dpn i  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher dpn i
    Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only <t>Dpn</t> I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).
    Dpn I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dpn i/product/Thermo Fisher
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    dpn i - by Bioz Stars, 2022-10
    99/100 stars

    Images

    1) Product Images from "iDamIDseq and iDEAR: an improved method and computational pipeline to profile chromatin-binding proteins"

    Article Title: iDamIDseq and iDEAR: an improved method and computational pipeline to profile chromatin-binding proteins

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.139261

    Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only Dpn I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).
    Figure Legend Snippet: Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only Dpn I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).

    Techniques Used: Modification, Injection, Isolation, Expressing, Polymerase Chain Reaction, Amplification

    Improving Dam-fusion proteins. (A) DamL122A displays low toxicity in medaka embryos compared with the unmodified protein. Medaka zygotes were injected with mRNA coding for the E. coli Dam (eD-f-G) or DamL122A fused to GFP via flexylinker (D-f-G) (see below). Embryos were scored for abnormalities at embryonic stage 25. (B) Agarose gel of isolated bacterial gDNA samples undigested (−) or digested (+) with DpnI . Dam activity depends on the flexilinker, and the type and orientation of the fused proteins. Bacterial gDNA isolated from a strain deficient in the dam/dcm systems is resistant to Dpn I digestion. This condition can be reversed in transformed bacteria only when the fusion protein generates a functional Dam. Whereas DNA from bacteria transformed with constructs coding for fusions Dam-GFP (D-G) or Dam-TF (D-TF) (OtpA from zebrafish) can be digested by Dpn I, DNA from GFP-Dam (G-D) and TF-Dam (TF-D) bacteria is resistant to Dpn I digestion. In addition, the use of flexylinker between Dam and the fusion protein (D-f-GFP and D-f-TF) generates a Dpn I digestion pattern similar to that of bacteria with a functional dam/dcm system (Top10 cells).
    Figure Legend Snippet: Improving Dam-fusion proteins. (A) DamL122A displays low toxicity in medaka embryos compared with the unmodified protein. Medaka zygotes were injected with mRNA coding for the E. coli Dam (eD-f-G) or DamL122A fused to GFP via flexylinker (D-f-G) (see below). Embryos were scored for abnormalities at embryonic stage 25. (B) Agarose gel of isolated bacterial gDNA samples undigested (−) or digested (+) with DpnI . Dam activity depends on the flexilinker, and the type and orientation of the fused proteins. Bacterial gDNA isolated from a strain deficient in the dam/dcm systems is resistant to Dpn I digestion. This condition can be reversed in transformed bacteria only when the fusion protein generates a functional Dam. Whereas DNA from bacteria transformed with constructs coding for fusions Dam-GFP (D-G) or Dam-TF (D-TF) (OtpA from zebrafish) can be digested by Dpn I, DNA from GFP-Dam (G-D) and TF-Dam (TF-D) bacteria is resistant to Dpn I digestion. In addition, the use of flexylinker between Dam and the fusion protein (D-f-GFP and D-f-TF) generates a Dpn I digestion pattern similar to that of bacteria with a functional dam/dcm system (Top10 cells).

    Techniques Used: Injection, Agarose Gel Electrophoresis, Isolation, Activity Assay, Transformation Assay, Functional Assay, Construct

    2) Product Images from "A cassava protoplast system for screening genes associated with the response to South African cassava mosaic virus"

    Article Title: A cassava protoplast system for screening genes associated with the response to South African cassava mosaic virus

    Journal: Virology Journal

    doi: 10.1186/s12985-020-01453-4

    Assessment of viral DNA accumulation, relative MeE3L expression, and predicted MeE3L primary structure in transformed cassava protoplasts. a Relative DNA accumulation of SACMV- and SACMV + CRISPR-Cas9-transformed cassava protoplasts under different transformation conditions. Δ MeE3L = mutant CRISPR-edited MeE3L . Real-time qPCR was performed in triplicate using Dpn I - treated total DNA extracted from cassava protoplasts 24 hpt as template. b MeE3L relative expression levels in transformed cassava protoplasts. V = SACMV-transformed. Δ MeE3L = gene-edited MeE3L . C* = transformed with CRISPR construct lackingt gRNA duplex. RT-qPCR was performed in triplicate using total mRNA as template. c Stop mutation induced in SACMV-infected susceptible T200 MeE3L . d Stop mutation induced in SACMV-infected tolerant TME3 MeE3L . e The predicted amino acid sequence of tolerant TME3 MeE3L at reference sequence positions 2–148 showing multiple mutations in SACMV-infected variant. V = SACMV-infected. C = gene-edited. Sequence alignment was conducted in MEGA-X [ 40 ]. f Frequency and types of mutation at target gRNA sites from CRISPR-transformed protoplasts. Frequency of clones with altered sequence was obtained by expressing number of amplicons from a polyclonal mix with sequence alteration as a ratio of total amplicons (n = 10 per genotype) sequenced. Mutations were determined by aligning amplicon sequences with wild-type reference AM560-2 [ 14 ] and TME3 (RefSeq ID: RSFT01000007,GenBankassembly GCA_003957995.1 (unpublished data)) MeE3L homologs. Alignment was conducted on MEGA-X [ 40 ] using the CLUSTAL W algorithm for multiple sequence alignment [ 44 ]. g Timeline for rapid screening of genes associated with the response to South African cassava mosaic virus in cassava
    Figure Legend Snippet: Assessment of viral DNA accumulation, relative MeE3L expression, and predicted MeE3L primary structure in transformed cassava protoplasts. a Relative DNA accumulation of SACMV- and SACMV + CRISPR-Cas9-transformed cassava protoplasts under different transformation conditions. Δ MeE3L = mutant CRISPR-edited MeE3L . Real-time qPCR was performed in triplicate using Dpn I - treated total DNA extracted from cassava protoplasts 24 hpt as template. b MeE3L relative expression levels in transformed cassava protoplasts. V = SACMV-transformed. Δ MeE3L = gene-edited MeE3L . C* = transformed with CRISPR construct lackingt gRNA duplex. RT-qPCR was performed in triplicate using total mRNA as template. c Stop mutation induced in SACMV-infected susceptible T200 MeE3L . d Stop mutation induced in SACMV-infected tolerant TME3 MeE3L . e The predicted amino acid sequence of tolerant TME3 MeE3L at reference sequence positions 2–148 showing multiple mutations in SACMV-infected variant. V = SACMV-infected. C = gene-edited. Sequence alignment was conducted in MEGA-X [ 40 ]. f Frequency and types of mutation at target gRNA sites from CRISPR-transformed protoplasts. Frequency of clones with altered sequence was obtained by expressing number of amplicons from a polyclonal mix with sequence alteration as a ratio of total amplicons (n = 10 per genotype) sequenced. Mutations were determined by aligning amplicon sequences with wild-type reference AM560-2 [ 14 ] and TME3 (RefSeq ID: RSFT01000007,GenBankassembly GCA_003957995.1 (unpublished data)) MeE3L homologs. Alignment was conducted on MEGA-X [ 40 ] using the CLUSTAL W algorithm for multiple sequence alignment [ 44 ]. g Timeline for rapid screening of genes associated with the response to South African cassava mosaic virus in cassava

    Techniques Used: Expressing, Transformation Assay, CRISPR, Mutagenesis, Real-time Polymerase Chain Reaction, Construct, Quantitative RT-PCR, Infection, Sequencing, Variant Assay, Clone Assay, Amplification

    3) Product Images from "Immunologic Function and Molecular Insight of Recombinant Interleukin-18"

    Article Title: Immunologic Function and Molecular Insight of Recombinant Interleukin-18

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0160321

    Construction of the expression plasmid pPICZα-IL18WT and its mutants. (A) Strategy and schematic presentation of steps involved in the construction of expression plasmid pPICZa-IL18WT. A mature human IL-18 sequence was inserted into the expression plasmid at the Eco RI and Xba I sites. (B) Diagram showing the site-directed mutagenesis method. The mutant-strand was amplified by PCR and a wild-type DNA template was digested by Dpn I. The resulting annealed double-stranded nicked DNA molecules were transformed into E . coli DH5α and the nicked DNA was repaired.
    Figure Legend Snippet: Construction of the expression plasmid pPICZα-IL18WT and its mutants. (A) Strategy and schematic presentation of steps involved in the construction of expression plasmid pPICZa-IL18WT. A mature human IL-18 sequence was inserted into the expression plasmid at the Eco RI and Xba I sites. (B) Diagram showing the site-directed mutagenesis method. The mutant-strand was amplified by PCR and a wild-type DNA template was digested by Dpn I. The resulting annealed double-stranded nicked DNA molecules were transformed into E . coli DH5α and the nicked DNA was repaired.

    Techniques Used: Expressing, Plasmid Preparation, Sequencing, Mutagenesis, Amplification, Polymerase Chain Reaction, Transformation Assay

    4) Product Images from "Characterization of baculovirus constructs lacking either the Ac 101, Ac 142, or the Ac 144 open reading frame"

    Article Title: Characterization of baculovirus constructs lacking either the Ac 101, Ac 142, or the Ac 144 open reading frame

    Journal: Virology

    doi: 10.1016/j.virol.2007.05.003

    Real-time PCR analysis of viral DNA replication in transfected Sf-9 cells. Shown are the results of three independent DNA replication assays. For these analyses, total DNA was isolated from Sf-9 cells transfected with either the Ac 101 (panel A), 142 (panel B), or the 144 (panel C) knockout bacmid or a bacmid lacking the gp64 envelope fusion protein which served as the non-infectious control. At the designated time-point, total DNA was extracted and digested with the restriction enzyme Dpn I to eliminate input bacmid DNA, and analyzed by real-time PCR. The values displayed represent the averages from transfections performed in triplicate with error bars indicating standard deviations.
    Figure Legend Snippet: Real-time PCR analysis of viral DNA replication in transfected Sf-9 cells. Shown are the results of three independent DNA replication assays. For these analyses, total DNA was isolated from Sf-9 cells transfected with either the Ac 101 (panel A), 142 (panel B), or the 144 (panel C) knockout bacmid or a bacmid lacking the gp64 envelope fusion protein which served as the non-infectious control. At the designated time-point, total DNA was extracted and digested with the restriction enzyme Dpn I to eliminate input bacmid DNA, and analyzed by real-time PCR. The values displayed represent the averages from transfections performed in triplicate with error bars indicating standard deviations.

    Techniques Used: Real-time Polymerase Chain Reaction, Transfection, Isolation, Knock-Out

    5) Product Images from "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery"

    Article Title: Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery

    Journal: Genetic Vaccines and Therapy

    doi: 10.1186/1479-0556-4-1

    Persistence of DNA adenine methylase site methylations (dam) of pcDNA3-HSP65 in muscle at 6 months after immunization . (A) Approximately 1 μg cellular DNA obtained from muscle of immunized mouse were digested with Nde I and Dpn I (lane a), Nde I and Mbo I (lane b), or with Nde I alone (lane c) and amplified by PCR using Hsp65 primers. The samples were submitted to electrophoresis on a 1% agarose gel (B) The positive control was done using E.coli DNA digested with Dpn I, Mbo I or non-digested to show the dam methylation pattern. The mobility of DNA size standards (l DNA cut with Hind III) are shown on the left.
    Figure Legend Snippet: Persistence of DNA adenine methylase site methylations (dam) of pcDNA3-HSP65 in muscle at 6 months after immunization . (A) Approximately 1 μg cellular DNA obtained from muscle of immunized mouse were digested with Nde I and Dpn I (lane a), Nde I and Mbo I (lane b), or with Nde I alone (lane c) and amplified by PCR using Hsp65 primers. The samples were submitted to electrophoresis on a 1% agarose gel (B) The positive control was done using E.coli DNA digested with Dpn I, Mbo I or non-digested to show the dam methylation pattern. The mobility of DNA size standards (l DNA cut with Hind III) are shown on the left.

    Techniques Used: Amplification, Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis, Positive Control, Methylation

    6) Product Images from "Only minimal regions of tomato yellow leaf curl virus (TYLCV) are required for replication, expression and movement"

    Article Title: Only minimal regions of tomato yellow leaf curl virus (TYLCV) are required for replication, expression and movement

    Journal: Archives of Virology

    doi: 10.1007/s00705-014-2066-7

    Evidence that the IR-GUS extracted from protoplasts is not methylated, indicating that it was replicated in the protoplasts and does not represent the input DNA. DNA extracted from protoplasts at various times following IR–GUS transfection was digested with Dpn I, and the entire GUS sequence was PCR-amplified. Failure of Dpn I digestion indicated that the DNA was not methylated. Lane 1, size markers; lane 2, control—DNA extracts from untransfected protoplasts; lane 3, digestion of bacterial-extracted IR–GUS; lanes 4–6, digestion of PCR-amplified DNA extracts from IR–GUS-transfected protoplasts at 16, 24 and 48 h posttransfection, respectively
    Figure Legend Snippet: Evidence that the IR-GUS extracted from protoplasts is not methylated, indicating that it was replicated in the protoplasts and does not represent the input DNA. DNA extracted from protoplasts at various times following IR–GUS transfection was digested with Dpn I, and the entire GUS sequence was PCR-amplified. Failure of Dpn I digestion indicated that the DNA was not methylated. Lane 1, size markers; lane 2, control—DNA extracts from untransfected protoplasts; lane 3, digestion of bacterial-extracted IR–GUS; lanes 4–6, digestion of PCR-amplified DNA extracts from IR–GUS-transfected protoplasts at 16, 24 and 48 h posttransfection, respectively

    Techniques Used: Methylation, Transfection, Sequencing, Polymerase Chain Reaction, Amplification

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher dpn i
    Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only <t>Dpn</t> I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).
    Dpn I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dpn i/product/Thermo Fisher
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    dpn i - by Bioz Stars, 2022-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only Dpn I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).

    Journal: Development (Cambridge, England)

    Article Title: iDamIDseq and iDEAR: an improved method and computational pipeline to profile chromatin-binding proteins

    doi: 10.1242/dev.139261

    Figure Lengend Snippet: Modification of the crucial steps of the DamID protocol. (A) Medaka zygotes were injected with mRNA coding for Dam-f-GFP or Dam-f-TF (Medaka Rx2). Embryos were maintained in ERM supplemented with an antibiotic solution and gDNA was isolated at stage 22. (B) Medaka embryos (stage 22) expressing Dam-f-GFP. (C) DamID LM-PCR at 25 cycles using the modifications presented in the main text generates only Dpn I-dependent amplification (see Materials and Methods, iDamIDseq protocol). (D) Flowchart comparing the standard DamID-seq protocol (based on Wu et al., 2016 ) with the iDamIDseq protocol (improvements are underlined).

    Article Snippet: Adaptor ligation The treated samples (±Dpn I) were added to 2 µl 10× T4 ligase buffer, 1 µl of 50 µM dsOligos AdRt/AdRb, 2.5 units of T4 DNA ligase (Thermo Fisher Scientific, EL0011) and 6.5 µl H2 O, and incubated overnight at 16-18°C.

    Techniques: Modification, Injection, Isolation, Expressing, Polymerase Chain Reaction, Amplification

    Improving Dam-fusion proteins. (A) DamL122A displays low toxicity in medaka embryos compared with the unmodified protein. Medaka zygotes were injected with mRNA coding for the E. coli Dam (eD-f-G) or DamL122A fused to GFP via flexylinker (D-f-G) (see below). Embryos were scored for abnormalities at embryonic stage 25. (B) Agarose gel of isolated bacterial gDNA samples undigested (−) or digested (+) with DpnI . Dam activity depends on the flexilinker, and the type and orientation of the fused proteins. Bacterial gDNA isolated from a strain deficient in the dam/dcm systems is resistant to Dpn I digestion. This condition can be reversed in transformed bacteria only when the fusion protein generates a functional Dam. Whereas DNA from bacteria transformed with constructs coding for fusions Dam-GFP (D-G) or Dam-TF (D-TF) (OtpA from zebrafish) can be digested by Dpn I, DNA from GFP-Dam (G-D) and TF-Dam (TF-D) bacteria is resistant to Dpn I digestion. In addition, the use of flexylinker between Dam and the fusion protein (D-f-GFP and D-f-TF) generates a Dpn I digestion pattern similar to that of bacteria with a functional dam/dcm system (Top10 cells).

    Journal: Development (Cambridge, England)

    Article Title: iDamIDseq and iDEAR: an improved method and computational pipeline to profile chromatin-binding proteins

    doi: 10.1242/dev.139261

    Figure Lengend Snippet: Improving Dam-fusion proteins. (A) DamL122A displays low toxicity in medaka embryos compared with the unmodified protein. Medaka zygotes were injected with mRNA coding for the E. coli Dam (eD-f-G) or DamL122A fused to GFP via flexylinker (D-f-G) (see below). Embryos were scored for abnormalities at embryonic stage 25. (B) Agarose gel of isolated bacterial gDNA samples undigested (−) or digested (+) with DpnI . Dam activity depends on the flexilinker, and the type and orientation of the fused proteins. Bacterial gDNA isolated from a strain deficient in the dam/dcm systems is resistant to Dpn I digestion. This condition can be reversed in transformed bacteria only when the fusion protein generates a functional Dam. Whereas DNA from bacteria transformed with constructs coding for fusions Dam-GFP (D-G) or Dam-TF (D-TF) (OtpA from zebrafish) can be digested by Dpn I, DNA from GFP-Dam (G-D) and TF-Dam (TF-D) bacteria is resistant to Dpn I digestion. In addition, the use of flexylinker between Dam and the fusion protein (D-f-GFP and D-f-TF) generates a Dpn I digestion pattern similar to that of bacteria with a functional dam/dcm system (Top10 cells).

    Article Snippet: Adaptor ligation The treated samples (±Dpn I) were added to 2 µl 10× T4 ligase buffer, 1 µl of 50 µM dsOligos AdRt/AdRb, 2.5 units of T4 DNA ligase (Thermo Fisher Scientific, EL0011) and 6.5 µl H2 O, and incubated overnight at 16-18°C.

    Techniques: Injection, Agarose Gel Electrophoresis, Isolation, Activity Assay, Transformation Assay, Functional Assay, Construct

    Assessment of viral DNA accumulation, relative MeE3L expression, and predicted MeE3L primary structure in transformed cassava protoplasts. a Relative DNA accumulation of SACMV- and SACMV + CRISPR-Cas9-transformed cassava protoplasts under different transformation conditions. Δ MeE3L = mutant CRISPR-edited MeE3L . Real-time qPCR was performed in triplicate using Dpn I - treated total DNA extracted from cassava protoplasts 24 hpt as template. b MeE3L relative expression levels in transformed cassava protoplasts. V = SACMV-transformed. Δ MeE3L = gene-edited MeE3L . C* = transformed with CRISPR construct lackingt gRNA duplex. RT-qPCR was performed in triplicate using total mRNA as template. c Stop mutation induced in SACMV-infected susceptible T200 MeE3L . d Stop mutation induced in SACMV-infected tolerant TME3 MeE3L . e The predicted amino acid sequence of tolerant TME3 MeE3L at reference sequence positions 2–148 showing multiple mutations in SACMV-infected variant. V = SACMV-infected. C = gene-edited. Sequence alignment was conducted in MEGA-X [ 40 ]. f Frequency and types of mutation at target gRNA sites from CRISPR-transformed protoplasts. Frequency of clones with altered sequence was obtained by expressing number of amplicons from a polyclonal mix with sequence alteration as a ratio of total amplicons (n = 10 per genotype) sequenced. Mutations were determined by aligning amplicon sequences with wild-type reference AM560-2 [ 14 ] and TME3 (RefSeq ID: RSFT01000007,GenBankassembly GCA_003957995.1 (unpublished data)) MeE3L homologs. Alignment was conducted on MEGA-X [ 40 ] using the CLUSTAL W algorithm for multiple sequence alignment [ 44 ]. g Timeline for rapid screening of genes associated with the response to South African cassava mosaic virus in cassava

    Journal: Virology Journal

    Article Title: A cassava protoplast system for screening genes associated with the response to South African cassava mosaic virus

    doi: 10.1186/s12985-020-01453-4

    Figure Lengend Snippet: Assessment of viral DNA accumulation, relative MeE3L expression, and predicted MeE3L primary structure in transformed cassava protoplasts. a Relative DNA accumulation of SACMV- and SACMV + CRISPR-Cas9-transformed cassava protoplasts under different transformation conditions. Δ MeE3L = mutant CRISPR-edited MeE3L . Real-time qPCR was performed in triplicate using Dpn I - treated total DNA extracted from cassava protoplasts 24 hpt as template. b MeE3L relative expression levels in transformed cassava protoplasts. V = SACMV-transformed. Δ MeE3L = gene-edited MeE3L . C* = transformed with CRISPR construct lackingt gRNA duplex. RT-qPCR was performed in triplicate using total mRNA as template. c Stop mutation induced in SACMV-infected susceptible T200 MeE3L . d Stop mutation induced in SACMV-infected tolerant TME3 MeE3L . e The predicted amino acid sequence of tolerant TME3 MeE3L at reference sequence positions 2–148 showing multiple mutations in SACMV-infected variant. V = SACMV-infected. C = gene-edited. Sequence alignment was conducted in MEGA-X [ 40 ]. f Frequency and types of mutation at target gRNA sites from CRISPR-transformed protoplasts. Frequency of clones with altered sequence was obtained by expressing number of amplicons from a polyclonal mix with sequence alteration as a ratio of total amplicons (n = 10 per genotype) sequenced. Mutations were determined by aligning amplicon sequences with wild-type reference AM560-2 [ 14 ] and TME3 (RefSeq ID: RSFT01000007,GenBankassembly GCA_003957995.1 (unpublished data)) MeE3L homologs. Alignment was conducted on MEGA-X [ 40 ] using the CLUSTAL W algorithm for multiple sequence alignment [ 44 ]. g Timeline for rapid screening of genes associated with the response to South African cassava mosaic virus in cassava

    Article Snippet: Quantitative PCR (qPCR) for SACMV relative viral load quantitation using Dpn I-digested (ThermoFisher Scientific, Massachusetts, USA) DNA as template was performed in triplicate using forward (5` GGCTAGTTCCCGGATTACAT 3`) and reverse (5` GACAAGGACGGAGACACC 3`) primers, and 18S rRNA as the reference gene.

    Techniques: Expressing, Transformation Assay, CRISPR, Mutagenesis, Real-time Polymerase Chain Reaction, Construct, Quantitative RT-PCR, Infection, Sequencing, Variant Assay, Clone Assay, Amplification

    Construction of the expression plasmid pPICZα-IL18WT and its mutants. (A) Strategy and schematic presentation of steps involved in the construction of expression plasmid pPICZa-IL18WT. A mature human IL-18 sequence was inserted into the expression plasmid at the Eco RI and Xba I sites. (B) Diagram showing the site-directed mutagenesis method. The mutant-strand was amplified by PCR and a wild-type DNA template was digested by Dpn I. The resulting annealed double-stranded nicked DNA molecules were transformed into E . coli DH5α and the nicked DNA was repaired.

    Journal: PLoS ONE

    Article Title: Immunologic Function and Molecular Insight of Recombinant Interleukin-18

    doi: 10.1371/journal.pone.0160321

    Figure Lengend Snippet: Construction of the expression plasmid pPICZα-IL18WT and its mutants. (A) Strategy and schematic presentation of steps involved in the construction of expression plasmid pPICZa-IL18WT. A mature human IL-18 sequence was inserted into the expression plasmid at the Eco RI and Xba I sites. (B) Diagram showing the site-directed mutagenesis method. The mutant-strand was amplified by PCR and a wild-type DNA template was digested by Dpn I. The resulting annealed double-stranded nicked DNA molecules were transformed into E . coli DH5α and the nicked DNA was repaired.

    Article Snippet: To remove the plasmid template, the purified PCR fragments were digested with Dpn I (Thermo Scientific) and transformed into E . coli DH5α.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Mutagenesis, Amplification, Polymerase Chain Reaction, Transformation Assay

    Real-time PCR analysis of viral DNA replication in transfected Sf-9 cells. Shown are the results of three independent DNA replication assays. For these analyses, total DNA was isolated from Sf-9 cells transfected with either the Ac 101 (panel A), 142 (panel B), or the 144 (panel C) knockout bacmid or a bacmid lacking the gp64 envelope fusion protein which served as the non-infectious control. At the designated time-point, total DNA was extracted and digested with the restriction enzyme Dpn I to eliminate input bacmid DNA, and analyzed by real-time PCR. The values displayed represent the averages from transfections performed in triplicate with error bars indicating standard deviations.

    Journal: Virology

    Article Title: Characterization of baculovirus constructs lacking either the Ac 101, Ac 142, or the Ac 144 open reading frame

    doi: 10.1016/j.virol.2007.05.003

    Figure Lengend Snippet: Real-time PCR analysis of viral DNA replication in transfected Sf-9 cells. Shown are the results of three independent DNA replication assays. For these analyses, total DNA was isolated from Sf-9 cells transfected with either the Ac 101 (panel A), 142 (panel B), or the 144 (panel C) knockout bacmid or a bacmid lacking the gp64 envelope fusion protein which served as the non-infectious control. At the designated time-point, total DNA was extracted and digested with the restriction enzyme Dpn I to eliminate input bacmid DNA, and analyzed by real-time PCR. The values displayed represent the averages from transfections performed in triplicate with error bars indicating standard deviations.

    Article Snippet: Prior to PCR, 5 μl of total DNA from each time-point was digested with 2 units of Dpn I restriction enzyme (Fermentas) overnight in 20 μl total reaction volume.

    Techniques: Real-time Polymerase Chain Reaction, Transfection, Isolation, Knock-Out