Structured Review

New England Biolabs dpni
Dpni, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dpni/product/New England Biolabs
Average 99 stars, based on 230 article reviews
Price from $9.99 to $1999.99
dpni - by Bioz Stars, 2020-01
99/100 stars

Images

Related Articles

Transfection:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Starting one day after transfection, stably transfected cells were selected with 100ng/ml Zeocin ( , Thermo Fisher Scientific) for ~10 days. .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Amplification:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C. .. Methylated DNA was PCR amplified using Advantage®2 PCR enzyme system (639206, Takara Bio Corporation Div Clontech).

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: .. Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs). .. Transform DpnI-treated PCR product: mix 2μl of DpnI-treated DNA with 45μl of XL10-Gold Ultracompetent E. coli (Stratagene) in pre-chilled 15 ml cell culture tube.

Stable Transfection:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Starting one day after transfection, stably transfected cells were selected with 100ng/ml Zeocin ( , Thermo Fisher Scientific) for ~10 days. .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Ligation:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C. .. 2.5 g DpnI-digested DNA was ligated with 2 M DamID adaptor [slowly annealed AdRt (CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA) and AdRb (TCCTCGGCCG)] using 5 units T4 ligase in 20 l 1× T4 ligation buffer at 16°C overnight, followed by heat-inactivation of T4 ligase for 10 minutes at 65°C.

Mutagenesis:

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: Paragraph title: 1. Site-directed mutagenesis of highly GC-rich KISS1R gene sequence ... Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs).

Methylation:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Methylated DNA was PCR-amplified as described ( ). .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: .. Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs). .. Transform DpnI-treated PCR product: mix 2μl of DpnI-treated DNA with 45μl of XL10-Gold Ultracompetent E. coli (Stratagene) in pre-chilled 15 ml cell culture tube.

Cell Culture:

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs). .. Transform DpnI-treated PCR product: mix 2μl of DpnI-treated DNA with 45μl of XL10-Gold Ultracompetent E. coli (Stratagene) in pre-chilled 15 ml cell culture tube.

Purification:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Genomic DNA of stable lines was purified by DNeasy Blood and Tissue Kits (69506, Qiagen), with the RNase A digestion step included. .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Polymerase Chain Reaction:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Methylated DNA was PCR-amplified as described ( ). .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: .. Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs). .. Transform DpnI-treated PCR product: mix 2μl of DpnI-treated DNA with 45μl of XL10-Gold Ultracompetent E. coli (Stratagene) in pre-chilled 15 ml cell culture tube.

Sequencing:

Article Title: SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
Article Snippet: Thus, > 600,000 X-linked sequence polymorphisms between the Xcas and Xmus enabled us to generate allele-specific SMCHD1-binding maps of the Xa and the Xi. .. Briefly, 2.5 g genomic DNA was digested by 10 units DpnI (R0176S, NEB) in 1× CutSmart buffer (B7204S, NEB) overnight at 37°C, followed by heat-inactivation of DpnI for 20 minutes at 80°C.

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: Paragraph title: 1. Site-directed mutagenesis of highly GC-rich KISS1R gene sequence ... Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs).

Plasmid Preparation:

Article Title: Mutagenesis and Analysis of Genetic Mutations in the GC-rich KISS1 Receptor Sequence Identified in Humans with Reproductive Disorders
Article Snippet: In summary: Both (forward and reverse) primers must contain the desired mutation and anneal to the same sequence on opposite strands of the plasmid (e.g. forward and reverse primers are complementary to each other) Primers should be 25 to 45 bases long and end in one or more C or G bases Introduced mutation(s) should be in the middle of primer and flanked by ˜10–15 bases of correct sequence on both sides Melting temperature (Tm) of primers should be equal or greater than 78°C. .. Eliminate parental DNA on amplification products by digestion of methylated DNA with DpnI for 1h 30min at 37°C: mix in a centrifuge tube 17.5μl of PCR product with 2μl of 10x NEBuffer 4 and 0.5μl of DpnI (10U; New England Biolabs).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs r0176
    R0176, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/r0176/product/New England Biolabs
    Average 90 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    r0176 - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    NEBuffer Set EcoRI DpnII 5 0 ml
      Buy from Supplier

    Image Search Results