dsdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    M13mp18 RF I DNA
    Description:
    M13mp18 RF I DNA 10 ug
    Catalog Number:
    n4018s
    Price:
    87
    Size:
    10 ug
    Category:
    Genomic DNA
    Buy from Supplier


    Structured Review

    New England Biolabs dsdna
    M13mp18 RF I DNA
    M13mp18 RF I DNA 10 ug
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 99 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Rrp1 translocase and ubiquitin ligase activities restrict the genome destabilising effects of Rad51 in fission yeast"

    Article Title: Rrp1 translocase and ubiquitin ligase activities restrict the genome destabilising effects of Rad51 in fission yeast

    Journal: bioRxiv

    doi: 10.1101/2020.05.30.125286

    Rrp1 is an E3 ubiquitin ligase with Rad51 as a substrate (A) The indicated reaction components were included (+) or omitted (-) for in vitro ubiquitylation assays. After the reaction, the reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, and multiple bands indicative of Rad51 ubiquitylation are shown. (B) In vitro ubiquitylation assay containing all components as in (A) with Rrp1-FLAG or Rrp1-CS-FLAG as the E3 ligase. The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, demonstrating that Rrp1 RING domain is indispensable for Rad51 ubiquitylation. Additionally, reaction products were analysed with anti-FLAG antibodies (lowest panel), revealing auto-ubiquitylation of Rrp1. (C) Ubiquitylation of Rad51 by Rrp1 is less efficient in the presence of DNA. In vitro ubiquitylation assay containing all components as in (A) with Rad51 pre-incubated with 4 µM of ssDNA (PhiX 174 virion) or dsDNA (PhiX 174 RF I linearized with ApaLI). The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies. The intensity ratios of mono-ubiquitylated to non-ubiquitylated Rad51 bands normalised to the sample without DNA are shown.
    Figure Legend Snippet: Rrp1 is an E3 ubiquitin ligase with Rad51 as a substrate (A) The indicated reaction components were included (+) or omitted (-) for in vitro ubiquitylation assays. After the reaction, the reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, and multiple bands indicative of Rad51 ubiquitylation are shown. (B) In vitro ubiquitylation assay containing all components as in (A) with Rrp1-FLAG or Rrp1-CS-FLAG as the E3 ligase. The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, demonstrating that Rrp1 RING domain is indispensable for Rad51 ubiquitylation. Additionally, reaction products were analysed with anti-FLAG antibodies (lowest panel), revealing auto-ubiquitylation of Rrp1. (C) Ubiquitylation of Rad51 by Rrp1 is less efficient in the presence of DNA. In vitro ubiquitylation assay containing all components as in (A) with Rad51 pre-incubated with 4 µM of ssDNA (PhiX 174 virion) or dsDNA (PhiX 174 RF I linearized with ApaLI). The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies. The intensity ratios of mono-ubiquitylated to non-ubiquitylated Rad51 bands normalised to the sample without DNA are shown.

    Techniques Used: In Vitro, Western Blot, Ubiquitin Assay, Incubation

    Rrp1 can disassemble Rad51-dsDNA complexes (A) Rrp1 outcompetes Rad51 for binding to dsDNA as demonstrated by electrophoretic mobility shift assay (EMSA). Increasing amounts of Rad51 were pre-incubated with linear double-stranded DNA (ldsDNA, PhiX 174 RF I linearized with ApaLI) before addition of the indicated concentration of Rrp1. Mixtures were resolved on an agarose gel and stained with SYBR-gold. (B) Rad51-dsDNA filaments disassemble following addition of Rrp1, as demonstrated by the reduction in anisotropy of fluorescently-labelled dsDNA. Rad51 (6 µM) was incubated with a dsDNA oligonucleotide (3 µM nucleotide concentration) labelled with the TAMRA fluorophore; the resultant high anisotropy value confirms filament formation. Unlabelled heterologous scavenger DNA was then added, followed by a sub stoichiometric amount of Rrp1 (0.25 µM) or the equivalent volume of protein storage buffer, and fluorescence anisotropy was monitored for the indicated time. The decline in anisotropy observed in the reaction containing Rrp1 indicates that Rad51-dsDNA complexes are disassembled.
    Figure Legend Snippet: Rrp1 can disassemble Rad51-dsDNA complexes (A) Rrp1 outcompetes Rad51 for binding to dsDNA as demonstrated by electrophoretic mobility shift assay (EMSA). Increasing amounts of Rad51 were pre-incubated with linear double-stranded DNA (ldsDNA, PhiX 174 RF I linearized with ApaLI) before addition of the indicated concentration of Rrp1. Mixtures were resolved on an agarose gel and stained with SYBR-gold. (B) Rad51-dsDNA filaments disassemble following addition of Rrp1, as demonstrated by the reduction in anisotropy of fluorescently-labelled dsDNA. Rad51 (6 µM) was incubated with a dsDNA oligonucleotide (3 µM nucleotide concentration) labelled with the TAMRA fluorophore; the resultant high anisotropy value confirms filament formation. Unlabelled heterologous scavenger DNA was then added, followed by a sub stoichiometric amount of Rrp1 (0.25 µM) or the equivalent volume of protein storage buffer, and fluorescence anisotropy was monitored for the indicated time. The decline in anisotropy observed in the reaction containing Rrp1 indicates that Rad51-dsDNA complexes are disassembled.

    Techniques Used: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Concentration Assay, Agarose Gel Electrophoresis, Staining, Fluorescence

    2) Product Images from "The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements"

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1252

    Schematic of a RecBCD-dependent repair of a double-strand break and a genomic rearrangement that might result. ( A ) i . The dsDNA sequences are identical. The DSB is indicated by the gray arrow. ii . The bright green triangles indicate the Chi sites on each strand that are oriented so that they would be recognized by RecBCD as it proceeds along the dsDNA from the DSB. The L χleft and L χright are the separations between the position of the DSB and the nearest appropriately oriented Chi site on each initiating strand. iii . RecBCD creates the two initiating ssDNAs, while the complementary strands are degraded or looped (dotted circles). L left and L right are the distances separating the DSB from the 3′ end of each initiating strand. Note that L left ≥ L χleft and L right ≥ L χright . iv . RecA mediated strand exchange creates heteroduplex products that reach the 3′ ends of the filaments . v . DNA polymerase (orange rectangles) extends both initiating ssDNAs by copying the complementary strands beginning at the 3′ end of an initiating strand in a RecA filament. ( B ) The red and blue lines represent two identical dsDNAs that include two copies of a repeated sequence, Copy 1 and Copy 2 separated by a non-repeated region. i . A DSB occurs near the center of Copy 1. ii . After the DSB, RecBCD creates two ssDNA–RecA filaments by loading RecA onto the initiating ssDNA created by RecBCD. The two ssDNA–RecA filaments are indicated by the green horizontal arrows pointing toward the 3′ end. iii . Both filaments pair with the sequence matched regions in Copy 2 and form sequence matched heteroduplex products that extend to the 3′ ends of the initiating strands. DNA synthesis then completes two dsDNAs. The sequence region that includes the heteroduplex products and the newly synthesized DNA is shown in purple. The completion of the dsDNA is followed by Holliday junction resolution that is a crossover on the right side. As a result, the upper dsDNA lacks the sequence region between the two copies, and the lower dsDNA has two copies of the region between the two repeats. The duplicated regions are highlighted by the yellow rectangles. ( C ) Schematic of a DSB that occurs in Copy 1 of a repeated sequence. The appropriately oriented Chi sites are indicated by the bright green triangles, and the direction of RecBCD is shown by the black arrows. Copy 1 only includes appropriately oriented Chi sites in the dark red strand, so only the dark red strand can terminate in a region of Copy 1. ( D ) Same as C), but the DSB occurs to the left of Copy 1, which changes the number of correctly oriented Chi site in this region. The light pink filament cannot include a region of Copy 1 because RecBCD moves away from the DSB. ( E ) In a different sequence than C), Copy 1 includes appropriately oriented Chi sites on both strands, allowing the rearrangement shown in B); however, this never occurs in any of the 12 enteric bacteria we studied in this work.
    Figure Legend Snippet: Schematic of a RecBCD-dependent repair of a double-strand break and a genomic rearrangement that might result. ( A ) i . The dsDNA sequences are identical. The DSB is indicated by the gray arrow. ii . The bright green triangles indicate the Chi sites on each strand that are oriented so that they would be recognized by RecBCD as it proceeds along the dsDNA from the DSB. The L χleft and L χright are the separations between the position of the DSB and the nearest appropriately oriented Chi site on each initiating strand. iii . RecBCD creates the two initiating ssDNAs, while the complementary strands are degraded or looped (dotted circles). L left and L right are the distances separating the DSB from the 3′ end of each initiating strand. Note that L left ≥ L χleft and L right ≥ L χright . iv . RecA mediated strand exchange creates heteroduplex products that reach the 3′ ends of the filaments . v . DNA polymerase (orange rectangles) extends both initiating ssDNAs by copying the complementary strands beginning at the 3′ end of an initiating strand in a RecA filament. ( B ) The red and blue lines represent two identical dsDNAs that include two copies of a repeated sequence, Copy 1 and Copy 2 separated by a non-repeated region. i . A DSB occurs near the center of Copy 1. ii . After the DSB, RecBCD creates two ssDNA–RecA filaments by loading RecA onto the initiating ssDNA created by RecBCD. The two ssDNA–RecA filaments are indicated by the green horizontal arrows pointing toward the 3′ end. iii . Both filaments pair with the sequence matched regions in Copy 2 and form sequence matched heteroduplex products that extend to the 3′ ends of the initiating strands. DNA synthesis then completes two dsDNAs. The sequence region that includes the heteroduplex products and the newly synthesized DNA is shown in purple. The completion of the dsDNA is followed by Holliday junction resolution that is a crossover on the right side. As a result, the upper dsDNA lacks the sequence region between the two copies, and the lower dsDNA has two copies of the region between the two repeats. The duplicated regions are highlighted by the yellow rectangles. ( C ) Schematic of a DSB that occurs in Copy 1 of a repeated sequence. The appropriately oriented Chi sites are indicated by the bright green triangles, and the direction of RecBCD is shown by the black arrows. Copy 1 only includes appropriately oriented Chi sites in the dark red strand, so only the dark red strand can terminate in a region of Copy 1. ( D ) Same as C), but the DSB occurs to the left of Copy 1, which changes the number of correctly oriented Chi site in this region. The light pink filament cannot include a region of Copy 1 because RecBCD moves away from the DSB. ( E ) In a different sequence than C), Copy 1 includes appropriately oriented Chi sites on both strands, allowing the rearrangement shown in B); however, this never occurs in any of the 12 enteric bacteria we studied in this work.

    Techniques Used: Sequencing, DNA Synthesis, Synthesized

    DNA synthesis is required for a DNA polymerase to stabilize strand exchange products. ( A ) Schematic for experiments with M 3 ′ values of 0, 3, 5. ( B ) Graphic representation of the change in fluorescence (Δ F ) versus time curves from single trial experiments performed with dATP–ssDNA–RecA filaments and DNA Pol IV in which the blue, pink, and light-blue curves correspond to M 3′ values of 0, 3 and 5 base mismatches, respectively. Δ F is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. ( C ) Analogous experiments as (B), but with LF-Bsu polymerase instead of DNA Pol IV.
    Figure Legend Snippet: DNA synthesis is required for a DNA polymerase to stabilize strand exchange products. ( A ) Schematic for experiments with M 3 ′ values of 0, 3, 5. ( B ) Graphic representation of the change in fluorescence (Δ F ) versus time curves from single trial experiments performed with dATP–ssDNA–RecA filaments and DNA Pol IV in which the blue, pink, and light-blue curves correspond to M 3′ values of 0, 3 and 5 base mismatches, respectively. Δ F is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. ( C ) Analogous experiments as (B), but with LF-Bsu polymerase instead of DNA Pol IV.

    Techniques Used: DNA Synthesis, Fluorescence

    The presence of a second filament rescues instability caused by an ssDNA outgoing strand and a long homoduplex dsDNA (180 bp) that extends beyond the 3′ end of a filament. ( A ) Schematic of experiments with 66 bp of homoduplex dsDNA on the 3′ end of the filament and N values of 5, 20, 50 and 82 bp. ( B ) Graphic representation of the change in fluorescence (ΔΔ F ) versus time curves of the experiment represented in (A) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F is calculated as the difference between the measured fluorescence and the fluorescence for N = 5. The purple, red, and black curves correspond to N 2 = 82, 50 and 20 nt, respectively. ( C ) Schematic for experiments performed involving two filaments. In all of these experiments N 1 = 42. ( D ) Graphic representation of the change in fluorescence ΔΔ F versus time curves for single trials of the experiment represented in (C) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F was calculated as indicated above. Different N 2 values are represented with different curve colors, where purple, red and black correspond to N 2 = 82, 50 and 20 nt, respectively.
    Figure Legend Snippet: The presence of a second filament rescues instability caused by an ssDNA outgoing strand and a long homoduplex dsDNA (180 bp) that extends beyond the 3′ end of a filament. ( A ) Schematic of experiments with 66 bp of homoduplex dsDNA on the 3′ end of the filament and N values of 5, 20, 50 and 82 bp. ( B ) Graphic representation of the change in fluorescence (ΔΔ F ) versus time curves of the experiment represented in (A) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F is calculated as the difference between the measured fluorescence and the fluorescence for N = 5. The purple, red, and black curves correspond to N 2 = 82, 50 and 20 nt, respectively. ( C ) Schematic for experiments performed involving two filaments. In all of these experiments N 1 = 42. ( D ) Graphic representation of the change in fluorescence ΔΔ F versus time curves for single trials of the experiment represented in (C) with dATP–ssDNA–RecA filaments and DNA Pol IV. ΔΔ F was calculated as indicated above. Different N 2 values are represented with different curve colors, where purple, red and black correspond to N 2 = 82, 50 and 20 nt, respectively.

    Techniques Used: Fluorescence

    DNA synthesis stabilizes DSB repair occurring at a repeat. ( A ) Experimental schematic showing a typical ssDNA–RecA filament (orange line with blue ellipses) and 90 bp dsDNA. Δ L = D label – D init = 5 bp. The labeled dsDNA used in all of the experiments was the same, so each N value corresponds to a different filament sequence. For each N value, the green brackets highlight the green regions of the dsDNA that are homologous to the N bases at the 3′ end of the ssDNA. The other bases in the dsDNA are heterologous to the initiating ssDNA. The yellow region indicates D init = 15 bp. The remaining dsDNA is shown in magenta. The red circle and black star represent the rhodamine and fluorescein labels, respectively. They are positioned on the complementary (purple line) and outgoing (blue line) strands, respectively. ( B ) Graph representing the average over three trials of the change in fluorescence (Δ F ) versus time curves in experiments with dATP–ssDNA–RecA filaments and DNA Pol IV represented in A) for N = 75 (dark blue), 50 (red), 36 (gray), 20 (black), and heterologous filament (light blue). Δ F in counts per second (cps) is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. The error bars show the standard deviation based on three trials. ( C ) Same as B) in the presence of ATP–ssDNA–RecA filaments and LF-Bsu polymerase.
    Figure Legend Snippet: DNA synthesis stabilizes DSB repair occurring at a repeat. ( A ) Experimental schematic showing a typical ssDNA–RecA filament (orange line with blue ellipses) and 90 bp dsDNA. Δ L = D label – D init = 5 bp. The labeled dsDNA used in all of the experiments was the same, so each N value corresponds to a different filament sequence. For each N value, the green brackets highlight the green regions of the dsDNA that are homologous to the N bases at the 3′ end of the ssDNA. The other bases in the dsDNA are heterologous to the initiating ssDNA. The yellow region indicates D init = 15 bp. The remaining dsDNA is shown in magenta. The red circle and black star represent the rhodamine and fluorescein labels, respectively. They are positioned on the complementary (purple line) and outgoing (blue line) strands, respectively. ( B ) Graph representing the average over three trials of the change in fluorescence (Δ F ) versus time curves in experiments with dATP–ssDNA–RecA filaments and DNA Pol IV represented in A) for N = 75 (dark blue), 50 (red), 36 (gray), 20 (black), and heterologous filament (light blue). Δ F in counts per second (cps) is calculated as the difference between the measured fluorescence and the average initial fluorescence for heterologous dsDNA. The error bars show the standard deviation based on three trials. ( C ) Same as B) in the presence of ATP–ssDNA–RecA filaments and LF-Bsu polymerase.

    Techniques Used: DNA Synthesis, Labeling, Sequencing, Fluorescence, Standard Deviation

    ΔΔ F versus time curves obtained with ATP–ssDNA–RecA filaments, LF-Bsu polymerase, and 180 bp labeled dsDNA construct. The purple, red and black curves correspond to N = 82, 50 and 20, respectively. ( A ) ΔΔ F versus time curves for one filament experiments with LF-Bsu, represented by the schematic shown in Figure 5A and after subtracting the heterologous DNA curve shown in Supplementary Figure S5A . ( B ) ΔΔ F versus time curves for two filament experiments in the presence of LF-Bsu, represented by the schematic shown in Figure 5C and after subtracting the heterologous DNA curve shown in Supplementary Figure S5B .
    Figure Legend Snippet: ΔΔ F versus time curves obtained with ATP–ssDNA–RecA filaments, LF-Bsu polymerase, and 180 bp labeled dsDNA construct. The purple, red and black curves correspond to N = 82, 50 and 20, respectively. ( A ) ΔΔ F versus time curves for one filament experiments with LF-Bsu, represented by the schematic shown in Figure 5A and after subtracting the heterologous DNA curve shown in Supplementary Figure S5A . ( B ) ΔΔ F versus time curves for two filament experiments in the presence of LF-Bsu, represented by the schematic shown in Figure 5C and after subtracting the heterologous DNA curve shown in Supplementary Figure S5B .

    Techniques Used: Labeling, Construct

    3) Product Images from "Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway"

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky943

    Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).
    Figure Legend Snippet: Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).

    Techniques Used: Modification, DNA Binding Assay, Incubation, Magnetic Beads, Western Blot, Binding Assay

    4) Product Images from "IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome"

    Article Title: IFI16 filament formation in salivary epithelial cells shapes the anti-IFI16 immune response in Sjögren’s syndrome

    Journal: JCI Insight

    doi: 10.1172/jci.insight.120179

    Autoantibody Immunoprecipitation of IFI16 is enhanced in the presence of dsDNA. ( A and B ) Serum samples from 56 Sjögren’s Syndrome patients positive for IFI16 antibodies by ELISA were used to immunoprecipitate IFI16 in the absence or presence of 150 bp dsDNA in 10:1 IFI16/dsDNA molar ratio. Immunoprecipitation products were electrophoresed and Western Blotted with a commercial IFI16 antibody. ( A ) Representative data from immunoprecipitations performed with 16 patients’ sera and an N-terminal mouse monoclonal antibody (MM) are shown. Sera 1 and 4 were negative for anti-IFI16 antibodies by ELISA and were included as negative controls. Input lanes contain one-fourth protein used in each serum immunoprecipitation. ( B ) All 56 immunoprecipitations were quantified by densitometry. For each, the ratio of immunoprecipitated IFI16 detected in the presence versus absence of dsDNA was calculated. The dotted line indicates a ratio of 1, denoting unchanged immunoprecipitation with or without dsDNA. Median with interquartile range are indicated with solid lines.
    Figure Legend Snippet: Autoantibody Immunoprecipitation of IFI16 is enhanced in the presence of dsDNA. ( A and B ) Serum samples from 56 Sjögren’s Syndrome patients positive for IFI16 antibodies by ELISA were used to immunoprecipitate IFI16 in the absence or presence of 150 bp dsDNA in 10:1 IFI16/dsDNA molar ratio. Immunoprecipitation products were electrophoresed and Western Blotted with a commercial IFI16 antibody. ( A ) Representative data from immunoprecipitations performed with 16 patients’ sera and an N-terminal mouse monoclonal antibody (MM) are shown. Sera 1 and 4 were negative for anti-IFI16 antibodies by ELISA and were included as negative controls. Input lanes contain one-fourth protein used in each serum immunoprecipitation. ( B ) All 56 immunoprecipitations were quantified by densitometry. For each, the ratio of immunoprecipitated IFI16 detected in the presence versus absence of dsDNA was calculated. The dotted line indicates a ratio of 1, denoting unchanged immunoprecipitation with or without dsDNA. Median with interquartile range are indicated with solid lines.

    Techniques Used: Immunoprecipitation, Enzyme-linked Immunosorbent Assay, Western Blot

    Generation of IFI16 cytoplasmic filaments in response to dsDNA transfection in epithelial cells in vitro. ( A–C ) Human salivary gland (HSG) cells were treated with recombinant IFNα prior to transfection with empty plasmid DNA. Cells were then fixed, permeabilized, and stained with anti-IFI16 antibody (green) and DAPI (blue). Representative confocal images at 100× magnification are shown. Camera settings were held constant between experiments. ( D ) Keratinocyte cultures were transfected with Rhodamine labeled Poly(dA:dT) (red) and then stained for IFI16 (green) and counterstained with DAPI (blue). A 3-dimensional rendering of a Z-stack series is shown. ( E ) DNA titration was performed in HSG cultures using increasing concentrations of plasmid DNA, followed by staining with anti-IFI16 (green) and DAPI (blue). Cells with cytoplasmic IFI16 were counted in 4 fields imaged at 40×. Mean values with standard deviation are indicated. * P
    Figure Legend Snippet: Generation of IFI16 cytoplasmic filaments in response to dsDNA transfection in epithelial cells in vitro. ( A–C ) Human salivary gland (HSG) cells were treated with recombinant IFNα prior to transfection with empty plasmid DNA. Cells were then fixed, permeabilized, and stained with anti-IFI16 antibody (green) and DAPI (blue). Representative confocal images at 100× magnification are shown. Camera settings were held constant between experiments. ( D ) Keratinocyte cultures were transfected with Rhodamine labeled Poly(dA:dT) (red) and then stained for IFI16 (green) and counterstained with DAPI (blue). A 3-dimensional rendering of a Z-stack series is shown. ( E ) DNA titration was performed in HSG cultures using increasing concentrations of plasmid DNA, followed by staining with anti-IFI16 (green) and DAPI (blue). Cells with cytoplasmic IFI16 were counted in 4 fields imaged at 40×. Mean values with standard deviation are indicated. * P

    Techniques Used: Transfection, In Vitro, Recombinant, Plasmid Preparation, Staining, Labeling, Titration, Standard Deviation

    5) Product Images from "RecA homology search is promoted by mechanical stress along the scanned duplex DNA"

    Article Title: RecA homology search is promoted by mechanical stress along the scanned duplex DNA

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr855

    RecA–ssDNA filaments bind to non-homologous dsDNA pulled by 3′5′ ends. Confocal microscope visualization (linearly enhanced for brightness and contrast) of fluorescent RecA–ssDNA filaments (white arrows) bound to λ dsDNA. The force applied to the bead is indicated by the yellow arrows.
    Figure Legend Snippet: RecA–ssDNA filaments bind to non-homologous dsDNA pulled by 3′5′ ends. Confocal microscope visualization (linearly enhanced for brightness and contrast) of fluorescent RecA–ssDNA filaments (white arrows) bound to λ dsDNA. The force applied to the bead is indicated by the yellow arrows.

    Techniques Used: Microscopy

    RecA–ssDNA binding to dsDNA. ( A ) Schematic representation of RecA-mediated reactions: incoming ssDNA (red line), outgoing strand (green line), complementary strand (purple line), Watson–Crick pairing (orange) and RecA: site I (gray region of oval) and site II (blue region of oval). ( B ) Schematic representation of the extension and tension on dsDNA bound to RecA–ssDNA filaments with pink highlighting base pairs under tension and yellow triangles indicating regions occupied by the L1 and L2 loops and their attached alpha helices which interact strongly with the incoming strand (i) dsDNA bound to the pre-synaptic filament (ii) dsDNA bound to a RecA–ssDNA filament in the post-strand exchange state ( C ) Schematic representation of the extension and tension on dsDNA with the same color scheme used in (B) (i) in the absence of external force (ii) with external force applied to the 3′5′-ends of one strand (iii) shear force applied to opposite ends of opposite strands (3′3′ or 5′5′ pulling) (iv) with external force applied to both strands at both ends (v) with external force applied to the 3′5′-ends of the complementary strand in the homology searching complex ( D ) Schematic representation of the extension-based assay for measuring the extension of dsDNA due to the binding of RecA–ssDNA filaments (i) λ dsDNA tethered between a capillary tube and a magnetic bead under force (arrow) that is extended without [Δ L , (i)] and with [Δ L RecA (ii–vi)] binding of non-homologous RecA–ssDNA filaments.
    Figure Legend Snippet: RecA–ssDNA binding to dsDNA. ( A ) Schematic representation of RecA-mediated reactions: incoming ssDNA (red line), outgoing strand (green line), complementary strand (purple line), Watson–Crick pairing (orange) and RecA: site I (gray region of oval) and site II (blue region of oval). ( B ) Schematic representation of the extension and tension on dsDNA bound to RecA–ssDNA filaments with pink highlighting base pairs under tension and yellow triangles indicating regions occupied by the L1 and L2 loops and their attached alpha helices which interact strongly with the incoming strand (i) dsDNA bound to the pre-synaptic filament (ii) dsDNA bound to a RecA–ssDNA filament in the post-strand exchange state ( C ) Schematic representation of the extension and tension on dsDNA with the same color scheme used in (B) (i) in the absence of external force (ii) with external force applied to the 3′5′-ends of one strand (iii) shear force applied to opposite ends of opposite strands (3′3′ or 5′5′ pulling) (iv) with external force applied to both strands at both ends (v) with external force applied to the 3′5′-ends of the complementary strand in the homology searching complex ( D ) Schematic representation of the extension-based assay for measuring the extension of dsDNA due to the binding of RecA–ssDNA filaments (i) λ dsDNA tethered between a capillary tube and a magnetic bead under force (arrow) that is extended without [Δ L , (i)] and with [Δ L RecA (ii–vi)] binding of non-homologous RecA–ssDNA filaments.

    Techniques Used: Binding Assay

    Interaction of RecA–ssDNA filaments with ssDNA during DNA ‘unzipping’. Representation of unzipping experiment: One λ dsDNA molecule (λ sp ) acts as spacer and the second λ dsDNA (λ µ ) is unzipped by force. λ µ contains a hairpin connecting its two constituent ssDNA strands at one terminus and a magnetic bead at the free terminus between λ sp and λµ. i is the extension distance for forces between ∼ 2 and 12 pN at which λ sp B-form duplex molecule is stretched out, but the λ µ molecule remains fully zipped. ii is the extension distance at which λ µ is fully unzipped, but the λ sp remains in B-form. ( A ) The initial extension before unzipping. ( B ) The extension after unzipping while a force > 15 pN is maintained. ( C ) The extension after the force has been lowered to ∼5 pN. ( D ) Extension versus force curves for unzipping. The force was first increased and then decreased. ( a ) No added protein or nucleoprotein filaments ( b ) ‘unrezippable’ control curve constructed by taking the sum of the extension versus force curves for λ sp alone and two times that for a λ ssDNA strand obtained by thermal melting of dsDNA. (Note: in this case rezipping is impossible because the complementary strand is not present.) ( c ) Unzipping in the presence of RecA–ssDNA filaments (M13 ssDNA). ( d ) Unzipping in the presence of free RecA protein. In (a), (c) and (d) curves generated by increasing force differed from those generated by decreasing force. In these cases, upturned arrowheads mark the ascending curves and down-turned arrowheads the descending ones.
    Figure Legend Snippet: Interaction of RecA–ssDNA filaments with ssDNA during DNA ‘unzipping’. Representation of unzipping experiment: One λ dsDNA molecule (λ sp ) acts as spacer and the second λ dsDNA (λ µ ) is unzipped by force. λ µ contains a hairpin connecting its two constituent ssDNA strands at one terminus and a magnetic bead at the free terminus between λ sp and λµ. i is the extension distance for forces between ∼ 2 and 12 pN at which λ sp B-form duplex molecule is stretched out, but the λ µ molecule remains fully zipped. ii is the extension distance at which λ µ is fully unzipped, but the λ sp remains in B-form. ( A ) The initial extension before unzipping. ( B ) The extension after unzipping while a force > 15 pN is maintained. ( C ) The extension after the force has been lowered to ∼5 pN. ( D ) Extension versus force curves for unzipping. The force was first increased and then decreased. ( a ) No added protein or nucleoprotein filaments ( b ) ‘unrezippable’ control curve constructed by taking the sum of the extension versus force curves for λ sp alone and two times that for a λ ssDNA strand obtained by thermal melting of dsDNA. (Note: in this case rezipping is impossible because the complementary strand is not present.) ( c ) Unzipping in the presence of RecA–ssDNA filaments (M13 ssDNA). ( d ) Unzipping in the presence of free RecA protein. In (a), (c) and (d) curves generated by increasing force differed from those generated by decreasing force. In these cases, upturned arrowheads mark the ascending curves and down-turned arrowheads the descending ones.

    Techniques Used: Construct, Generated

    Binding of RecA–ssDNA filaments to dsDNA pulled from different ends. ( A ) Δ L RecA versus force for 1000-nt filaments (magenta circles). λ dsDNAs are pulled on (i) 3′5′-ends of one strand, (ii) 3′3′-ends, (iii) 5′5′-ends, (iv) both ends of each of the two constituent strands of the dsDNA, respectively, and controls for each pulling technique in the absence of RecA (gray triangles). ( B ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′ends, 5′5′-ends, and both ends of each of the two constituent strands of the dsDNA; force range: 52-55 pN and negative controls shown in gray. ( C ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′-ends, 5′5′-ends and both ends of each of the two constituent strands of the dsDNA: force range: 52–57 pN; negative controls shown in gray. ( D ) Bar graphs for Δ L RecA values between 52 and 55 pN and 52 and 57 pN, for 1000-nt filaments. λ dsDNAs are pulled 3′5′-, 3′3′-, 5′5′- and both ends of both strands: positives (magenta) and controls (gray). In these experiments filaments were prepared in a buffer containing ATPγS and measured in a buffer containing ATPγS.
    Figure Legend Snippet: Binding of RecA–ssDNA filaments to dsDNA pulled from different ends. ( A ) Δ L RecA versus force for 1000-nt filaments (magenta circles). λ dsDNAs are pulled on (i) 3′5′-ends of one strand, (ii) 3′3′-ends, (iii) 5′5′-ends, (iv) both ends of each of the two constituent strands of the dsDNA, respectively, and controls for each pulling technique in the absence of RecA (gray triangles). ( B ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′ends, 5′5′-ends, and both ends of each of the two constituent strands of the dsDNA; force range: 52-55 pN and negative controls shown in gray. ( C ) Histograms of the fraction of the total number of beads that showed a particular Δ L RecA after a force has been applied for 60 s (magenta) for dsDNA pulled (from left to right) from 3′5′-ends of one strand, 3′3′-ends, 5′5′-ends and both ends of each of the two constituent strands of the dsDNA: force range: 52–57 pN; negative controls shown in gray. ( D ) Bar graphs for Δ L RecA values between 52 and 55 pN and 52 and 57 pN, for 1000-nt filaments. λ dsDNAs are pulled 3′5′-, 3′3′-, 5′5′- and both ends of both strands: positives (magenta) and controls (gray). In these experiments filaments were prepared in a buffer containing ATPγS and measured in a buffer containing ATPγS.

    Techniques Used: Binding Assay

    RecA–ssDNA filaments extend non-homologous dsDNA pulled by 3′5′ ends. ( A ) Δ L RecA 's for λ dsDNAs controls with free ssDNA or λ dsDNA only (red, N = 87) and λ dsDNAs with RecA–ssDNA filaments (blue, N = 454). ( B ) Single molecule extension profiles for non-homologous binding. Different colors are used to represent the response for each different single molecule. The curves ending at positions corresponding to 1, 3 and 4 filaments are 57.0, 59.0 and 60.9 pN, respectively. The red and green curves ending at two-filament lengths correspond to 58.9 and 57.2 pN, respectively. The filaments were prepared in a buffer containing ATPγS, but measured in a buffer containing ATP Pauses at full filament lengths are indicated by horizontal bars the same color as the curve. ( C ) Δ L RecA probability distributions for periods of ≥2 s constant λ dsDNA length, for all filaments of 400–800 nt at 50–62 pN. ( D ) DNA extensions within homology search complexes on dsDNA (color) or λ ssDNA.
    Figure Legend Snippet: RecA–ssDNA filaments extend non-homologous dsDNA pulled by 3′5′ ends. ( A ) Δ L RecA 's for λ dsDNAs controls with free ssDNA or λ dsDNA only (red, N = 87) and λ dsDNAs with RecA–ssDNA filaments (blue, N = 454). ( B ) Single molecule extension profiles for non-homologous binding. Different colors are used to represent the response for each different single molecule. The curves ending at positions corresponding to 1, 3 and 4 filaments are 57.0, 59.0 and 60.9 pN, respectively. The red and green curves ending at two-filament lengths correspond to 58.9 and 57.2 pN, respectively. The filaments were prepared in a buffer containing ATPγS, but measured in a buffer containing ATP Pauses at full filament lengths are indicated by horizontal bars the same color as the curve. ( C ) Δ L RecA probability distributions for periods of ≥2 s constant λ dsDNA length, for all filaments of 400–800 nt at 50–62 pN. ( D ) DNA extensions within homology search complexes on dsDNA (color) or λ ssDNA.

    Techniques Used: Binding Assay

    6) Product Images from "Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA"

    Article Title: Single-molecule studies of the stringency factors and rates governing the polymerization of RecA on double-stranded DNA

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr013

    Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 , and 1 mM ATP at 10 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are several times higher than the minimum rate are indicated with the black lines next to each curve. A few lines labeled as 0× show absence of growth at the lowest forces or pauses at higher forces.
    Figure Legend Snippet: Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 , and 1 mM ATP at 10 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are several times higher than the minimum rate are indicated with the black lines next to each curve. A few lines labeled as 0× show absence of growth at the lowest forces or pauses at higher forces.

    Techniques Used: Labeling

    RecA polymerization in the absence of hydrolysis or negligible hydrolysis: elongation of one single dsDNA molecule in 1 mM ATP and 10 mM CaCl 2 , pH 7.6 at 21 pN, 32 pN, 44 pN and 54 pN (bottom curve to top curve, respectively).
    Figure Legend Snippet: RecA polymerization in the absence of hydrolysis or negligible hydrolysis: elongation of one single dsDNA molecule in 1 mM ATP and 10 mM CaCl 2 , pH 7.6 at 21 pN, 32 pN, 44 pN and 54 pN (bottom curve to top curve, respectively).

    Techniques Used:

    Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 and 1 mM ATPgS at 10 pN, 20 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are twice, three and six times the average rate, are indicated with the black lines next to each curve. In addition, periods where no growth is observed are indicated as 0×.
    Figure Legend Snippet: Extension versus time for RecA growth on dsDNA at pH 7.6, 10 mM MgCl 2 and 1 mM ATPgS at 10 pN, 20 pN, 30 pN, 40 pN and 50 pN (bottom curve to top curve, respectively). ( A ) Full-time range. ( B ) Replotting the first 100 s where a few growth rates that are twice, three and six times the average rate, are indicated with the black lines next to each curve. In addition, periods where no growth is observed are indicated as 0×.

    Techniques Used:

    Nucleation through overstretching. ( A ) Overstretching curve for lambda-phage dsDNA. ( B ) Absence of growth without overstretching and constant force of 50 pN (black curve); however, a fast increase in force through the overstretching transition (sharp peak) can start RecA polymerization showing linear growth at 50 pN on dsDNA at pH 7.6, 10 mM MgCl 2 , 1 mM ATP and 1 µM RecA (gray and black curve). A rapid change in force between 47 and 55 pN is indicated by the arrow.
    Figure Legend Snippet: Nucleation through overstretching. ( A ) Overstretching curve for lambda-phage dsDNA. ( B ) Absence of growth without overstretching and constant force of 50 pN (black curve); however, a fast increase in force through the overstretching transition (sharp peak) can start RecA polymerization showing linear growth at 50 pN on dsDNA at pH 7.6, 10 mM MgCl 2 , 1 mM ATP and 1 µM RecA (gray and black curve). A rapid change in force between 47 and 55 pN is indicated by the arrow.

    Techniques Used:

    7) Product Images from "Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway"

    Article Title: Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky943

    Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).
    Figure Legend Snippet: Effects of various types of DNA. Chain-formation activities of wild-type HLTF ( A – E ) and his HLTF ΔN ( F, G ) were analyzed under standard assay conditions containing E1, MMS2-UBC13, and ubiquitin at 30°C for 10 min with the indicated DNA. The total amounts of ubiquitin in chains in each 25 μl reaction mixture were plotted. (A) Poly(dA)-oligo(dT) is a 2:1 mixture of poly(dA) and 18-mer oligo(dT) as nucleotides. (B, F) The indicated DNA was titrated as shown. (C, G) Poly(dA) was annealed to 18-mer oligo(dT) modified with biotin at the 5′- or 3′-end at a 2:1 ratio as nucleotides. (D) Poly(dA) was annealed to 18-mer oligo(dT) modified with phosphate at the 5′-OH or 3′-OH at a 2:1 ratio as nucleotides. ( E ) Poly(dA) was annealed to 18-mer oligo(dT) with one (-C1), two (-C2), or four (-C4) additional dCs at the 3′-end at a 2:1 ratio as nucleotides. The same data with poly(dA)-oligo(dT) were plotted in graphs for the wild type (A–E) and for his HLTF ΔN (F, G) as controls. Error bars from at least two experiments are shown with the symbols. ( H ) DNA-binding assay. HLTF (upper panel) or his HLTF ΔN (middle panel) was incubated with M13mp18 ssDNA (ss) or dsDNA (ds) tethered with magnetic beads, or magnetic beads only (–), at 4°C for 2 min, and the beads were separated from the supernatants. Each fraction was analyzed by western blotting with an anti-HLTF antibody, and band intensities were measured. The relative values of binding fractions normalized by the amount of the input were plotted in a graph (bottom panel).

    Techniques Used: Modification, DNA Binding Assay, Incubation, Magnetic Beads, Western Blot, Binding Assay

    8) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    9) Product Images from "A novel nuclease-ATPase (Nar71) from archaea is part of a proposed thermophilic DNA repair system"

    Article Title: A novel nuclease-ATPase (Nar71) from archaea is part of a proposed thermophilic DNA repair system

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkh960

    ( A ) ATPase activity of Nar71 measured in malachite green assays. Reactions contained (i) 50 nM or (ii) 100 nM Nar71 and (iii) 3.3 mM Mg 2+ and 5 mM ATP. dsDNA or ssDNA (100 ng) was added as indicated. RecG (50 nM) was used as a comparison in 5 mM Mg 2+ and 5 mM ATP. In each panel, data are a mean of reactions in duplicate. ( B ) Time course reaction on 100 nM Nar71 containing 100 nM Nar71 and 100 ng ssDNA in 3.3 mM Mg 2+ and 5 mM ATP. Data are a mean of reactions in duplicate. ( C ) Effect of pre-incubating His-tag monoclonal antibody with tagged Nar71 (250 nM) prior to mixing with 5 nM 3′ flap DNA in 10 mM Mg 2+ and 15 mM ATP.
    Figure Legend Snippet: ( A ) ATPase activity of Nar71 measured in malachite green assays. Reactions contained (i) 50 nM or (ii) 100 nM Nar71 and (iii) 3.3 mM Mg 2+ and 5 mM ATP. dsDNA or ssDNA (100 ng) was added as indicated. RecG (50 nM) was used as a comparison in 5 mM Mg 2+ and 5 mM ATP. In each panel, data are a mean of reactions in duplicate. ( B ) Time course reaction on 100 nM Nar71 containing 100 nM Nar71 and 100 ng ssDNA in 3.3 mM Mg 2+ and 5 mM ATP. Data are a mean of reactions in duplicate. ( C ) Effect of pre-incubating His-tag monoclonal antibody with tagged Nar71 (250 nM) prior to mixing with 5 nM 3′ flap DNA in 10 mM Mg 2+ and 15 mM ATP.

    Techniques Used: Activity Assay

    10) Product Images from "Efficient assembly of very short oligonucleotides using T4 DNA Ligase"

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-3-291

    Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.
    Figure Legend Snippet: Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.

    Techniques Used: Activity Assay, Ligation

    11) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    12) Product Images from "Dynamics and stability of polymorphic human telomeric G-quadruplex under tension"

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku581

    Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.
    Figure Legend Snippet: Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.

    Techniques Used: Sequencing, Construct, Proton NMR

    13) Product Images from "Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates"

    Article Title: Single-molecule visualization of human BLM helicase as it acts upon double- and single-stranded DNA substrates

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkz810

    BLM is a fast and highly processive dsDNA helicase. ( A) Schematic illustration of the double-tethered DNA curtains assay. ( B ) Schematic showing experimental rational for the detection of dsDNA unwinding activity for unlabeled BLM as revealed by the binding of RPA-mCherry to the resulting ssDNA products. ( C ) Kymograph showing BLM (unlabeled) unwinding dsDNA (unlabeled) as revealed by the binding of RPA-mCherry (magenta); note that buffer flow was OFF during data collection. Arrowheads indicate the sites where BLM initiated dsDNA unwinding based upon the appearance of RPA-mCherry. Reactions contained 0.2 nM unlabeled BLM and 1 nM RPA-mCherry. ( D ) Distribution of sites where BLM initiated dsDNA unwinding; error bars represent 95% confidence intervals calculated from bootstrap analysis. (E) Quantification of BLM translocation direction in reactions with 1 nM RPA-mCherry. ‘Towards pedestal’ indicates BLM movement in the direction from the barrier to the pedestal, and ‘towards barrier’ indicates movement in the opposite direction. ( F ) Velocity distribution of BLM unwinding rates in reactions with 1 nM RPA-mCherry on double-tethered dsDNA. The solid blue line represents a Gaussian fit to the data. Error bars represent 95% confidence intervals calculated from bootstrap analysis. ( G ) Survival probability plot of BLM translocation with 1 nM RPA-mCherry on double-tethered dsDNA. Error bars represent 95% confidence intervals calculated from bootstrap analysis.
    Figure Legend Snippet: BLM is a fast and highly processive dsDNA helicase. ( A) Schematic illustration of the double-tethered DNA curtains assay. ( B ) Schematic showing experimental rational for the detection of dsDNA unwinding activity for unlabeled BLM as revealed by the binding of RPA-mCherry to the resulting ssDNA products. ( C ) Kymograph showing BLM (unlabeled) unwinding dsDNA (unlabeled) as revealed by the binding of RPA-mCherry (magenta); note that buffer flow was OFF during data collection. Arrowheads indicate the sites where BLM initiated dsDNA unwinding based upon the appearance of RPA-mCherry. Reactions contained 0.2 nM unlabeled BLM and 1 nM RPA-mCherry. ( D ) Distribution of sites where BLM initiated dsDNA unwinding; error bars represent 95% confidence intervals calculated from bootstrap analysis. (E) Quantification of BLM translocation direction in reactions with 1 nM RPA-mCherry. ‘Towards pedestal’ indicates BLM movement in the direction from the barrier to the pedestal, and ‘towards barrier’ indicates movement in the opposite direction. ( F ) Velocity distribution of BLM unwinding rates in reactions with 1 nM RPA-mCherry on double-tethered dsDNA. The solid blue line represents a Gaussian fit to the data. Error bars represent 95% confidence intervals calculated from bootstrap analysis. ( G ) Survival probability plot of BLM translocation with 1 nM RPA-mCherry on double-tethered dsDNA. Error bars represent 95% confidence intervals calculated from bootstrap analysis.

    Techniques Used: Activity Assay, Binding Assay, Recombinase Polymerase Amplification, Flow Cytometry, Translocation Assay

    BLM cannot dismantle RAD51-bound heteroduplex DNA joints. ( A ) Schematic illustration of heteroduplex joints prepared with RAD51–ssDNA curtains and an Atto565-labeled dsDNA oligonucleotide (70-bp) bearing 15-nts of sequence homologous to the M13-derived ssDNA substrate. ( B ) Percent of GFP–BLM (15 nM) molecules bound the Atto565-labeled heteroduplex DNA joints or bound elsewhere on the RAD51–ssDNA ( N = 116). (C) Kymograph showing outcomes of reactions containing GFP–BLM (15 nM) with RAD51–ssDNA curtains preassembled with the Atto565-labeled heteroduplex DNA joints; note that buffer flow was OFF during data collection. The Asterix highlights an example of bound GFP–BLM that did not co-localize with the heteroduplex DNA joint.
    Figure Legend Snippet: BLM cannot dismantle RAD51-bound heteroduplex DNA joints. ( A ) Schematic illustration of heteroduplex joints prepared with RAD51–ssDNA curtains and an Atto565-labeled dsDNA oligonucleotide (70-bp) bearing 15-nts of sequence homologous to the M13-derived ssDNA substrate. ( B ) Percent of GFP–BLM (15 nM) molecules bound the Atto565-labeled heteroduplex DNA joints or bound elsewhere on the RAD51–ssDNA ( N = 116). (C) Kymograph showing outcomes of reactions containing GFP–BLM (15 nM) with RAD51–ssDNA curtains preassembled with the Atto565-labeled heteroduplex DNA joints; note that buffer flow was OFF during data collection. The Asterix highlights an example of bound GFP–BLM that did not co-localize with the heteroduplex DNA joint.

    Techniques Used: Labeling, Sequencing, Derivative Assay, Flow Cytometry

    14) Product Images from "Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters"

    Article Title: Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2017.12.030

    DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.
    Figure Legend Snippet: DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.

    Techniques Used: Binding Assay, Methylation, Activity Assay, Real-time Polymerase Chain Reaction, Pull Down Assay

    15) Product Images from "Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters"

    Article Title: Senataxin Mutation Reveals How R-loops Promote Transcription by Blocking DNA Methylation at Gene Promoters

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2017.12.030

    DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.
    Figure Legend Snippet: DNMT1 favors binding and methylation of dsDNA over RNA/DNA hybrid ( A ) DNMT1 activity is higher with dsDNA than RNA-DNA hybrid as substrates; error bars represent SEM of triplicates. ( B ) Binding affinity of DNMT1 for dsDNA is higher than for RNA/DNA hybrid. EMSA was used to measure binding of DNMT1 to BAMBI promoter represented as biotinylated dsDNA or corresponding RNA/DNA hybrid. Unlabeled dsDNA was added as competitor to show specificity of binding. ( C ) More binding of DNMT1 to dsDNA than RNA/DNA hybrid. Binding with a dilution series of DNMT1 to 2.5nM dsDNA (solid lines) or RNA/DNA hybrid (dotted lines) assayed by biolayer interferometry. Baseline was recorded from 0 to 300 seconds, association of DNMT1 with dsDNA or RNA/DNA hybrid from 300-900 seconds, followed by dissociation. ( D ) ALS4 patients have less nascent transcripts of BAMBI . In nuclear run-on (NRO) of primary fibroblasts (n = 2 controls 2 ALS4 patients), nascent transcript level was measured by quantitative PCR using primers specific to promoter of BAMBI , and normalized to promoter of a housekeeping gene ABLI that has no R-loops in S9.6 pull-down assay.

    Techniques Used: Binding Assay, Methylation, Activity Assay, Real-time Polymerase Chain Reaction, Pull Down Assay

    16) Product Images from "RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin"

    Article Title: RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin

    Journal: eLife

    doi: 10.7554/eLife.25299

    Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009
    Figure Legend Snippet: Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009

    Techniques Used: RNA Binding Assay, In Vitro, Competitive Binding Assay, Labeling, Binding Assay, Purification, Sequencing, Standard Deviation

    17) Product Images from "Complementary strand relocation may play vital roles in RecA-based homology recognition"

    Article Title: Complementary strand relocation may play vital roles in RecA-based homology recognition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks769

    Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.
    Figure Legend Snippet: Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.

    Techniques Used:

    Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.
    Figure Legend Snippet: Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.

    Techniques Used: Binding Assay

    Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).
    Figure Legend Snippet: Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).

    Techniques Used: Binding Assay, Concentration Assay

    Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.
    Figure Legend Snippet: Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.

    Techniques Used: Binding Assay, Construct

    18) Product Images from "Polymerization and mechanical properties of single RecA-DNA filaments"

    Article Title: Polymerization and mechanical properties of single RecA-DNA filaments

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Polymerization of RecA on dsDNA with or without force feedback. ( a ) Polymerization speed of two different RecA dsDNA fibers (●, ▴) polymerized at constant force of 64 pN in the presence of ATP[γS]. The time between points is 0.8 s, and a running average of 30 points was applied. Frame-grabber jitter of ≈20 nm probably causes the fast fluctuations. Both experiments shown, eventually covered the full length of the DNA. ( b ) Polymerization speed of three different RecA fibers without force feedback (see text). The figure shows the polymerization rate vs. the force applied to the growing DNA RecA fiber. ( Inset ) ln(rate) vs. force analysis of the slope allows one to extract the step size of the polymerization.
    Figure Legend Snippet: Polymerization of RecA on dsDNA with or without force feedback. ( a ) Polymerization speed of two different RecA dsDNA fibers (●, ▴) polymerized at constant force of 64 pN in the presence of ATP[γS]. The time between points is 0.8 s, and a running average of 30 points was applied. Frame-grabber jitter of ≈20 nm probably causes the fast fluctuations. Both experiments shown, eventually covered the full length of the DNA. ( b ) Polymerization speed of three different RecA fibers without force feedback (see text). The figure shows the polymerization rate vs. the force applied to the growing DNA RecA fiber. ( Inset ) ln(rate) vs. force analysis of the slope allows one to extract the step size of the polymerization.

    Techniques Used:

    F vs. extension plot for dsDNA–RecA ATP filaments. Fully coated dsDNA–RecA ATP form (empty circles correspond to the extension cycle and filled circles indicate the relaxation cycle). After RecA was depleted from the surrounding buffer an intermediate dsDNA–RecA ATP filament (triangles) that did not show any hysteresis as in the fully coated version showed up. The small dots correspond to dsDNA, shown here for reference.
    Figure Legend Snippet: F vs. extension plot for dsDNA–RecA ATP filaments. Fully coated dsDNA–RecA ATP form (empty circles correspond to the extension cycle and filled circles indicate the relaxation cycle). After RecA was depleted from the surrounding buffer an intermediate dsDNA–RecA ATP filament (triangles) that did not show any hysteresis as in the fully coated version showed up. The small dots correspond to dsDNA, shown here for reference.

    Techniques Used:

    19) Product Images from "Upgrading SELEX Technology by Using Lambda Exonuclease Digestion for Single-Stranded DNA Generation"

    Article Title: Upgrading SELEX Technology by Using Lambda Exonuclease Digestion for Single-Stranded DNA Generation

    Journal: Molecules

    doi: 10.3390/molecules15010001

    Digestion of the phosphorylated strand of dsDNA with 25 U lambda exonuclease after PCR with 1 ng template per reaction.
    Figure Legend Snippet: Digestion of the phosphorylated strand of dsDNA with 25 U lambda exonuclease after PCR with 1 ng template per reaction.

    Techniques Used: Polymerase Chain Reaction

    20) Product Images from "The poor homology stringency in the heteroduplex allows strand exchange to incorporate desirable mismatches without sacrificing recognition in vivo"

    Article Title: The poor homology stringency in the heteroduplex allows strand exchange to incorporate desirable mismatches without sacrificing recognition in vivo

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv610

    Molecular Dynamics simulation for poly dA-dT and poly dG-dT dsDNA in site I. ( A ) Schematic of the molecular dynamics simulation system. The solvation water is shown as the transparent box and the sodium and chloride ions are shown as pink and purple sphere, respectively. The molecule in surface representation is the RecA-DNA complex. ( B ) Structure of the matched and mismatched DNA in site I at the end of the 15 ns conventional MD simulation. The initiating, and matched and mismatched complementary strands are shown in yellow, cyan and green, respectively. The overlapping structures are obtained from the last 10 ns of the simulation with 1 ns gap. ( C and D ). Detail illustrations of the stable nucleotide triplet at the end of the simulation for matched and mismatched strands.
    Figure Legend Snippet: Molecular Dynamics simulation for poly dA-dT and poly dG-dT dsDNA in site I. ( A ) Schematic of the molecular dynamics simulation system. The solvation water is shown as the transparent box and the sodium and chloride ions are shown as pink and purple sphere, respectively. The molecule in surface representation is the RecA-DNA complex. ( B ) Structure of the matched and mismatched DNA in site I at the end of the 15 ns conventional MD simulation. The initiating, and matched and mismatched complementary strands are shown in yellow, cyan and green, respectively. The overlapping structures are obtained from the last 10 ns of the simulation with 1 ns gap. ( C and D ). Detail illustrations of the stable nucleotide triplet at the end of the simulation for matched and mismatched strands.

    Techniques Used:

    21) Product Images from "DIDS, a chemical compound that inhibits RAD51-mediated homologous pairing and strand exchange"

    Article Title: DIDS, a chemical compound that inhibits RAD51-mediated homologous pairing and strand exchange

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp200

    The strand-exchange assay with human RAD51. ( A ) A schematic diagram of the strand-exchange assay. ( B ) The strand exchange activity of RAD51 under the three different conditions. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecules and nicked circular DNA are indicated by jm and nc, respectively. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate experiments with RAD51 in the absence and presence of 0.2 M KCl, respectively. Lane 4 indicates an experiment with 5% methanol in the absence of 0.2 M KCl.
    Figure Legend Snippet: The strand-exchange assay with human RAD51. ( A ) A schematic diagram of the strand-exchange assay. ( B ) The strand exchange activity of RAD51 under the three different conditions. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecules and nicked circular DNA are indicated by jm and nc, respectively. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate experiments with RAD51 in the absence and presence of 0.2 M KCl, respectively. Lane 4 indicates an experiment with 5% methanol in the absence of 0.2 M KCl.

    Techniques Used: Activity Assay, Incubation, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Staining, Negative Control

    Effects of the DIDS reaction order on RAD51-mediated strand exchange. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA containing 2 μM 32 P-labeled ϕX174 linear dsDNA, in the absence of 0.2 M KCl. The reactions were stopped and deproteinized at the indicated times, and the products were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The jm products and dsDNA labeled by 32 P were visualized and quantified using an FLA-7000 imaging analyzer (Fujifilm). ( A ) RAD51 was incubated with DIDS (10 μM) at 37°C for 10 min. After the addition of the ϕX174 circular ssDNA, RPA was added to the reaction mixture. The ϕX174 linear dsDNA was then added to initiate the reaction. The reactions were continued for the indicated times. Lanes 1–4 indicate positive control experiments with RAD51 and 5% methanol. Lanes 5–8 indicate experiments with RAD51 and DIDS (and 5% methanol). Reaction times were 0 min (lanes 1 and 5), 30 min (lanes 2 and 6), 60 min (lanes 3 and 7) and 90 min (lanes 4 and 8). ( B ) Graphic representation of the experiments shown in (A). Closed and open circles indicate experiments with and without DIDS, respectively. ( C ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min. After this incubation, DIDS (10 μM) was added, followed by the addition of RPA. The ϕX174 linear dsDNA was then added to initiate the reaction. ( D ) Graphic representation of the experiments shown in (C). Closed and open circles indicate experiments with and without DIDS, respectively. ( E ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min, and RPA was added. DIDS was added, and then ϕX174 linear dsDNA was added to initiate the reaction. ( F ) Graphic representation of the experiments shown in (E). Closed and open circles indicate experiments with and without DIDS, respectively.
    Figure Legend Snippet: Effects of the DIDS reaction order on RAD51-mediated strand exchange. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA containing 2 μM 32 P-labeled ϕX174 linear dsDNA, in the absence of 0.2 M KCl. The reactions were stopped and deproteinized at the indicated times, and the products were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The jm products and dsDNA labeled by 32 P were visualized and quantified using an FLA-7000 imaging analyzer (Fujifilm). ( A ) RAD51 was incubated with DIDS (10 μM) at 37°C for 10 min. After the addition of the ϕX174 circular ssDNA, RPA was added to the reaction mixture. The ϕX174 linear dsDNA was then added to initiate the reaction. The reactions were continued for the indicated times. Lanes 1–4 indicate positive control experiments with RAD51 and 5% methanol. Lanes 5–8 indicate experiments with RAD51 and DIDS (and 5% methanol). Reaction times were 0 min (lanes 1 and 5), 30 min (lanes 2 and 6), 60 min (lanes 3 and 7) and 90 min (lanes 4 and 8). ( B ) Graphic representation of the experiments shown in (A). Closed and open circles indicate experiments with and without DIDS, respectively. ( C ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min. After this incubation, DIDS (10 μM) was added, followed by the addition of RPA. The ϕX174 linear dsDNA was then added to initiate the reaction. ( D ) Graphic representation of the experiments shown in (C). Closed and open circles indicate experiments with and without DIDS, respectively. ( E ) RAD51 was incubated with the ϕX174 circular ssDNA at 37°C for 10 min, and RPA was added. DIDS was added, and then ϕX174 linear dsDNA was added to initiate the reaction. ( F ) Graphic representation of the experiments shown in (E). Closed and open circles indicate experiments with and without DIDS, respectively.

    Techniques Used: Incubation, Recombinase Polymerase Amplification, Labeling, Agarose Gel Electrophoresis, Imaging, Positive Control

    DIDS efficiently inhibits RAD51-mediated strand exchange. ( A ) DIDS titration experiments in the absence of 0.2 M KCl. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) in the presence of DIDS at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecule is indicated by jm. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 and 5% methanol in the absence of DIDS. DIDS concentrations were 0.01 μM (lane 3), 0.1 μM (lane 4), 1 μM (lane 5) and 10 μM (lane 6). Lane 7 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( B ) Graphic representation of the experiments shown in (A). The band intensities of the jm product were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (A, lane 2) were plotted against the DIDS concentration. ( C ) The strand-exchange assay in the presence of 0.2 M KCl. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate control experiments without DIDS with RAD51 in the absence and presence of 5% methanol, respectively. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( D ) Graphic representation of the experiments shown in (C). The band intensities of the jm products were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (C, lane 3) were plotted against the DIDS concentration.
    Figure Legend Snippet: DIDS efficiently inhibits RAD51-mediated strand exchange. ( A ) DIDS titration experiments in the absence of 0.2 M KCl. The ϕX174 circular ssDNA (20 μM) was incubated with RAD51 (6 μM) in the presence of DIDS at 37°C for 10 min. After this incubation, 2 μM RPA was added to the reaction mixture, which was incubated at 37°C for 10 min. The reactions were then initiated by the addition of 20 μM ϕX174 linear dsDNA. The DNA products were then deproteinized, and were separated by 1% agarose gel electrophoresis in 1× TAE buffer at 3.3 V/cm for 4 h. The products were visualized by SYBR Gold (Invitrogen) staining. Joint molecule is indicated by jm. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 and 5% methanol in the absence of DIDS. DIDS concentrations were 0.01 μM (lane 3), 0.1 μM (lane 4), 1 μM (lane 5) and 10 μM (lane 6). Lane 7 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( B ) Graphic representation of the experiments shown in (A). The band intensities of the jm product were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (A, lane 2) were plotted against the DIDS concentration. ( C ) The strand-exchange assay in the presence of 0.2 M KCl. Lane 1 indicates a negative control experiment without RAD51. Lanes 2 and 3 indicate control experiments without DIDS with RAD51 in the absence and presence of 5% methanol, respectively. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( D ) Graphic representation of the experiments shown in (C). The band intensities of the jm products were quantified as the peak volumes of densitometric scans. The jm peak volumes relative to that in the reaction without DIDS (C, lane 3) were plotted against the DIDS concentration.

    Techniques Used: Titration, Incubation, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Staining, Negative Control, Concentration Assay

    The strand-exchange assay in the presence of chemical compounds. ( A ) Each chemical compound (10 μM, lanes 1–185) was incubated with RAD51 (6 μM), and the strand-exchange reaction was performed under the conditions containing 5% methanol at 37°C for 1 h with 20 μM ssDNA, 20 μM dsDNA and 2 μM RPA. Lanes C, R and M indicate negative control reactions without RAD51, complete reactions and complete reactions with 5% methanol, respectively. The chemical compounds are listed in Supplementary Table 1 . ( B ) Structure of 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS).
    Figure Legend Snippet: The strand-exchange assay in the presence of chemical compounds. ( A ) Each chemical compound (10 μM, lanes 1–185) was incubated with RAD51 (6 μM), and the strand-exchange reaction was performed under the conditions containing 5% methanol at 37°C for 1 h with 20 μM ssDNA, 20 μM dsDNA and 2 μM RPA. Lanes C, R and M indicate negative control reactions without RAD51, complete reactions and complete reactions with 5% methanol, respectively. The chemical compounds are listed in Supplementary Table 1 . ( B ) Structure of 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS).

    Techniques Used: Incubation, Recombinase Polymerase Amplification, Negative Control

    DIDS inhibits DNA binding by RAD51. ( A ) The ssDNA-binding experiments in the presence of ATP. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) in the presence of DIDS at 37°C for 15 min. The samples were analyzed by 0.8% agarose gel electrophoresis in 1× TAE buffer. The bands were visualized by ethidium bromide staining. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lane 7). Lane 8 indicates an experiment with 20 μM DIDS in the absence of RAD51. ( B ) The dsDNA-binding experiments in the presence of ATP. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( C ) The ssDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) at 37°C for 15 min. Lanes 1–4, lanes 5–8 and lanes 9–12 represent experiments with ATP, AMPPNP and ATPγS, respectively. Lanes 1, 5 and 9 indicate negative control experiments without RAD51. Lanes 2, 6 and 10 indicate experiments with RAD51 alone. Lanes 3, 7 and 11 indicate experiments with RAD51 and 5% methanol. Lanes 4, 8 and 12 indicate experiments with RAD51 and DIDS (20 μM). ( D ) The dsDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lanes correspond to those in (C). The DIDS concentration was 10 μM. ( E ) Effect of DIDS on the ssDNA binding of RPA. The ϕX174 circular ssDNA (40 μM) was incubated with RPA (0.5 μM) in the presence of DIDS at 37°C for 15 min. Lanes 1 and 8 indicate negative control experiments without RPA. Lanes 2 and 3 indicate experiments with RPA in the absence and presence of 5% methanol, respectively. The DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lanes 7 and 8). ( F ) The ssDNA-binding and dsDNA-binding experiments with RAD51 were performed in the presence of methanol. Lanes 1–6 and lanes 7–12 indicate experiments with ssDNA and dsDNA, respectively. Lanes 1, 6, 7 and 12 are negative controls without RAD51, and lanes 2 and 8 are positive controls with RAD51 in the absence of methanol. Methanol concentrations were 2.5% (lanes 3 and 9), 5% (lanes 4 and 10) and 10% (lanes 5, 6, 11 and 12).
    Figure Legend Snippet: DIDS inhibits DNA binding by RAD51. ( A ) The ssDNA-binding experiments in the presence of ATP. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) in the presence of DIDS at 37°C for 15 min. The samples were analyzed by 0.8% agarose gel electrophoresis in 1× TAE buffer. The bands were visualized by ethidium bromide staining. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lane 7). Lane 8 indicates an experiment with 20 μM DIDS in the absence of RAD51. ( B ) The dsDNA-binding experiments in the presence of ATP. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lane 1 indicates a negative control experiment without RAD51. Lane 2 indicates an experiment with RAD51 alone. Lane 3 indicates an experiment with RAD51 and 5% methanol. DIDS concentrations were 0.01 μM (lane 4), 0.1 μM (lane 5), 1 μM (lane 6) and 10 μM (lane 7). Lane 8 indicates an experiment with 10 μM DIDS in the absence of RAD51. ( C ) The ssDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The ϕX174 circular ssDNA (40 μM) was incubated with RAD51 (2 μM) at 37°C for 15 min. Lanes 1–4, lanes 5–8 and lanes 9–12 represent experiments with ATP, AMPPNP and ATPγS, respectively. Lanes 1, 5 and 9 indicate negative control experiments without RAD51. Lanes 2, 6 and 10 indicate experiments with RAD51 alone. Lanes 3, 7 and 11 indicate experiments with RAD51 and 5% methanol. Lanes 4, 8 and 12 indicate experiments with RAD51 and DIDS (20 μM). ( D ) The dsDNA-binding experiments in the presence of ATP, AMPPNP and ATPγS. The linear ϕX174 dsDNA (10 μM) was incubated with RAD51 (1 μM) in the presence of DIDS at 37°C for 15 min. Lanes correspond to those in (C). The DIDS concentration was 10 μM. ( E ) Effect of DIDS on the ssDNA binding of RPA. The ϕX174 circular ssDNA (40 μM) was incubated with RPA (0.5 μM) in the presence of DIDS at 37°C for 15 min. Lanes 1 and 8 indicate negative control experiments without RPA. Lanes 2 and 3 indicate experiments with RPA in the absence and presence of 5% methanol, respectively. The DIDS concentrations were 0.1 μM (lane 4), 1 μM (lane 5), 10 μM (lane 6) and 20 μM (lanes 7 and 8). ( F ) The ssDNA-binding and dsDNA-binding experiments with RAD51 were performed in the presence of methanol. Lanes 1–6 and lanes 7–12 indicate experiments with ssDNA and dsDNA, respectively. Lanes 1, 6, 7 and 12 are negative controls without RAD51, and lanes 2 and 8 are positive controls with RAD51 in the absence of methanol. Methanol concentrations were 2.5% (lanes 3 and 9), 5% (lanes 4 and 10) and 10% (lanes 5, 6, 11 and 12).

    Techniques Used: Binding Assay, Incubation, Agarose Gel Electrophoresis, Staining, Negative Control, Concentration Assay, Recombinase Polymerase Amplification

    22) Product Images from "Complementary strand relocation may play vital roles in RecA-based homology recognition"

    Article Title: Complementary strand relocation may play vital roles in RecA-based homology recognition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks769

    Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.
    Figure Legend Snippet: Proposed schematics of the strand exchange process. ( A ) Representation of the side view of the X-ray structure of the dsDNA heteroduplex in the final post-strand exchange state with incoming and complementary strands indicated by the cyan and red stick renderings. Orange, cyan and red arrows indicate the positions of the corresponding phosphates on the outgoing, incoming, and complementary strands in the final post-strand exchange structure. The VMD ( 9 ) renderings of RecA crystal structure 3CMX ( 8 ) show site II residues Arg226 (pink), Arg243 (yellow) and Lys245 (magenta) with charged nitrogen atoms (blue). The outgoing strand position was calculated by minimizing the energy of the interaction with those residues. The grey arrow points at the red plus sign indicating the proposed position of the corresponding complementary strand phosphate in the proposed intermediate structure. ( B ) Bottom view of the same structure. Circles correspond to the radii occupied by the phosphates. ( C ) Information as in Figure 1 B, but only one set of the corresponding phosphates is shown. Final state phosphate positions for the incoming, complementary, and outgoing strands are shown with filled colored circles. Paired bases shown as lines. The complementary strand position in the proposed intermediate structure is shown by the grey circle. ( D ) Same as Figure 1 B with circles and base pairs added to show radial positions of the corresponding phosphate groups and repositioning of the complementary strand.

    Techniques Used:

    Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.
    Figure Legend Snippet: Proposed steps in strand exchange and free RecA binding. ( A ) Schematic of the steps involved in the proposed strand exchange process. Grey areas show regions occupied by the protein, excluding the L2 loop: ( i ) incoming strand (cyan), in the post-strand exchange state. ( ii ) dsDNA outgoing strand (orange circle) bound into Site II; complementary strand (red filled circle) in proposed intermediate position. ( iii ) Complementary strand bases and incoming strand bases rotate in search of homology, where an L2 loop may rotate with the incoming strand. ( iv ) Strand exchanged state that may benefit from an interaction with the L2 loop if the bases are homologous. ( v ) The heteroduplex dsDNA rotates to the final X-ray structure position, possibly accompanied by the L2 loop. ( B ) Schematic of possible steps in the binding of free RecA to dsDNA: ( i ) an additional free RecA binds to the dsDNA in the intermediate state, possibly accompanied by an interaction with the L2 loop. ( ii ) dsDNA (red circle) rotates to the final state shown by the x-ray structure, possibly accompanied by the L2 loop.

    Techniques Used: Binding Assay

    Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).
    Figure Legend Snippet: Comparison of the measured dsDNA elongation rates due to strand exchange and the binding of free RecA to dsDNA. ( A ) Arrhenius plot: strand exchange rates in bulk experiments and no external force ( 21 ) (black line); single-molecule strand exchange rates in ATP or ATPγS: grey diamonds ( 23 ) and grey squares ( 24 ); dsDNA release rate at the back of the strand exchange window in ATP: grey triangle ( 22 ); new results for strand exchange in ATPγS (red triangles), ATPγS–ADP (outlined-red square), and free RecA binding (red circles). Error bars: confidence intervals. ( B ) Extension rates as a function of MgCl 2 concentration. Log of single-molecule dsDNA extension rates (nm/s) as a function of MgCl 2 concentration (mM) for both free RecA binding (navy diamonds) and strand exchange (green triangles) in ATPγS at 22°C. MgCl 2 concentrations varied from 0.1 to 10 mM. The dependence of the rates of free RecA binding on MgCl 2 concentration is fit by a logarithmic trend-line (black line).

    Techniques Used: Binding Assay, Concentration Assay

    Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.
    Figure Legend Snippet: Effect of force applied to different ends of dsDNA λ-phage during strand exchange and free RecA binding. ( A ) Elongation rate histogram for strand exchange in ATPγS at 30°C; peak 1 shows the characteristic rate of 211.8 bp/min (0.60 nm/s) whereas peak 0 corresponds to molecules that were followed but showed no change in extension. ( B ) Extension rates as a function of temperature for different 3′5′- and 3′3′-pulling techniques. Arrhenius plot of single-molecule extension rates as a function of temperature for free RecA binding and strand exchange in ATPγS and 10 mM MgCl 2 with 3′5′ and 3′3′ pulling techniques. Strand exchange rates in bulk experiments and no external force ( 21 ) (grey line); free RecA binding while pulling 3′5′ from the complementary strand (red plus signs); free RecA binding while pulling 3′5′ from the outgoing strand (blue × symbols). Strand exchange rate while pulling 3′5′ from the complementary strand (red squares) and while pulling the other 3′5′ strand with the alternative filament complementary to the pulled strand (red diamond). Strand exchange rate while pulling 3′5′ from the outgoing strand (blue circles); strand exchange rate while pulling 3′3′ from the outgoing strand nearest the filament (grey triangle) and strand exchange rate while pulling 3′3′ from the complementary strand nearest the filament (grey upside-down triangle). Error bars: confidence intervals. ( C ) Schematic representation of the effect of force applied to different ends of the dsDNA constructs during strand exchange experiments. ( i , ii and iii ) dsDNA pulled from 3′5′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. ( iv and v ) dsDNA pulled from the 3′3′-ends with stressed and unstressed base pairs shown in magenta and blue, respectively. The grey and black ssDNA correspond to filaments complementary to opposite strands of the dsDNA. In the representation of strand exchange in the first row, the RecA molecules were omitted for better clarity. The lavender band indicates the GC-rich end in λ-phage dsDNA. The ellipses in the second row indicate RecA monomers with Site I and Site II shown in grey and purple, respectively. The outgoing, complementary, and incoming strands are shown in orange, red and cyan, respectively. The effect of pulling the 3′5′-ends of the complementary strand, 3′5′-ends of the outgoing strand, and 3′3′-ends of the dsDNA is represented. The symbols under each figure correspond to the symbols in Figure 3 B.

    Techniques Used: Binding Assay, Construct

    23) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    Competitive fluorescence quenching of ethidium bromide bound to calf thymus (ct-DNA) by opioid drugs MC3, HC3 and OC3 , viscosity properties of MC3 , ethidium bromide and spermine ( SPM ) exposed to salmon testes dsDNA, and turbidity profiles of CT-DNA in the presence of titrated C 3 opioids and spermine. Data points being displayed as an average of triplicate measurement for fluorescence quenching and turbidity measurements.
    Figure Legend Snippet: Competitive fluorescence quenching of ethidium bromide bound to calf thymus (ct-DNA) by opioid drugs MC3, HC3 and OC3 , viscosity properties of MC3 , ethidium bromide and spermine ( SPM ) exposed to salmon testes dsDNA, and turbidity profiles of CT-DNA in the presence of titrated C 3 opioids and spermine. Data points being displayed as an average of triplicate measurement for fluorescence quenching and turbidity measurements.

    Techniques Used: Fluorescence

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.
    Figure Legend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Techniques Used: Generated, Incubation

    24) Product Images from "RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants"

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18122546

    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Figure Legend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Techniques Used: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    25) Product Images from "RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin"

    Article Title: RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin

    Journal: eLife

    doi: 10.7554/eLife.25299

    Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009
    Figure Legend Snippet: Characterization of SUV39H1-RNA binding in vitro. ( A ) Competitive binding assay measuring the ability of unlabeled 19mer ssRNA to compete with the interaction of labeled 19mer ssRNA binding to MBP-SUV39H1 42–106. MBP-SUV39H1 42–106 present at 12.4 μM, labeled RNA at approximately 3 nM, and unlabeled RNA at concentrations ranging from 30 to 1500 nM. Percent labeled RNA bound is quantified and listed. ( B ) Various nucleic acids oligonucleotides consisting of the first 50 bases of E. coli MBP run out on a native polyacrylamide gel. Oligonucleotides were annealed to create various nucleic acids and end labeled with radioactive 32 P. ssRNA 1, sense MBP 1–50; ssRNA 2, anti-sense MBP 1–50; ssDNA, sense MBP 1–50. ( C ) Representative EMSAs showing the binding of purified MBP-SUV39H1 1–106 and to various nucleic acids, all composed of the E. coli MBP 1–50 sequence, shown in B. Protein is diluted 2-fold from 25 μM. Quantification in Figure 3E . ( D ) Left, binding curves showing binding of MBP-SUV39H1 1–106 and either sense or anti-sense 19mer ssRNA, protein diluted 2-fold from 100 µM. Error bars are standard deviation from two independent experiments. Right, dissociation constants (K d , μM) determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. ( E ) Representative EMSAs showing binding of purified MBP-SUV39H1 1–106 to 180 bases of either α-satellite or β-actin ssRNA. Protein diluted 2-fold from 2.5 μM. Quantification in Figure 3F . ( F ) SUV39H1 affinity increases as length of nucleic acid increases. Binding curves compiled from Figure 3E and F (50mers and 180mers, respectively) and D ) (19mers) showing the binding of MBP-SUV39H1 1–106 to various nucleic acid types. 19mer random sequence: sense and antisense ssRNA; 50mer MBP 1–50: sense and antisense ssRNA, ssDNA, dsRNA, dsDNA, and RNA/DNA hybrid; 180mers: α-satellite and β-actin ssRNA. All sequences are described in the materials and methods. Error bars are standard deviation from two independent experiments. Dissociation constants (K d , μM) displayed on graph are determined by non-linear fitting of the binding curves. Standard error represents the error of the curve fitting to the average of two experimental replicates. DOI: http://dx.doi.org/10.7554/eLife.25299.009

    Techniques Used: RNA Binding Assay, In Vitro, Competitive Binding Assay, Labeling, Binding Assay, Purification, Sequencing, Standard Deviation

    Related Articles

    Ligation:

    Article Title: Optimised ligation of oligonucleotides by thermal ligases: comparison of Thermus scotoductus and Rhodothermus marinus DNA ligases to other thermophilic ligases
    Article Snippet: .. Our system for the analysis of the rate and fidelity of DNA ligases is centred around the sequential ligation of oligonucleotides from a complete library, using M13mp18 ssDNA as a template. .. This process of sequential ligation is directed by the 32 P-labelled primer M13P (Fig. ).

    Article Title: Optimised ligation of oligonucleotides by thermal ligases: comparison of Thermus scotoductus and Rhodothermus marinus DNA ligases to other thermophilic ligases
    Article Snippet: .. Each library was incorporated separately into the following ligation reactions in which the libraries were present at different concentrations ranging from 1.3 × 10–1 to 15.7 nmol of library (2–120 fmol of each individual oligonucleotide), 15 fmol of M13mp18 ssDNA (New England Biolabs), 60 fmol of γ-32 P-labelled M13P oligonucleotide, 60 fmol of unlabelled M13P oligonucleotide, 0.5× buffer (10 mM Tris–HCl, pH 8.3, 25 mM KCl, 5 mM MgCl2 , 0.5 mM EDTA, 0.5 mM NAD+ , 5 mM DTT, 0.25% Triton X-100; Advanced Biotechnologies Ltd), 1.3 pmol Tth DNA ligase, in a total volume of 10 µl. ..

    Generated:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Labeling:

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity
    Article Snippet: .. After incubating at 37°C for 1 h, unincorporated nucleotide was removed by passing the primer through a MicroSpin S-200 HR column and the labeled primer was annealed to 0.25 μg of M13mp18 DNA (New England Biolabs) by heating to 96°C and slowly cooling to room temperature; 0.5 μg of reverse transcriptase was added to the labeled template-primer complex in 25 mM Tris-HCl (pH 8.0)-75 mM KCl-8 mM MgCl2 -2 mM dithiothreitol-100 μg of bovine serum albumin per ml-10 mM CHAPS. ..

    Incubation:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: .. M13mp18 was then added to the 30 L reaction mixture and incubated for an additional 45 minutes. .. A fraction of the reaction was taken out every 5 minutes, quenched in 6X purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) .

    Sequencing:

    Article Title: The Initial Response of a Eukaryotic Replisome to DNA Damage
    Article Snippet: .. Primase assay Primed template was prepared by annealing oligonucleotide JY180 (500 nM) (sequence: ) to M13mp18 ssDNA (50 nM) (New England Biolabs) in 10 mM Tris-Cl pH 7.6, 5 mM EDTA and 100 mM NaCl. .. Unannealed oligonucleotide was removed with an S400 column (GE Healthcare).

    Plasmid Preparation:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs double stranded dna dsdna
    CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). <t>DNA</t> sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, <t>dsDNA</t> size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).
    Double Stranded Dna Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/double stranded dna dsdna/product/New England Biolabs
    Average 92 stars, based on 134 article reviews
    Price from $9.99 to $1999.99
    double stranded dna dsdna - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs dsdna donor cassettes
    Modification of 5’ ends of long <t>dsDNA</t> fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo <t>PCR</t> genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.
    Dsdna Donor Cassettes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna donor cassettes/product/New England Biolabs
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dsdna donor cassettes - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). DNA sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, dsDNA size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).

    Journal: Nucleic Acids Research

    Article Title: Adaptation of the Haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process

    doi: 10.1093/nar/gkt1154

    Figure Lengend Snippet: CRISPR adaptation to HHPV-2 infection. ( A ) Depiction of the single CRISPR structure and the preceding cas operon carried by the H. hispanica ATCC 33960 genome. Primers used to examine CRISPR expansion (in panel B) are shown as black arrows and listed in Supplementary Table S2 . ( B ) PCR assay to detect CRISPR expansion at the leader end (L1–L2), the inner part (I1–I2) or the distal end (D1–D2). DNA sampled from infected (+) or uninfected (−) cells was used as PCR templates. Lane M, dsDNA size marker. ( C ) The sequence logo showing the conserved PAM of TTC. The 20 nt upstream of each protospacer observed during HHPV-2 infection were collected and analyzed with WebLogo ( http://weblogo.berkeley.edu/logo.cgi ).

    Article Snippet: The single-stranded DNA (ssDNA) (ФX174ss) and double-stranded DNA (dsDNA) (ФX174ds) from phiX174 phage (purchased from New England Biolabs) were used as controls.

    Techniques: CRISPR, Infection, Polymerase Chain Reaction, Marker, Sequencing

    Adaptation to HHPV-2 infection under different cas genetic backgrounds. ( A ) Cas requirement for adaptation. For each cas mutant, DNA was sampled from cells transformed with an empty plasmid (−) or the plasmid carrying the deleted cas gene(s) (+). The plasmid-carried cas gene(s) was/were under the control of the cas operon promoter. ( B ) Requirements for the nuclease and helicase activities of Cas3. Alanine replacement was performed for the putative key residues in the HD nuclease domain (H20A, H55A, D56A and D229A) and the DExD/H helicase domain (K315A, D439A and E440A). Another two conserved residues (His6 and Lys113) were also mutated. The empty plasmid (−) and the plasmid carrying a wild-type Cas3 (Cas3 WT ) were used, respectively, as negative and positive controls. Lane Ms, dsDNA size markers.

    Journal: Nucleic Acids Research

    Article Title: Adaptation of the Haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process

    doi: 10.1093/nar/gkt1154

    Figure Lengend Snippet: Adaptation to HHPV-2 infection under different cas genetic backgrounds. ( A ) Cas requirement for adaptation. For each cas mutant, DNA was sampled from cells transformed with an empty plasmid (−) or the plasmid carrying the deleted cas gene(s) (+). The plasmid-carried cas gene(s) was/were under the control of the cas operon promoter. ( B ) Requirements for the nuclease and helicase activities of Cas3. Alanine replacement was performed for the putative key residues in the HD nuclease domain (H20A, H55A, D56A and D229A) and the DExD/H helicase domain (K315A, D439A and E440A). Another two conserved residues (His6 and Lys113) were also mutated. The empty plasmid (−) and the plasmid carrying a wild-type Cas3 (Cas3 WT ) were used, respectively, as negative and positive controls. Lane Ms, dsDNA size markers.

    Article Snippet: The single-stranded DNA (ssDNA) (ФX174ss) and double-stranded DNA (dsDNA) (ФX174ds) from phiX174 phage (purchased from New England Biolabs) were used as controls.

    Techniques: Infection, Mutagenesis, Transformation Assay, Plasmid Preparation, Mass Spectrometry

    Rrp1 is an E3 ubiquitin ligase with Rad51 as a substrate (A) The indicated reaction components were included (+) or omitted (-) for in vitro ubiquitylation assays. After the reaction, the reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, and multiple bands indicative of Rad51 ubiquitylation are shown. (B) In vitro ubiquitylation assay containing all components as in (A) with Rrp1-FLAG or Rrp1-CS-FLAG as the E3 ligase. The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, demonstrating that Rrp1 RING domain is indispensable for Rad51 ubiquitylation. Additionally, reaction products were analysed with anti-FLAG antibodies (lowest panel), revealing auto-ubiquitylation of Rrp1. (C) Ubiquitylation of Rad51 by Rrp1 is less efficient in the presence of DNA. In vitro ubiquitylation assay containing all components as in (A) with Rad51 pre-incubated with 4 µM of ssDNA (PhiX 174 virion) or dsDNA (PhiX 174 RF I linearized with ApaLI). The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies. The intensity ratios of mono-ubiquitylated to non-ubiquitylated Rad51 bands normalised to the sample without DNA are shown.

    Journal: bioRxiv

    Article Title: Rrp1 translocase and ubiquitin ligase activities restrict the genome destabilising effects of Rad51 in fission yeast

    doi: 10.1101/2020.05.30.125286

    Figure Lengend Snippet: Rrp1 is an E3 ubiquitin ligase with Rad51 as a substrate (A) The indicated reaction components were included (+) or omitted (-) for in vitro ubiquitylation assays. After the reaction, the reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, and multiple bands indicative of Rad51 ubiquitylation are shown. (B) In vitro ubiquitylation assay containing all components as in (A) with Rrp1-FLAG or Rrp1-CS-FLAG as the E3 ligase. The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies, demonstrating that Rrp1 RING domain is indispensable for Rad51 ubiquitylation. Additionally, reaction products were analysed with anti-FLAG antibodies (lowest panel), revealing auto-ubiquitylation of Rrp1. (C) Ubiquitylation of Rad51 by Rrp1 is less efficient in the presence of DNA. In vitro ubiquitylation assay containing all components as in (A) with Rad51 pre-incubated with 4 µM of ssDNA (PhiX 174 virion) or dsDNA (PhiX 174 RF I linearized with ApaLI). The reaction mixture was analysed by western blotting with anti-Rad51 antiserum and anti-Ubiquitin antibodies. The intensity ratios of mono-ubiquitylated to non-ubiquitylated Rad51 bands normalised to the sample without DNA are shown.

    Article Snippet: Electrophoretic mobility shift assay (EMSA) Purified Rrp1 was incubated with ssDNA (Phi X174, NEB) or dsDNA (Phi 174 RF I, NEB; linearized with ApaLI) in E buffer (25 mM HEPES pH 7.5, 1 mM DTT, 60 mM KCl, 2 mM ATP, 3.5 mM MgCl2 , 5% glycerol) for 15 min in 37°C.

    Techniques: In Vitro, Western Blot, Ubiquitin Assay, Incubation

    Rrp1 can disassemble Rad51-dsDNA complexes (A) Rrp1 outcompetes Rad51 for binding to dsDNA as demonstrated by electrophoretic mobility shift assay (EMSA). Increasing amounts of Rad51 were pre-incubated with linear double-stranded DNA (ldsDNA, PhiX 174 RF I linearized with ApaLI) before addition of the indicated concentration of Rrp1. Mixtures were resolved on an agarose gel and stained with SYBR-gold. (B) Rad51-dsDNA filaments disassemble following addition of Rrp1, as demonstrated by the reduction in anisotropy of fluorescently-labelled dsDNA. Rad51 (6 µM) was incubated with a dsDNA oligonucleotide (3 µM nucleotide concentration) labelled with the TAMRA fluorophore; the resultant high anisotropy value confirms filament formation. Unlabelled heterologous scavenger DNA was then added, followed by a sub stoichiometric amount of Rrp1 (0.25 µM) or the equivalent volume of protein storage buffer, and fluorescence anisotropy was monitored for the indicated time. The decline in anisotropy observed in the reaction containing Rrp1 indicates that Rad51-dsDNA complexes are disassembled.

    Journal: bioRxiv

    Article Title: Rrp1 translocase and ubiquitin ligase activities restrict the genome destabilising effects of Rad51 in fission yeast

    doi: 10.1101/2020.05.30.125286

    Figure Lengend Snippet: Rrp1 can disassemble Rad51-dsDNA complexes (A) Rrp1 outcompetes Rad51 for binding to dsDNA as demonstrated by electrophoretic mobility shift assay (EMSA). Increasing amounts of Rad51 were pre-incubated with linear double-stranded DNA (ldsDNA, PhiX 174 RF I linearized with ApaLI) before addition of the indicated concentration of Rrp1. Mixtures were resolved on an agarose gel and stained with SYBR-gold. (B) Rad51-dsDNA filaments disassemble following addition of Rrp1, as demonstrated by the reduction in anisotropy of fluorescently-labelled dsDNA. Rad51 (6 µM) was incubated with a dsDNA oligonucleotide (3 µM nucleotide concentration) labelled with the TAMRA fluorophore; the resultant high anisotropy value confirms filament formation. Unlabelled heterologous scavenger DNA was then added, followed by a sub stoichiometric amount of Rrp1 (0.25 µM) or the equivalent volume of protein storage buffer, and fluorescence anisotropy was monitored for the indicated time. The decline in anisotropy observed in the reaction containing Rrp1 indicates that Rad51-dsDNA complexes are disassembled.

    Article Snippet: Electrophoretic mobility shift assay (EMSA) Purified Rrp1 was incubated with ssDNA (Phi X174, NEB) or dsDNA (Phi 174 RF I, NEB; linearized with ApaLI) in E buffer (25 mM HEPES pH 7.5, 1 mM DTT, 60 mM KCl, 2 mM ATP, 3.5 mM MgCl2 , 5% glycerol) for 15 min in 37°C.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Concentration Assay, Agarose Gel Electrophoresis, Staining, Fluorescence

    Sgs1 does not stimulate resection of dsDNA by Exo1. ( A ) Nuclease assays with Exo1 (0.35, 0.53, 0.8, 1.2, and 1.8 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.1 nM, lanes 8–13) in low-salt buffer. Blunt-ended pUC19 dsDNA (1 nM), 32 P labeled at the 3′ end, was used. ( B ) Quantification of experiments as shown in A . Error bars show SE. ( C ) Nuclease assays with Exo1 (0.53, 0.8, 1.2, 1.8, and 2.7 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.5 nM) and Top3-Rmi1 (5 nM, lanes 9–14, respectively), in standard buffer. Substrate is as in A . ( D ) Quantification of experiments as shown in C . Error bars show SE. ( E ) Nuclease assay carried out with Exo1 (0.5, 1, 2, 3, and 4 nM), RPA (0.4 μM), and either without (lanes 2–6) or with helicase-dead Sgs1 K706A (20 nM, lanes 8–12). Substrate is as in A . ( F ) Increasing amounts of nuclease-dead Exo1 D173A (0.53, 0.8, 1.2, 1.8, 2.7, 4, and 8 nM) were added to reactions containing Sgs1 (0.5 nM) and/or Top3-Rmi1 (5 nM), as indicated, in the presence of RPA (0.4 μM). Substrate is as in A .

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Relationship of DNA degradation by Saccharomyces cerevisiae Exonuclease 1 and its stimulation by RPA and Mre11-Rad50-Xrs2 to DNA end resection

    doi: 10.1073/pnas.1305166110

    Figure Lengend Snippet: Sgs1 does not stimulate resection of dsDNA by Exo1. ( A ) Nuclease assays with Exo1 (0.35, 0.53, 0.8, 1.2, and 1.8 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.1 nM, lanes 8–13) in low-salt buffer. Blunt-ended pUC19 dsDNA (1 nM), 32 P labeled at the 3′ end, was used. ( B ) Quantification of experiments as shown in A . Error bars show SE. ( C ) Nuclease assays with Exo1 (0.53, 0.8, 1.2, 1.8, and 2.7 nM), RPA (0.4 μM), and either without (lanes 2–6) or with Sgs1 (0.5 nM) and Top3-Rmi1 (5 nM, lanes 9–14, respectively), in standard buffer. Substrate is as in A . ( D ) Quantification of experiments as shown in C . Error bars show SE. ( E ) Nuclease assay carried out with Exo1 (0.5, 1, 2, 3, and 4 nM), RPA (0.4 μM), and either without (lanes 2–6) or with helicase-dead Sgs1 K706A (20 nM, lanes 8–12). Substrate is as in A . ( F ) Increasing amounts of nuclease-dead Exo1 D173A (0.53, 0.8, 1.2, 1.8, 2.7, 4, and 8 nM) were added to reactions containing Sgs1 (0.5 nM) and/or Top3-Rmi1 (5 nM), as indicated, in the presence of RPA (0.4 μM). Substrate is as in A .

    Article Snippet: The 2.7-kb dsDNA substrate with 4-nt overhangs at the 5′ end was pUC19 dsDNA linearized with HindIII (New England Biolabs).

    Techniques: Recombinase Polymerase Amplification, Labeling, Nuclease Assay

    Modification of 5’ ends of long dsDNA fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo PCR genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Modification of 5’ ends of long dsDNA fragments promotes HDR-mediated single-copy integration. ( A ) GFP expression in the respective expression domain after HDR-mediated integration of modified dsDNA gfp donor cassettes into rx2 , rx1 , actb and dnmt1 ORFs in the injected generation. ( B ) Individual embryo PCR genotyping highlights efficient HDR-mediated single-copy integration of 5’Biotin modified long dsDNA donors, but not unmodified donor cassettes. Locus PCR reveals band size indicative of single-copy gfp integration (asterisk) besides alleles without gfp integration (open arrowhead). Amplification of gfp donor (white arrow) for control.

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Modification, Expressing, Injection, Polymerase Chain Reaction, Amplification

    Single-copy integration of long dsDNA donor establishes stably transmitted gfp-rx2 fusion gene. ( A ) F2 homozygous embryos exhibit GFP-Rx2 fusion protein expression in the pattern of the endogenous gene in the retina. ( B ) Southern Blot analysis of F2 gfp-rx2 embryos reveals a single band for a digestion scheme cutting outside the donor cassette (BglII/HindIII) or within the 5’ donor cassette and in intron 2 (ScaI/HindIII) indicating precise single-copy donor integration. ( B’ ) Schematic representation of the modified locus indicating the restriction sites and the domain complementary to the probe used in ( B ). ( C ) RT-PCR analysis on mRNA isolated from individual homozygous F3 embryos indicates the transcription of a single gfp-rx2 fusion mRNA in comparison to the shorter wild-type rx2 mRNA as schematically represented in ( C’ ).

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Single-copy integration of long dsDNA donor establishes stably transmitted gfp-rx2 fusion gene. ( A ) F2 homozygous embryos exhibit GFP-Rx2 fusion protein expression in the pattern of the endogenous gene in the retina. ( B ) Southern Blot analysis of F2 gfp-rx2 embryos reveals a single band for a digestion scheme cutting outside the donor cassette (BglII/HindIII) or within the 5’ donor cassette and in intron 2 (ScaI/HindIII) indicating precise single-copy donor integration. ( B’ ) Schematic representation of the modified locus indicating the restriction sites and the domain complementary to the probe used in ( B ). ( C ) RT-PCR analysis on mRNA isolated from individual homozygous F3 embryos indicates the transcription of a single gfp-rx2 fusion mRNA in comparison to the shorter wild-type rx2 mRNA as schematically represented in ( C’ ).

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Stable Transfection, Expressing, Southern Blot, Modification, Reverse Transcription Polymerase Chain Reaction, Isolation

    Modification of 5’ ends of long dsDNA fragments prevents in vivo multimerization. ( A ) Schematic representation of long dsDNA donor cassette PCR amplification with universal primers (black arrows) complementary to the cloning vector backbone outside of the assembled donor cassette (e. g. gfp with homology flanks). Bulky moieties like Biotin at the 5’ ends of both modified primers (red octagon) prevent multimerization/NHEJ of dsDNA, providing optimal conditions for HDR-mediated single-copy integration following CRISPR/Cas9-introduced DSB at the target locus (grey scissors). Representation of locus (Lf/Lr) and internal gfp (Gf/Gr) primers for PCR genotyping of putative HDR-mediated gfp integration events. ( B ) Southern blot analysis reveals the monomeric state of injected dsDNA fragments in vivo for 5’ modification with Biotin or Spacer C3. Long dsDNAs generated with control unmodified primers or Amino-dT attached primers multimerize as indicated by a high molecular weight ladder apparent already within two hours post-injection (hpi). Note: 5’ moieties did not enhance the stability of injected DNA.

    Journal: eLife

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors

    doi: 10.7554/eLife.39468

    Figure Lengend Snippet: Modification of 5’ ends of long dsDNA fragments prevents in vivo multimerization. ( A ) Schematic representation of long dsDNA donor cassette PCR amplification with universal primers (black arrows) complementary to the cloning vector backbone outside of the assembled donor cassette (e. g. gfp with homology flanks). Bulky moieties like Biotin at the 5’ ends of both modified primers (red octagon) prevent multimerization/NHEJ of dsDNA, providing optimal conditions for HDR-mediated single-copy integration following CRISPR/Cas9-introduced DSB at the target locus (grey scissors). Representation of locus (Lf/Lr) and internal gfp (Gf/Gr) primers for PCR genotyping of putative HDR-mediated gfp integration events. ( B ) Southern blot analysis reveals the monomeric state of injected dsDNA fragments in vivo for 5’ modification with Biotin or Spacer C3. Long dsDNAs generated with control unmodified primers or Amino-dT attached primers multimerize as indicated by a high molecular weight ladder apparent already within two hours post-injection (hpi). Note: 5’ moieties did not enhance the stability of injected DNA.

    Article Snippet: The dsDNA donor cassettes were amplified by PCR using 1x Q5 reaction buffer, 200 µM dNTPs, 200 µM primer forward and reverse and 0.6 U/µl Q5 polymerase (New England Biolabs).

    Techniques: Modification, In Vivo, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Non-Homologous End Joining, CRISPR, Southern Blot, Injection, Generated, Molecular Weight