bamhi draiii v130del sites  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher bamhi draiii v130del sites
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Bamhi Draiii V130del Sites, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi draiii v130del sites/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi draiii v130del sites - by Bioz Stars, 2024-06
    86/100 stars

    Images

    1) Product Images from "ATP1A3 Disease Spectrum Includes Paroxysmal Weakness and Encephalopathy Not Triggered by Fever"

    Article Title: ATP1A3 Disease Spectrum Includes Paroxysmal Weakness and Encephalopathy Not Triggered by Fever

    Journal: Neurology: Genetics

    doi: 10.1212/NXG.0000000000200150

    (A) Ouabain complementation assay shows a loss-of-function effect of p.V130del. HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Figure Legend Snippet: (A) Ouabain complementation assay shows a loss-of-function effect of p.V130del. HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.

    Techniques Used: Transfection, Expressing, Construct, Variant Assay, Cell Counting, Activity Assay, Generated

    (A) Representative tracings of extracellular Na + transient currents induced by voltage pulses from the holding potential of 0 mV to −160 mV in the absence of extracellular K + . Low-high ouabain subtractions from oocytes expressing untagged ATP1A3-containing Na + /K + -ATPases are shown. The blue line represents the monoexponential decay function obtained by fitting the off-transient current starting 4 ms after the end of the voltage pulse. (B) Charge-voltage plots of off-transient currents. Transient currents induced by the return from each voltage pulse to the holding potential of 0 mV were fit to monoexponential decay curves and integrated to yield the charge moved Q shown on the Y-axis. Owing to the small magnitude of p.V130del transient currents, the same curve is shown at larger scale at the bottom.
    Figure Legend Snippet: (A) Representative tracings of extracellular Na + transient currents induced by voltage pulses from the holding potential of 0 mV to −160 mV in the absence of extracellular K + . Low-high ouabain subtractions from oocytes expressing untagged ATP1A3-containing Na + /K + -ATPases are shown. The blue line represents the monoexponential decay function obtained by fitting the off-transient current starting 4 ms after the end of the voltage pulse. (B) Charge-voltage plots of off-transient currents. Transient currents induced by the return from each voltage pulse to the holding potential of 0 mV were fit to monoexponential decay curves and integrated to yield the charge moved Q shown on the Y-axis. Owing to the small magnitude of p.V130del transient currents, the same curve is shown at larger scale at the bottom.

    Techniques Used: Expressing

    (A) An N-terminal tag does not disrupt ATP1A3 function. N-FLAG-Strep-mCherry-tagged ATP1A3 constructs were expressed in Xenopus oocytes. Na + /K + -ATPase-specific electrogenic ion transport currents in the presence of 5 mM extracellular K + , measured as in , are shown. (B) Representative Western blot of oocytes expressing N-tagged ATP1A3 shows that p.V130del proteins are expressed. A constant amount of total protein was loaded in each lane and visualized by Ponceau stain before blocking (left). The blots were then cut in half (dotted line). The top half was probed using anti-Strep tag primary antibody to detect tagged ATP1A3 (expected size ∼146 kDa including 34 kDa tag), and the bottom half was probed using anti-α-tubulin primary antibody as an additional loading control; the 2 halves are shown together. Lane 1: uninjected negative control; 2: wildtype, 3: p.D801N, 4: p.V130del. (C) Cell surface biotinylation followed by avidin pulldown demonstrates N-tagged p.V130del ATP1A3 at the cell surface. Oocytes expressing the indicated N-tagged construct were treated with a cell surface biotinylation reagent. Avidin chromatography was performed to separate cell surface (bound) and intracellular (unbound) protein fractions for Western blot. More total protein was present in the unbound than the bound fraction, as shown by the Ponceau stain of the blots before blocking at left. The blots were then cut in half and probed against anti-Strep/anti-tubulin; lanes are numbered as in (B). (D) Semiquantitative determination of band intensity from cell surface biotinylation assays, normalized to the total amount of detected ATP1A3 as detailed in the Methods. All 3 ATP1A3 proteins were present at the cell surface.
    Figure Legend Snippet: (A) An N-terminal tag does not disrupt ATP1A3 function. N-FLAG-Strep-mCherry-tagged ATP1A3 constructs were expressed in Xenopus oocytes. Na + /K + -ATPase-specific electrogenic ion transport currents in the presence of 5 mM extracellular K + , measured as in , are shown. (B) Representative Western blot of oocytes expressing N-tagged ATP1A3 shows that p.V130del proteins are expressed. A constant amount of total protein was loaded in each lane and visualized by Ponceau stain before blocking (left). The blots were then cut in half (dotted line). The top half was probed using anti-Strep tag primary antibody to detect tagged ATP1A3 (expected size ∼146 kDa including 34 kDa tag), and the bottom half was probed using anti-α-tubulin primary antibody as an additional loading control; the 2 halves are shown together. Lane 1: uninjected negative control; 2: wildtype, 3: p.D801N, 4: p.V130del. (C) Cell surface biotinylation followed by avidin pulldown demonstrates N-tagged p.V130del ATP1A3 at the cell surface. Oocytes expressing the indicated N-tagged construct were treated with a cell surface biotinylation reagent. Avidin chromatography was performed to separate cell surface (bound) and intracellular (unbound) protein fractions for Western blot. More total protein was present in the unbound than the bound fraction, as shown by the Ponceau stain of the blots before blocking at left. The blots were then cut in half and probed against anti-Strep/anti-tubulin; lanes are numbered as in (B). (D) Semiquantitative determination of band intensity from cell surface biotinylation assays, normalized to the total amount of detected ATP1A3 as detailed in the Methods. All 3 ATP1A3 proteins were present at the cell surface.

    Techniques Used: Construct, Western Blot, Expressing, Staining, Blocking Assay, Strep-tag, Negative Control, Avidin-Biotin Assay, Chromatography

    restriction enzyme draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher restriction enzyme draiii
    Restriction Enzyme Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii
    Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    restriction enzymes draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher restriction enzymes draiii
    Restriction Enzymes Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii
    Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii
    Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii restriction enzyme  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii restriction enzyme
    Draiii Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii restriction enzyme/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii restriction enzyme - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii restriction enzyme  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii restriction enzyme
    Draiii Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii restriction enzyme/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii restriction enzyme - by Bioz Stars, 2024-06
    86/100 stars

    Images

    restriction enzyme adel draiii  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher restriction enzyme adel draiii
    Restriction Enzyme Adel Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme adel draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme adel draiii - by Bioz Stars, 2024-06
    86/100 stars

    Images

    draiii digestion  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher draiii digestion
    Draiii Digestion, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii digestion/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii digestion - by Bioz Stars, 2024-06
    86/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Thermo Fisher bamhi draiii v130del sites
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Bamhi Draiii V130del Sites, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi draiii v130del sites/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi draiii v130del sites - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher restriction enzyme draiii
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Restriction Enzyme Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme draiii - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher draiii
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher restriction enzymes draiii
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Restriction Enzymes Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes draiii - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher draiii restriction enzyme
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Draiii Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii restriction enzyme/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii restriction enzyme - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher restriction enzyme adel draiii
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Restriction Enzyme Adel Draiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme adel draiii/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme adel draiii - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher draiii digestion
    (A) Ouabain complementation assay shows a loss-of-function effect of <t>p.V130del.</t> HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.
    Draiii Digestion, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/draiii digestion/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    draiii digestion - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    (A) Ouabain complementation assay shows a loss-of-function effect of p.V130del. HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.

    Journal: Neurology: Genetics

    Article Title: ATP1A3 Disease Spectrum Includes Paroxysmal Weakness and Encephalopathy Not Triggered by Fever

    doi: 10.1212/NXG.0000000000200150

    Figure Lengend Snippet: (A) Ouabain complementation assay shows a loss-of-function effect of p.V130del. HEK293 cells were transfected with expression constructs carrying partially ouabain-resistant wildtype or variant ATP1A3 as indicated for 2 days before challenge with ouabain. Cell survival in the presence of ouabain is shown normalized to the cell count in the absence of ouabain from the same transfection. p.V130del rescued significantly less cell survival than wildtype. Error bars shown in all figures are means ± 95% confidence intervals. *** p < 0.001. (B) p.V130del causes loss of electrogenic ion transport activity at 0 mV. Steady-state ouabain-sensitive currents generated by ATP1A3-Na + /K + -ATPase in the presence of 5 mM extracellular K + were measured using a two-electrode voltage clamp in Xenopus oocytes. p = 0.0002 for the difference between V130del and wildtype. *** p < 0.001. (C) p.V130del ATP1A3-Na + /K + -ATPase is inactive across the range of tested voltages. Steady-state ouabain-sensitive currents, as in (B), are plotted against voltage. The average of 10 replicates is shown for each construct. (D) Holding currents at 0 mV show that p.V130del ATP1A3-Na + /K + -ATPases are inactive, not ouabain-resistant. The entirety of the representative two-electrode voltage clamp recording is shown for each wildtype or variant ATP1A3 indicated. If the absence of ouabain-sensitive currents with p.V130del ATP1A3-Na + /K + -ATPases in (C) was due to decreased affinity for ouabain, then the enzyme would still generate electrogenic ion transport currents that depend on the presence of extracellular K + . However, holding currents with p.V130del are essentially identical in the presence or absence of K + (compare before and after the black bar, 5 mM K + ), indicating that p.V130del ATP1A3-Na + /K + -ATPases do not generate ion transport currents.

    Article Snippet: They were subcloned into pGEMHE for cRNA synthesis and pcDNA3.1+ (Thermo Fisher) for transfection. p.D801N and p.V130del variants were introduced in pGEMHE by cloning overlap-extension PCR products using the following primer pairs into the MfeI/HindIII (D801N) or BamHI/DraIII (V130del) sites on the same construct: D801N: CATTCCCGTCAGCCAGGTTA (forward/c.1917), CAGTGCCCAGATTGATGCAGAG (reverse, D801N); CTCTGCATCAATCTGGGCACTG (forward/D801N), TATGTAGCTTAGAGACTCCATTCGG (reverse/vector); V130del: GCTCAGAATAAACGCTCAACTTTGG (forward/vector), GTAGGAGAAGCAGCCAGTGATGAtcACGGCCGCCAGCACGATGCCCAGG (reverse/V130del); CCTGGGCATCGTGCTGGCGGCCGTgaTCATCACTGGCTGCTTCTCCTAC (forward, V130del), GAGGCTGGTTTAGTGGTAACC (reverse/vector).

    Techniques: Transfection, Expressing, Construct, Variant Assay, Cell Counting, Activity Assay, Generated

    (A) Representative tracings of extracellular Na + transient currents induced by voltage pulses from the holding potential of 0 mV to −160 mV in the absence of extracellular K + . Low-high ouabain subtractions from oocytes expressing untagged ATP1A3-containing Na + /K + -ATPases are shown. The blue line represents the monoexponential decay function obtained by fitting the off-transient current starting 4 ms after the end of the voltage pulse. (B) Charge-voltage plots of off-transient currents. Transient currents induced by the return from each voltage pulse to the holding potential of 0 mV were fit to monoexponential decay curves and integrated to yield the charge moved Q shown on the Y-axis. Owing to the small magnitude of p.V130del transient currents, the same curve is shown at larger scale at the bottom.

    Journal: Neurology: Genetics

    Article Title: ATP1A3 Disease Spectrum Includes Paroxysmal Weakness and Encephalopathy Not Triggered by Fever

    doi: 10.1212/NXG.0000000000200150

    Figure Lengend Snippet: (A) Representative tracings of extracellular Na + transient currents induced by voltage pulses from the holding potential of 0 mV to −160 mV in the absence of extracellular K + . Low-high ouabain subtractions from oocytes expressing untagged ATP1A3-containing Na + /K + -ATPases are shown. The blue line represents the monoexponential decay function obtained by fitting the off-transient current starting 4 ms after the end of the voltage pulse. (B) Charge-voltage plots of off-transient currents. Transient currents induced by the return from each voltage pulse to the holding potential of 0 mV were fit to monoexponential decay curves and integrated to yield the charge moved Q shown on the Y-axis. Owing to the small magnitude of p.V130del transient currents, the same curve is shown at larger scale at the bottom.

    Article Snippet: They were subcloned into pGEMHE for cRNA synthesis and pcDNA3.1+ (Thermo Fisher) for transfection. p.D801N and p.V130del variants were introduced in pGEMHE by cloning overlap-extension PCR products using the following primer pairs into the MfeI/HindIII (D801N) or BamHI/DraIII (V130del) sites on the same construct: D801N: CATTCCCGTCAGCCAGGTTA (forward/c.1917), CAGTGCCCAGATTGATGCAGAG (reverse, D801N); CTCTGCATCAATCTGGGCACTG (forward/D801N), TATGTAGCTTAGAGACTCCATTCGG (reverse/vector); V130del: GCTCAGAATAAACGCTCAACTTTGG (forward/vector), GTAGGAGAAGCAGCCAGTGATGAtcACGGCCGCCAGCACGATGCCCAGG (reverse/V130del); CCTGGGCATCGTGCTGGCGGCCGTgaTCATCACTGGCTGCTTCTCCTAC (forward, V130del), GAGGCTGGTTTAGTGGTAACC (reverse/vector).

    Techniques: Expressing

    (A) An N-terminal tag does not disrupt ATP1A3 function. N-FLAG-Strep-mCherry-tagged ATP1A3 constructs were expressed in Xenopus oocytes. Na + /K + -ATPase-specific electrogenic ion transport currents in the presence of 5 mM extracellular K + , measured as in , are shown. (B) Representative Western blot of oocytes expressing N-tagged ATP1A3 shows that p.V130del proteins are expressed. A constant amount of total protein was loaded in each lane and visualized by Ponceau stain before blocking (left). The blots were then cut in half (dotted line). The top half was probed using anti-Strep tag primary antibody to detect tagged ATP1A3 (expected size ∼146 kDa including 34 kDa tag), and the bottom half was probed using anti-α-tubulin primary antibody as an additional loading control; the 2 halves are shown together. Lane 1: uninjected negative control; 2: wildtype, 3: p.D801N, 4: p.V130del. (C) Cell surface biotinylation followed by avidin pulldown demonstrates N-tagged p.V130del ATP1A3 at the cell surface. Oocytes expressing the indicated N-tagged construct were treated with a cell surface biotinylation reagent. Avidin chromatography was performed to separate cell surface (bound) and intracellular (unbound) protein fractions for Western blot. More total protein was present in the unbound than the bound fraction, as shown by the Ponceau stain of the blots before blocking at left. The blots were then cut in half and probed against anti-Strep/anti-tubulin; lanes are numbered as in (B). (D) Semiquantitative determination of band intensity from cell surface biotinylation assays, normalized to the total amount of detected ATP1A3 as detailed in the Methods. All 3 ATP1A3 proteins were present at the cell surface.

    Journal: Neurology: Genetics

    Article Title: ATP1A3 Disease Spectrum Includes Paroxysmal Weakness and Encephalopathy Not Triggered by Fever

    doi: 10.1212/NXG.0000000000200150

    Figure Lengend Snippet: (A) An N-terminal tag does not disrupt ATP1A3 function. N-FLAG-Strep-mCherry-tagged ATP1A3 constructs were expressed in Xenopus oocytes. Na + /K + -ATPase-specific electrogenic ion transport currents in the presence of 5 mM extracellular K + , measured as in , are shown. (B) Representative Western blot of oocytes expressing N-tagged ATP1A3 shows that p.V130del proteins are expressed. A constant amount of total protein was loaded in each lane and visualized by Ponceau stain before blocking (left). The blots were then cut in half (dotted line). The top half was probed using anti-Strep tag primary antibody to detect tagged ATP1A3 (expected size ∼146 kDa including 34 kDa tag), and the bottom half was probed using anti-α-tubulin primary antibody as an additional loading control; the 2 halves are shown together. Lane 1: uninjected negative control; 2: wildtype, 3: p.D801N, 4: p.V130del. (C) Cell surface biotinylation followed by avidin pulldown demonstrates N-tagged p.V130del ATP1A3 at the cell surface. Oocytes expressing the indicated N-tagged construct were treated with a cell surface biotinylation reagent. Avidin chromatography was performed to separate cell surface (bound) and intracellular (unbound) protein fractions for Western blot. More total protein was present in the unbound than the bound fraction, as shown by the Ponceau stain of the blots before blocking at left. The blots were then cut in half and probed against anti-Strep/anti-tubulin; lanes are numbered as in (B). (D) Semiquantitative determination of band intensity from cell surface biotinylation assays, normalized to the total amount of detected ATP1A3 as detailed in the Methods. All 3 ATP1A3 proteins were present at the cell surface.

    Article Snippet: They were subcloned into pGEMHE for cRNA synthesis and pcDNA3.1+ (Thermo Fisher) for transfection. p.D801N and p.V130del variants were introduced in pGEMHE by cloning overlap-extension PCR products using the following primer pairs into the MfeI/HindIII (D801N) or BamHI/DraIII (V130del) sites on the same construct: D801N: CATTCCCGTCAGCCAGGTTA (forward/c.1917), CAGTGCCCAGATTGATGCAGAG (reverse, D801N); CTCTGCATCAATCTGGGCACTG (forward/D801N), TATGTAGCTTAGAGACTCCATTCGG (reverse/vector); V130del: GCTCAGAATAAACGCTCAACTTTGG (forward/vector), GTAGGAGAAGCAGCCAGTGATGAtcACGGCCGCCAGCACGATGCCCAGG (reverse/V130del); CCTGGGCATCGTGCTGGCGGCCGTgaTCATCACTGGCTGCTTCTCCTAC (forward, V130del), GAGGCTGGTTTAGTGGTAACC (reverse/vector).

    Techniques: Construct, Western Blot, Expressing, Staining, Blocking Assay, Strep-tag, Negative Control, Avidin-Biotin Assay, Chromatography