and closed at its ends. .. The inner capillary was modified by adsorption of 1 mg/ml extravidin in PBS (phosphate-buffered saline) pH 7.4 overnight at room temperature.

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ). .. The downstream ends of the ssDNA or dsDNA were then anchored to exposed Cr pedestals either through non-specific adsorption (for ssDNA) or through an antibody-DIG interaction (for dsDNA), as described ( , ).

    Nuclear Magnetic Resonance:

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: Paragraph title: DNA construct and NMR ... Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB).

    Activity Assay:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes). .. Nuclease activity was confirmed by agarose gel electrophoresis.

    Modification:

    Article Title: Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA
    Article Snippet: After an aliquot of dsDNA in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) was mixed with RecA (New England Biolabs), ATP or ATPγS, and the beads, it was placed in a square micro-cell with cross-section of 0.8 mm × 0.8 mm containing a round inner capillary, 0.55 mm in diameter and closed at its ends. .. The inner capillary was modified by adsorption of 1 mg/ml extravidin in PBS (phosphate-buffered saline) pH 7.4 overnight at room temperature.

    Article Title: RecA homology search is promoted by mechanical stress along the scanned duplex DNA
    Article Snippet: After each modification step was completed, the dsDNA sample was washed three times using Amicon YM-100 filters (Millipore, USA) and 70 mM Tris buffer pH 7.6. .. A 0.2 µl aliquot of each dsDNA at 7 µg/µl in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) containing 1 mM ATP (or ATPγS) was mixed with free RecA (New England Biolabs) (final concentration 1 µM) or with preparations of RecA–ssDNA filaments (ranging in size from 57 to 7200 nt and final concentration 60 nM) and 1 µl of the beads.

    Article Title: A novel nuclease-ATPase (Nar71) from archaea is part of a proposed thermophilic DNA repair system
    Article Snippet: Reactions contained 3.3 mM MgCl2 and 5 mM ATP and either zero, 50 nM or 100 nM Nar71 protein, and were at 45°C for 1 h. ssDNA (ØX174 virion) or dsDNA (ØX174 RFI), both from New England Biolabs, were added as required to 100 ng. .. Hydrolysis of [γ-32 P]ATP to 32 P was visualized from 20 μl strand displacement reactions that were modified to contain 1 mM MgCl2 and 2 mM ATP, supplemented with [γ-32 P]ATP.

    Western Blot:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Immunoprecipitates were analyzed by SDS-PAGE and Western blotting as previously described ( ) using anti-IFI16 antibody (Santa Cruz Biotechnology Inc., 1G7, 1:1,000 dilution). .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Flow Cytometry:

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: Flow cells and ssDNA curtains were prepared as previously described ( , , ). .. For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ).

    Immunoprecipitation:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Paragraph title: IFI16 immunoprecipitation and nuclease treatment. ... For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Transferring:

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: .. FRET measurements Strand exchange reactions were performed by mixing an aliquot of 0.06 μM 98 nt ssDNA/RecA filament, 0.06 μM labeled dsDNA, and 1 μM Escherichia coli DNA Polymerase IV (Pol IV) or 5 units Bacillus subtilis DNA polymerase, Large fragment (LF-Bsu) (New England Biolabs (NEB), 5000 units/ml) and rapidly transferring the solution to a quartz cuvette. ..

    Generated:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Recombinant IFI16 (isoform 2) protein was generated as previously described, as both full-length protein and as a C-terminal truncation lacking amino acids 597-721 ( ). .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: The ssDNA substrate was generated using rolling circle replication with a biotinylated primer, a circular M13 ssDNA template, and phi29 DNA polymerase, as described ( , , ). .. For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ).

    Polymerase Chain Reaction:

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site
    Article Snippet: .. The competitors used for competition between ssRNA and dsRNA and between ssDNA and dsDNA were as follows: ssRNA, full-length in vitro -transcribed S9 RNA transcript; dsRNA, annealing product of the plus and minus strands of the full-length S9 RNA; ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplification product of full-length RBSDV S9. ..

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: PCR products were purified using PureLink PCR purification kit (Invitrogen) and digested with BstXI restriction enzyme (NEB). .. Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB).

    Injection:

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ). .. The biotinylated ssDNA or dsDNA was injected into the sample chamber and attached to the bilayer through a biotin–streptavidin linkage.

    Recombinant:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Recombinant IFI16 (isoform 2) protein was generated as previously described, as both full-length protein and as a C-terminal truncation lacking amino acids 597-721 ( ). .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Fluorescence:

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: Single- and double-strand DNA curtains All experiments were conducted with a prism–type total internal reflection fluorescence (TIRF) microscope (Nikon) equipped with a 488-nm laser (Coherent Sapphire, 200 mW), a 561-nm laser (Coherent Sapphire, 200 mW), and two Andor iXon EMCCD cameras ( , ). .. For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ).

    Magnetic Beads:

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway
    Article Snippet: Paragraph title: HLTF binding to M13mp18 ss or double-stranded (ds) DNA tethered to magnetic beads ... To convert ss M13mp18 DNA into dsDNA, 650 ng of ss M13mp18 DNA annealed to the biotinylated primer was incubated with 10 U of T7 DNA polymerase (New England Biolabs) in a reaction buffer containing 0.33 mM each of dGTP, dATP, dTTP and dCTP at 37°C for 15 min.

    Microscopy:

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: Single- and double-strand DNA curtains All experiments were conducted with a prism–type total internal reflection fluorescence (TIRF) microscope (Nikon) equipped with a 488-nm laser (Coherent Sapphire, 200 mW), a 561-nm laser (Coherent Sapphire, 200 mW), and two Andor iXon EMCCD cameras ( , ). .. For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ).

    Purification:

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: PCR products were purified using PureLink PCR purification kit (Invitrogen) and digested with BstXI restriction enzyme (NEB). .. Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB).

    Labeling:

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site
    Article Snippet: The competitors used for competition between ssRNA and dsRNA and between ssDNA and dsDNA were as follows: ssRNA, full-length in vitro -transcribed S9 RNA transcript; dsRNA, annealing product of the plus and minus strands of the full-length S9 RNA; ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplification product of full-length RBSDV S9. .. The ratios of unlabeled competitor to labeled RNA were calculated from masses of nucleic acid.

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: The 5′-thiol labeled 1449 bp and 5′-biotin labeled 601 bp dsDNA handles were prepared by PCR using DreamTaq DNA polymerase (Thermo Scientific) on lambda phage DNA template (New England Biolabs, NEB) using 5′-thiol and 5′-biotin primers. .. Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB).

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates
    Article Snippet: .. For assays with dsDNA, the substrates were prepared using λ-phage DNA (48.5 kb; NEB Cat No. N3011S) that was biotinylated at one end and labeled with digoxigenin (DIG) at the other end, as previously described ( , ). .. The biotinylated ssDNA or dsDNA was injected into the sample chamber and attached to the bilayer through a biotin–streptavidin linkage.

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: .. FRET measurements Strand exchange reactions were performed by mixing an aliquot of 0.06 μM 98 nt ssDNA/RecA filament, 0.06 μM labeled dsDNA, and 1 μM Escherichia coli DNA Polymerase IV (Pol IV) or 5 units Bacillus subtilis DNA polymerase, Large fragment (LF-Bsu) (New England Biolabs (NEB), 5000 units/ml) and rapidly transferring the solution to a quartz cuvette. ..

    SDS Page:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Immunoprecipitates were analyzed by SDS-PAGE and Western blotting as previously described ( ) using anti-IFI16 antibody (Santa Cruz Biotechnology Inc., 1G7, 1:1,000 dilution). .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Binding Assay:

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway
    Article Snippet: Paragraph title: HLTF binding to M13mp18 ss or double-stranded (ds) DNA tethered to magnetic beads ... To convert ss M13mp18 DNA into dsDNA, 650 ng of ss M13mp18 DNA annealed to the biotinylated primer was incubated with 10 U of T7 DNA polymerase (New England Biolabs) in a reaction buffer containing 0.33 mM each of dGTP, dATP, dTTP and dCTP at 37°C for 15 min.

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: FRET measurements Strand exchange reactions were performed by mixing an aliquot of 0.06 μM 98 nt ssDNA/RecA filament, 0.06 μM labeled dsDNA, and 1 μM Escherichia coli DNA Polymerase IV (Pol IV) or 5 units Bacillus subtilis DNA polymerase, Large fragment (LF-Bsu) (New England Biolabs (NEB), 5000 units/ml) and rapidly transferring the solution to a quartz cuvette. .. The filaments were initially prepared by incubating 0.06 μM ssDNA (final concentration ∼6 μM in bases) with 2 μM RecA (NEB) in the presence of 1 mM cofactor (ATP or dATP), 10 U/ml of pyruvate kinase, 3 mM phosphoenolpyruvate, and 0.2 μM single-stranded binding protein (SSB) (Epicentre) in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) at 37°C for 10 min. FRET experiments followed the emission of the fluorescein label by using 493-nm excitation during 30 min; the emission was read as counts per second (cps) at 518 nm every one second.

    Agarose Gel Electrophoresis:

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes). .. Nuclease activity was confirmed by agarose gel electrophoresis.

    In Vitro:

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site
    Article Snippet: .. The competitors used for competition between ssRNA and dsRNA and between ssDNA and dsDNA were as follows: ssRNA, full-length in vitro -transcribed S9 RNA transcript; dsRNA, annealing product of the plus and minus strands of the full-length S9 RNA; ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplification product of full-length RBSDV S9. ..

    Protein Binding:

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway
    Article Snippet: To convert ss M13mp18 DNA into dsDNA, 650 ng of ss M13mp18 DNA annealed to the biotinylated primer was incubated with 10 U of T7 DNA polymerase (New England Biolabs) in a reaction buffer containing 0.33 mM each of dGTP, dATP, dTTP and dCTP at 37°C for 15 min. .. Note that ubiquitin prevented non-specific protein binding to the beads.

    Incubation:

    Article Title: Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA
    Article Snippet: After an aliquot of dsDNA in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) was mixed with RecA (New England Biolabs), ATP or ATPγS, and the beads, it was placed in a square micro-cell with cross-section of 0.8 mm × 0.8 mm containing a round inner capillary, 0.55 mm in diameter and closed at its ends. .. After an initial incubation of 10 min, the DNA molecules became tethered between the glass capillary surface and the extravidin-coated beads.

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site
    Article Snippet: For one set of reactions, P9-1 was combined with DIG-labeled RNA probe and incubated for 10 min as described earlier, after which the competitor was added and the samples were incubated for an additional 10 min. .. The competitors used for competition between ssRNA and dsRNA and between ssDNA and dsDNA were as follows: ssRNA, full-length in vitro -transcribed S9 RNA transcript; dsRNA, annealing product of the plus and minus strands of the full-length S9 RNA; ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplification product of full-length RBSDV S9.

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway
    Article Snippet: .. To convert ss M13mp18 DNA into dsDNA, 650 ng of ss M13mp18 DNA annealed to the biotinylated primer was incubated with 10 U of T7 DNA polymerase (New England Biolabs) in a reaction buffer containing 0.33 mM each of dGTP, dATP, dTTP and dCTP at 37°C for 15 min. ..

    Article Title: RecA homology search is promoted by mechanical stress along the scanned duplex DNA
    Article Snippet: A 0.2 µl aliquot of each dsDNA at 7 µg/µl in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) containing 1 mM ATP (or ATPγS) was mixed with free RecA (New England Biolabs) (final concentration 1 µM) or with preparations of RecA–ssDNA filaments (ranging in size from 57 to 7200 nt and final concentration 60 nM) and 1 µl of the beads. .. After an initial incubation of 10 min, the DNA molecules became tethered between the glass capillary surface and the extravidin-coated beads.

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: Protein G DynaBeads (25 μl) were added and incubated for an additional hour and were then washed and boiled in gel application buffer. .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes).

    Concentration Assay:

    Article Title: RecA homology search is promoted by mechanical stress along the scanned duplex DNA
    Article Snippet: .. A 0.2 µl aliquot of each dsDNA at 7 µg/µl in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) containing 1 mM ATP (or ATPγS) was mixed with free RecA (New England Biolabs) (final concentration 1 µM) or with preparations of RecA–ssDNA filaments (ranging in size from 57 to 7200 nt and final concentration 60 nM) and 1 µl of the beads. ..

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome
    Article Snippet: .. For nuclease treatment, IFI16 and dsDNA were combined as above and were then treated with micrococcal nuclease (New England Biolabs) at a concentration of 1 × 105 units/ml (30 minutes). .. Nuclease activity was confirmed by agarose gel electrophoresis.

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: FRET measurements Strand exchange reactions were performed by mixing an aliquot of 0.06 μM 98 nt ssDNA/RecA filament, 0.06 μM labeled dsDNA, and 1 μM Escherichia coli DNA Polymerase IV (Pol IV) or 5 units Bacillus subtilis DNA polymerase, Large fragment (LF-Bsu) (New England Biolabs (NEB), 5000 units/ml) and rapidly transferring the solution to a quartz cuvette. .. The filaments were initially prepared by incubating 0.06 μM ssDNA (final concentration ∼6 μM in bases) with 2 μM RecA (NEB) in the presence of 1 mM cofactor (ATP or dATP), 10 U/ml of pyruvate kinase, 3 mM phosphoenolpyruvate, and 0.2 μM single-stranded binding protein (SSB) (Epicentre) in RecA buffer (70 mM Tris–HCl, 10 mM MgCl2 and 5 mM dithiothreitol, pH 7.6) at 37°C for 10 min. FRET experiments followed the emission of the fluorescein label by using 493-nm excitation during 30 min; the emission was read as counts per second (cps) at 518 nm every one second.

    Gel Extraction:

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension
    Article Snippet: Telomeric G-rich oligo, dsDNA handles were ligated using T4 DNA ligase (NEB). .. The ligated product (2042 bp with 26 nt) was purified by gel extraction with PureLink kit (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs truseq nebnext dsdna fragmentase
    Genome Coverage plots. Representation of the MPS relative coverage of both strands (rc+: relative coverage of the plus strand, rc-: relative coverage of the negative strand) of the pUC19 plasmid, or mtDNA molecules obtained from the Ion Torrent PGM or MiSeq sequencing system. The outer circle symbolizes the pUC19 (A) or mtDNA (B, C, D) gene structure, respectively. 1A: Use of the Ion Torrent PGM standard protocol on the pUC19 plasmid. 1B: Use of three different fragmentation methods in combination with the Ion Torrent sequencing protocol on the mtDNA: Ion Shear Plus Reagents (enzymatic), <t>NEBNext</t> <t>dsDNA</t> <t>Fragmentase</t> (enzymatic) and Covaris (physical). 1C: Use of an Ion Torrent PGM protocol without PCR amplification in the library construction on the mtDNA. 1D: LR-PCR products of the mtDNA were Covaris (physical) or NEBNext dsDNA Fragmentase (enzymatic) sheared, followed by a <t>TruSeq</t> DNA PCR free protocol on a MiSeq instrument. The same six samples were processed with a Nextera XT kit (enzymatic shearing and PCR amplification in library preparation) prior to MiSeq analysis.
    Truseq Nebnext Dsdna Fragmentase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq nebnext dsdna fragmentase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    truseq nebnext dsdna fragmentase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    New England Biolabs double stranded dna dsdna
    CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). <t>DNA</t> sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, <t>dsDNA</t> size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).
    Double Stranded Dna Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/double stranded dna dsdna/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    double stranded dna dsdna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    85
    New England Biolabs 2 7 kb dsdna substrate
    Sgs1 does not stimulate resection of <t>dsDNA</t> by Exo1. ( A ) Nuclease assays with Exo1 (0.35, 0.53, 0.8, 1.2, and 1.8 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.1 nM, lanes 8–13) in low-salt buffer. Blunt-ended pUC19 dsDNA (1 nM), 32 P labeled at the 3′ end, was used. ( B ) Quantification of experiments as shown in A . Error bars show SE. ( C ) Nuclease assays with Exo1 (0.53, 0.8, 1.2, 1.8, and <t>2.7</t> nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.5 nM) and Top3-Rmi1 (5 nM, lanes 9–14, respectively), in standard buffer. Substrate is as in A . ( D ) Quantification of experiments as shown in C . Error bars show SE. ( E ) Nuclease assay carried out with Exo1 (0.5, 1, 2, 3, and 4 nM), RPA (0.4 μM), and either without (lanes 2–6) or with helicase-dead Sgs1 K706A (20 nM, lanes 8–12). Substrate is as in A . ( F ) Increasing amounts of nuclease-dead Exo1 D173A (0.53, 0.8, 1.2, 1.8, 2.7, 4, and 8 nM) were added to reactions containing Sgs1 (0.5 nM) and/or Top3-Rmi1 (5 nM), as indicated, in the presence of RPA (0.4 μM). Substrate is as in A .
    2 7 Kb Dsdna Substrate, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2 7 kb dsdna substrate/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    2 7 kb dsdna substrate - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    95
    New England Biolabs dsdna donor cassettes
    Modification of 5’ ends of long <t>dsDNA</t> fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo <t>PCR</t> genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.
    Dsdna Donor Cassettes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna donor cassettes/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dsdna donor cassettes - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Genome Coverage plots. Representation of the MPS relative coverage of both strands (rc+: relative coverage of the plus strand, rc-: relative coverage of the negative strand) of the pUC19 plasmid, or mtDNA molecules obtained from the Ion Torrent PGM or MiSeq sequencing system. The outer circle symbolizes the pUC19 (A) or mtDNA (B, C, D) gene structure, respectively. 1A: Use of the Ion Torrent PGM standard protocol on the pUC19 plasmid. 1B: Use of three different fragmentation methods in combination with the Ion Torrent sequencing protocol on the mtDNA: Ion Shear Plus Reagents (enzymatic), NEBNext dsDNA Fragmentase (enzymatic) and Covaris (physical). 1C: Use of an Ion Torrent PGM protocol without PCR amplification in the library construction on the mtDNA. 1D: LR-PCR products of the mtDNA were Covaris (physical) or NEBNext dsDNA Fragmentase (enzymatic) sheared, followed by a TruSeq DNA PCR free protocol on a MiSeq instrument. The same six samples were processed with a Nextera XT kit (enzymatic shearing and PCR amplification in library preparation) prior to MiSeq analysis.

    Journal: PLoS ONE

    Article Title: A Bumpy Ride on the Diagnostic Bench of Massive Parallel Sequencing, the Case of the Mitochondrial Genome

    doi: 10.1371/journal.pone.0112950

    Figure Lengend Snippet: Genome Coverage plots. Representation of the MPS relative coverage of both strands (rc+: relative coverage of the plus strand, rc-: relative coverage of the negative strand) of the pUC19 plasmid, or mtDNA molecules obtained from the Ion Torrent PGM or MiSeq sequencing system. The outer circle symbolizes the pUC19 (A) or mtDNA (B, C, D) gene structure, respectively. 1A: Use of the Ion Torrent PGM standard protocol on the pUC19 plasmid. 1B: Use of three different fragmentation methods in combination with the Ion Torrent sequencing protocol on the mtDNA: Ion Shear Plus Reagents (enzymatic), NEBNext dsDNA Fragmentase (enzymatic) and Covaris (physical). 1C: Use of an Ion Torrent PGM protocol without PCR amplification in the library construction on the mtDNA. 1D: LR-PCR products of the mtDNA were Covaris (physical) or NEBNext dsDNA Fragmentase (enzymatic) sheared, followed by a TruSeq DNA PCR free protocol on a MiSeq instrument. The same six samples were processed with a Nextera XT kit (enzymatic shearing and PCR amplification in library preparation) prior to MiSeq analysis.

    Article Snippet: The average read depth for the different datasets generated with the MiSeq were 3723, 4701 and 19418 for the TruSeq Covaris, TruSeq NEBNext dsDNA Fragmentase and the Nextera XT methods, respectively.

    Techniques: Plasmid Preparation, Sequencing, Polymerase Chain Reaction, Amplification

    CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). DNA sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, dsDNA size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).

    Journal: Nucleic Acids Research

    Article Title: Adaptation of the Haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process

    doi: 10.1093/nar/gkt1154

    Figure Lengend Snippet: CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). DNA sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, dsDNA size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).

    Article Snippet: The single-stranded DNA (ssDNA) (ФX174ss) and double-stranded DNA (dsDNA) (ФX174ds) from phiX174 phage (purchased from New England Biolabs) were used as controls.

    Techniques: CRISPR, Infection, Polymerase Chain Reaction, Marker, Sequencing

    Adaptation to HHPV-2 infection under different cas genetic backgrounds. ( A ) Cas requirement for adaptation. For each cas mutant, DNA was sampled from cells transformed with an empty plasmid (−) or the plasmid carrying the deleted cas gene(s) (+). The plasmid-carried cas gene(s) was/were under the control of the cas operon promoter. ( B ) Requirements for the nuclease and helicase activities of Cas3. Alanine replacement was performed for the putative key residues in the HD nuclease domain (H20A, H55A, D56A and D229A) and the DExD/H helicase domain (K315A, D439A and E440A). Another two conserved residues (His6 and Lys113) were also mutated. The empty plasmid (−) and the plasmid carrying a wild-type Cas3 (Cas3 WT ) were used, respectively, as negative and positive controls. Lane Ms, dsDNA size markers.

    Journal: Nucleic Acids Research

    Article Title: Adaptation of the Haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process

    doi: 10.1093/nar/gkt1154

    Figure Lengend Snippet: Adaptation to HHPV-2 infection under different cas genetic backgrounds. ( A ) Cas requirement for adaptation. For each cas mutant, DNA was sampled from cells transformed with an empty plasmid (−) or the plasmid carrying the deleted cas gene(s) (+). The plasmid-carried cas gene(s) was/were under the control of the cas operon promoter. ( B ) Requirements for the nuclease and helicase activities of Cas3. Alanine replacement was performed for the putative key residues in the HD nuclease domain (H20A, H55A, D56A and D229A) and the DExD/H helicase domain (K315A, D439A and E440A). Another two conserved residues (His6 and Lys113) were also mutated. The empty plasmid (−) and the plasmid carrying a wild-type Cas3 (Cas3 WT ) were used, respectively, as negative and positive controls. Lane Ms, dsDNA size markers.

    Article Snippet: The single-stranded DNA (ssDNA) (ФX174ss) and double-stranded DNA (dsDNA) (ФX174ds) from phiX174 phage (purchased from New England Biolabs) were used as controls.

    Techniques: Infection, Mutagenesis, Transformation Assay, Plasmid Preparation, Mass Spectrometry

    Sgs1 does not stimulate resection of dsDNA by Exo1. ( A ) Nuclease assays with Exo1 (0.35, 0.53, 0.8, 1.2, and 1.8 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.1 nM, lanes 8–13) in low-salt buffer. Blunt-ended pUC19 dsDNA (1 nM), 32 P labeled at the 3′ end, was used. ( B ) Quantification of experiments as shown in A . Error bars show SE. ( C ) Nuclease assays with Exo1 (0.53, 0.8, 1.2, 1.8, and 2.7 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.5 nM) and Top3-Rmi1 (5 nM, lanes 9–14, respectively), in standard buffer. Substrate is as in A . ( D ) Quantification of experiments as shown in C . Error bars show SE. ( E ) Nuclease assay carried out with Exo1 (0.5, 1, 2, 3, and 4 nM), RPA (0.4 μM), and either without (lanes 2–6) or with helicase-dead Sgs1 K706A (20 nM, lanes 8–12). Substrate is as in A . ( F ) Increasing amounts of nuclease-dead Exo1 D173A (0.53, 0.8, 1.2, 1.8, 2.7, 4, and 8 nM) were added to reactions containing Sgs1 (0.5 nM) and/or Top3-Rmi1 (5 nM), as indicated, in the presence of RPA (0.4 μM). Substrate is as in A .

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Relationship of DNA degradation by Saccharomyces cerevisiae Exonuclease 1 and its stimulation by RPA and Mre11-Rad50-Xrs2 to DNA end resection

    doi: 10.1073/pnas.1305166110

    Figure Lengend Snippet: Sgs1 does not stimulate resection of dsDNA by Exo1. ( A ) Nuclease assays with Exo1 (0.35, 0.53, 0.8, 1.2, and 1.8 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.1 nM, lanes 8–13) in low-salt buffer. Blunt-ended pUC19 dsDNA (1 nM), 32 P labeled at the 3′ end, was used. ( B ) Quantification of experiments as shown in A . Error bars show SE. ( C ) Nuclease assays with Exo1 (0.53, 0.8, 1.2, 1.8, and 2.7 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.5 nM) and Top3-Rmi1 (5 nM, lanes 9–14, respectively), in standard buffer. Substrate is as in A . ( D ) Quantification of experiments as shown in C . Error bars show SE. ( E ) Nuclease assay carried out with Exo1 (0.5, 1, 2, 3, and 4 nM), RPA (0.4 μM), and either without (lanes 2–6) or with helicase-dead Sgs1 K706A (20 nM, lanes 8–12). Substrate is as in A . ( F ) Increasing amounts of nuclease-dead Exo1 D173A (0.53, 0.8, 1.2, 1.8, 2.7, 4, and 8 nM) were added to reactions containing Sgs1 (0.5 nM) and/or Top3-Rmi1 (5 nM), as indicated, in the presence of RPA (0.4 μM). Substrate is as in A .

    Article Snippet: The 2.7-kb dsDNA substrate with 4-nt overhangs at the 5′ end was pUC19 dsDNA linearized with HindIII (New England Biolabs).

    Techniques: Recombinase Polymerase Amplification, Labeling, Nuclease Assay

    Modification of 5’ ends of long dsDNA fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo PCR genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Modification of 5’ ends of long dsDNA fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo PCR genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Modification, Expressing, Injection, Polymerase Chain Reaction, Amplification

    Single-copy integration of long dsDNA donor establishes stably transmitted gfp-rx2 fusion gene. ( A ) F2 homozygous embryos exhibit GFP-Rx2 fusion protein expression in the pattern of the endogenous gene in the retina. ( B ) Southern Blot analysis of F2 gfp-rx2 embryos reveals a single band for a digestion scheme cutting outside the donor cassette (BglII/HindIII) or within the 5’ donor cassette and in intron 2 (ScaI/HindIII) indicating precise single-copy donor integration. ( B’ ) Schematic representation of the modified locus indicating the restriction sites and the domain complementary to the probe used in ( B ). ( C ) RT-PCR analysis on mRNA isolated from individual homozygous F3 embryos indicates the transcription of a single gfp-rx2 fusion mRNA in comparison to the shorter wild-type rx2 mRNA as schematically represented in ( C’ ).

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Single-copy integration of long dsDNA donor establishes stably transmitted gfp-rx2 fusion gene. ( A ) F2 homozygous embryos exhibit GFP-Rx2 fusion protein expression in the pattern of the endogenous gene in the retina. ( B ) Southern Blot analysis of F2 gfp-rx2 embryos reveals a single band for a digestion scheme cutting outside the donor cassette (BglII/HindIII) or within the 5’ donor cassette and in intron 2 (ScaI/HindIII) indicating precise single-copy donor integration. ( B’ ) Schematic representation of the modified locus indicating the restriction sites and the domain complementary to the probe used in ( B ). ( C ) RT-PCR analysis on mRNA isolated from individual homozygous F3 embryos indicates the transcription of a single gfp-rx2 fusion mRNA in comparison to the shorter wild-type rx2 mRNA as schematically represented in ( C’ ).

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Stable Transfection, Expressing, Southern Blot, Modification, Reverse Transcription Polymerase Chain Reaction, Isolation

    Modification of 5’ ends of long dsDNA fragments prevents in vivo multimerization. ( A ) Schematic representation of long dsDNA donor cassette PCR amplification with universal primers (black arrows) complementary to the cloning vector backbone outside of the assembled donor cassette (e. g. gfp with homology flanks). Bulky moieties like Biotin at the 5’ ends of both modified primers (red octagon) prevent multimerization/NHEJ of dsDNA, providing optimal conditions for HDR-mediated single-copy integration following CRISPR/Cas9-introduced DSB at the target locus (grey scissors). Representation of locus (Lf/Lr) and internal gfp (Gf/Gr) primers for PCR genotyping of putative HDR-mediated gfp integration events. ( B ) Southern blot analysis reveals the monomeric state of injected dsDNA fragments in vivo for 5’ modification with Biotin or Spacer C3. Long dsDNAs generated with control unmodified primers or Amino-dT attached primers multimerize as indicated by a high molecular weight ladder apparent already within two hours post-injection (hpi). Note: 5’ moieties did not enhance the stability of injected DNA.

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Modification of 5’ ends of long dsDNA fragments prevents in vivo multimerization. ( A ) Schematic representation of long dsDNA donor cassette PCR amplification with universal primers (black arrows) complementary to the cloning vector backbone outside of the assembled donor cassette (e. g. gfp with homology flanks). Bulky moieties like Biotin at the 5’ ends of both modified primers (red octagon) prevent multimerization/NHEJ of dsDNA, providing optimal conditions for HDR-mediated single-copy integration following CRISPR/Cas9-introduced DSB at the target locus (grey scissors). Representation of locus (Lf/Lr) and internal gfp (Gf/Gr) primers for PCR genotyping of putative HDR-mediated gfp integration events. ( B ) Southern blot analysis reveals the monomeric state of injected dsDNA fragments in vivo for 5’ modification with Biotin or Spacer C3. Long dsDNAs generated with control unmodified primers or Amino-dT attached primers multimerize as indicated by a high molecular weight ladder apparent already within two hours post-injection (hpi). Note: 5’ moieties did not enhance the stability of injected DNA.

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Modification, In Vivo, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Non-Homologous End Joining, CRISPR, Southern Blot, Injection, Generated, Molecular Weight