dntps  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    dNTPs (25 mM each)
    Description:

    Catalog Number:
    R0182
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher dntps
    Effects of cognate versus non-cognate <t>dNTPs</t> on DNA 3′ end-directed cleavage by <t>HIV-1</t> reverse transcriptase. A , schematic of substrates. 5′ end-labeled (indicated by an asterisk ) R−63/−23 ( gray ) was annealed to DNA strands

    https://www.bioz.com/result/dntps/product/Thermo Fisher
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    tgirt - iii
    rnaseout recombinant ribonuclease inhibitor

    Images

    1) Product Images from "Preferred Sequences within a Defined Cleavage Window Specify DNA 3? End-directed Cleavages by Retroviral RNases H"

    Article Title: Preferred Sequences within a Defined Cleavage Window Specify DNA 3? End-directed Cleavages by Retroviral RNases H

    Journal:

    doi: 10.1074/jbc.M109.043158

    Effects of cognate versus non-cognate dNTPs on DNA 3′ end-directed cleavage by HIV-1 reverse transcriptase. A , schematic of substrates. 5′ end-labeled (indicated by an asterisk ) R−63/−23 ( gray ) was annealed to DNA strands
    Figure Legend Snippet: Effects of cognate versus non-cognate dNTPs on DNA 3′ end-directed cleavage by HIV-1 reverse transcriptase. A , schematic of substrates. 5′ end-labeled (indicated by an asterisk ) R−63/−23 ( gray ) was annealed to DNA strands

    Techniques Used: Labeling

    2) Product Images from "Subtype-associated differences in HIV-1 reverse transcription affect the viral replication"

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication

    Journal: Retrovirology

    doi: 10.1186/1742-4690-7-85

    The presence of RT functional domains from HIV-1 subtype C leads to decreased cDNA accumulation . A - Endogenous reverse transcription (ERT) in permeabilized virions. Purified and p24 CA -normalized virus particles of either the backbone NL4-3 or NL-based chimeric viruses were subjected to ERT with addition of dNTPs and permeabilizing agent melittin. Samples without dNTPs were used as a control. DNA was harvested after the indicated time of incubation. The relative amounts of negative-strand strong-stop DNA were measured using quantitative real-time PCR. Data from the control samples were subtracted. Levels of cDNA are shown as percentages of the peak accumulation detected in virions of NL4-3 at 5 h after initiation of incubation. Error bars show the standard deviation from three independent viral preparations. B - Accumulation of early or strong-stop viral DNA in Sup-T1 cells at 24 h p.i. Untreated or treated with 10 μM nevirapine cells were infected with backbone NL4-3 or the chimeric viruses, containing pol fragments from subtype C 1084i isolate using spinoculation. Relative amounts of reverse transcription products were measured using quantitative real-time PCR analysis of DNA from infected cells after incubation with or without 10 μM nevirapine. Data from nevirapine-treated samples were subtracted. Levels of cDNA are shown as percentages of the maximal accumulation detected for cDNA in cells infected with NL4-3 virus strain. Error bars show the standard deviation from three independent viral preparations. C - Accumulation of early and late reverse transcription products in Sup-T1 cells infected with recombinant viruses carrying protease and RT polymerase domain from 1084i, 2669i, and 1984i isolates of subtype C at 24 h p.i. The cells were infected with the indicated viruses as described in B. Harvested DNA was measured using quantitative real-time PCR analysis. Levels of cDNA are shown as percentages of the maximal accumulation detected for negative strand strong-stop cDNA in cells infected with NL4-3. Error bars indicate the standard deviation from three independent viral preparations.
    Figure Legend Snippet: The presence of RT functional domains from HIV-1 subtype C leads to decreased cDNA accumulation . A - Endogenous reverse transcription (ERT) in permeabilized virions. Purified and p24 CA -normalized virus particles of either the backbone NL4-3 or NL-based chimeric viruses were subjected to ERT with addition of dNTPs and permeabilizing agent melittin. Samples without dNTPs were used as a control. DNA was harvested after the indicated time of incubation. The relative amounts of negative-strand strong-stop DNA were measured using quantitative real-time PCR. Data from the control samples were subtracted. Levels of cDNA are shown as percentages of the peak accumulation detected in virions of NL4-3 at 5 h after initiation of incubation. Error bars show the standard deviation from three independent viral preparations. B - Accumulation of early or strong-stop viral DNA in Sup-T1 cells at 24 h p.i. Untreated or treated with 10 μM nevirapine cells were infected with backbone NL4-3 or the chimeric viruses, containing pol fragments from subtype C 1084i isolate using spinoculation. Relative amounts of reverse transcription products were measured using quantitative real-time PCR analysis of DNA from infected cells after incubation with or without 10 μM nevirapine. Data from nevirapine-treated samples were subtracted. Levels of cDNA are shown as percentages of the maximal accumulation detected for cDNA in cells infected with NL4-3 virus strain. Error bars show the standard deviation from three independent viral preparations. C - Accumulation of early and late reverse transcription products in Sup-T1 cells infected with recombinant viruses carrying protease and RT polymerase domain from 1084i, 2669i, and 1984i isolates of subtype C at 24 h p.i. The cells were infected with the indicated viruses as described in B. Harvested DNA was measured using quantitative real-time PCR analysis. Levels of cDNA are shown as percentages of the maximal accumulation detected for negative strand strong-stop cDNA in cells infected with NL4-3. Error bars indicate the standard deviation from three independent viral preparations.

    Techniques Used: Functional Assay, Purification, Incubation, Real-time Polymerase Chain Reaction, Standard Deviation, Infection, Recombinant

    3) Product Images from "Gene Silencing Using 4′-thioDNA as an Artificial Template to Synthesize Short Hairpin RNA Without Inducing a Detectable Innate Immune Response"

    Article Title: Gene Silencing Using 4′-thioDNA as an Artificial Template to Synthesize Short Hairpin RNA Without Inducing a Detectable Innate Immune Response

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1038/mtna.2015.48

    Schematic of gene silencing using an intelligent shRNA expression device (iRed) . Step1: A region of plasmid DNA (pDNA) encoding the U6 promoter and a short hairpin RNA (shRNA) was amplified using PCR in the presence of one type of 2'-deoxy-4'-thionucleoside triphosphate (dSNTP) and three other dNTPs to synthesize an iRed. Step 2: The iRed was delivered into the nucleus. Step 3: Numerous shRNAs were transcribed from the iRed to possess a potent RNA interference (RNAi) activity.
    Figure Legend Snippet: Schematic of gene silencing using an intelligent shRNA expression device (iRed) . Step1: A region of plasmid DNA (pDNA) encoding the U6 promoter and a short hairpin RNA (shRNA) was amplified using PCR in the presence of one type of 2'-deoxy-4'-thionucleoside triphosphate (dSNTP) and three other dNTPs to synthesize an iRed. Step 2: The iRed was delivered into the nucleus. Step 3: Numerous shRNAs were transcribed from the iRed to possess a potent RNA interference (RNAi) activity.

    Techniques Used: shRNA, Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Activity Assay

    Related Articles

    Clone Assay:

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: The necessary template IN pCRII-Blunt-TOPO clones containing full-length IN (50 ng each) were added to a primer extension reaction composed of the appropriate bipartite primers at a final concentration of 0.2µM each, along with 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene), 300 µM dNTPs (Fermentas), and 1X PfuUltra reaction buffer. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Amplification:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min. .. Buffer and DTT from SuperScipt IV Reverse Transcriptase kit (Life Technologies), RNase OUT (Life Technologies) and strand-switching oligo with three O-methyl-guanine RNA bases (PCR_Sw_mod_3G; ordered from Bio Basic, Canada) were added and the sample was incubated at 42 °C for 2 min. 200U SuperScript IV Reverse Transcriptase enzyme was measured into the mix.

    Article Title: Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand. Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand
    Article Snippet: Each 25 μl PCR mixture contained 0.2 mmol/L of each dNTPs (Invitrogen), 1 μmol/L of forward and reverse primers, 1X reaction buffer (Invitrogen) with 1 mmol/L of MgCl2 (Invitrogen), 1.25 U of Taq polymerase (Invitrogen) and 2 μl of DNA. .. Each 25 μl PCR mixture contained 0.2 mmol/L of each dNTPs (Invitrogen), 1 μmol/L of forward and reverse primers, 1X reaction buffer (Invitrogen) with 1 mmol/L of MgCl2 (Invitrogen), 1.25 U of Taq polymerase (Invitrogen) and 2 μl of DNA.

    Article Title: Determinants of selection in yeast evolved by genome shuffling
    Article Snippet: We genotyped 86 backcrossed isolates at 18 of the mutant loci identified in R57 by PCR amplicon sequencing. .. PCRs contained genomic DNA template, 0.5 μM primers, 200 μM dNTPs, 1× high fidelity Phusion buffer (Thermo Fisher), 1.5% DMSO and 1 U of Phusion High Fidelity DNA polymerase (Thermo Fisher) in 50 μl.

    Article Title: Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters
    Article Snippet: The reaction was carried out utilizing the oligonucleotides reported by Guedes et al. [ ] with the following modifications: in a 25-μL final reaction volume, we used 30 ng of genomic DNA, 2.0 mM MgCl2 , 200 μM dNTPs (Applied Biosystems, Inc., Foster City, CA, USA), 1.0 U Taq polymerase (Applied Biosystems), and 50 pmol/μL of each oligonucleotide. .. The amplification program comprised one 3-min cycle at 95°C followed by 35 1-min cycles at 95°C, 1 min at 55°C, 1 min at 72°C, and a final 5-min cycle at 72°C to ensure full extension of all amplified products.

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: These primer extension and PCR amplification reactions were performed in a thermal cycler using the following protocol: 10 min denaturation step at 95°C, followed by 30 cycles of 20 sec at 95°C, 20 sec at 62°C, and 40 sec at 72°C, and a final step of 5 min at 72°C. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Article Title: High Degree of Plasmodium vivax Diversity in the Peruvian Amazon Demonstrated by Tandem Repeat Polymorphism Analysis
    Article Snippet: Briefly, 4 μL of DNA extracted from 200 μL of whole blood was added to 45 μL of PCR mix containing 5 μL of 10×PCR buffer, 1.0 μL of dNTPs (10 mM), and 0.1 μL (5 U/μL) of Taq polymerase (Invitrogen, Carlsbad, CA). .. Briefly, 4 μL of DNA extracted from 200 μL of whole blood was added to 45 μL of PCR mix containing 5 μL of 10×PCR buffer, 1.0 μL of dNTPs (10 mM), and 0.1 μL (5 U/μL) of Taq polymerase (Invitrogen, Carlsbad, CA).

    Article Title: Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma
    Article Snippet: PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen). .. PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen).

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: This reaction mixture was incubated at 42°C for 1 h followed by incubation at 94°C for 5 min. For detection of IL-10, TGF-β, IFN-γ, and TNF-α TaqMan technology was conducted using an iQ5 Multicolor RT-PCR Detection System (Bio-Rad Laboratories, Germany). .. The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Article Title: Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor 3 Inhibits Gamma Interferon and Major Histocompatibility Complex Class II Expression
    Article Snippet: Quantitative real-time PCR (qPCR) was performed in an ABI Prism 7500 Thermocycler (Applied Biosystems, Foster City, CA) using the oligonucleotides given in Table S1 in the supplemental material and SYBR green dye. .. Briefly, 45 cycles of amplification were done with a reaction mixture containing cDNA and 0.2 mM Rox, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 0.1× SYBR green (Invitrogen), 10 pmol of each primer, 0.6-fold Taq PCR buffer, and 0.25 μl AmpliTaq Gold DNA polymerase (Applied Biosystems) in a final volume of 50 μl. .. MHC II transcripts were normalized to β-actin using the Pfaffl method ( ).

    Positive Control:

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. As negative control, DNA was replaced with sterile deionized water.

    Synthesized:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain
    Article Snippet: Human Aβ40 and Aβ42 were synthesized at the W. M. Keck Facility (Yale University), using solid-phase N-t -butyloxycarbonyl chemistry, and purified by HPLC. .. Primers were synthesized by Integrated DNA Technologies (Coralville, IA), and dNTPs were obtained from Invitrogen. .. Purified recombinant full-length wild type ligand binding cluster IV of LRP1 (WT-LRPIV) was used for generating rabbit polyclonal LRPIV antibody (GeneScript, Piscataway, NJ).

    Article Title: Effects of nerve growth factor (NGF) on blood vessels area and expression of the angiogenic factors VEGF and TGFbeta1 in the rat ovary
    Article Snippet: First strand cDNA was synthesized in a 20 ml reaction mixture using 1 μg of total RNA. .. The reaction tubes contained 0.5 μl random hexamers (500 ng/μl, Invitrogen, Foster City CA, USA), 1 μl dNTPs (10 mM, Invitrogen, Foster City CA, USA), 4 μl 5× reaction buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2, Invitrogen, Foster City CA, USA), 2 μl DTT (0.1 M, Invitrogen, Foster City CA, USA), 1 μl ribonuclease inhibitor (10 U/μl, Invitrogen, Foster City CA, USA) and 1 μl M-MLV reverse transcriptase (200 U/μl, Invitrogen, Foster City CA, USA).

    Quantitative RT-PCR:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: Paragraph title: Real-Time RT-PCR Analysis ... The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes.

    SYBR Green Assay:

    Article Title: Effect of Regular Circus Physical Exercises on Lymphocytes in Overweight Children
    Article Snippet: Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL. .. Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL.

    Article Title: Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor 3 Inhibits Gamma Interferon and Major Histocompatibility Complex Class II Expression
    Article Snippet: Quantitative real-time PCR (qPCR) was performed in an ABI Prism 7500 Thermocycler (Applied Biosystems, Foster City, CA) using the oligonucleotides given in Table S1 in the supplemental material and SYBR green dye. .. Briefly, 45 cycles of amplification were done with a reaction mixture containing cDNA and 0.2 mM Rox, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 0.1× SYBR green (Invitrogen), 10 pmol of each primer, 0.6-fold Taq PCR buffer, and 0.25 μl AmpliTaq Gold DNA polymerase (Applied Biosystems) in a final volume of 50 μl. .. MHC II transcripts were normalized to β-actin using the Pfaffl method ( ).

    Article Title: Ammonium Concentrations in Produced Waters from a Mesothermic Oil Field Subjected to Nitrate Injection Decrease through Formation of Denitrifying Biomass and Anammox Activity
    Article Snippet: Primers were purchased from the University of Calgary Core DNA Services. .. Deoxynucleoside triphosphates (dNTPs) and SYBR green I were purchased from Invitrogen. .. Other PCR reagents were obtained from Qiagen.

    Incubation:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: For this, PolyA(+)-selected RNAs were used. .. Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min. .. Buffer and DTT from SuperScipt IV Reverse Transcriptase kit (Life Technologies), RNase OUT (Life Technologies) and strand-switching oligo with three O-methyl-guanine RNA bases (PCR_Sw_mod_3G; ordered from Bio Basic, Canada) were added and the sample was incubated at 42 °C for 2 min. 200U SuperScript IV Reverse Transcriptase enzyme was measured into the mix.

    Article Title: Effect of Regular Circus Physical Exercises on Lymphocytes in Overweight Children
    Article Snippet: Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL. .. Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL.

    Article Title: Estimating accuracy of RNA-Seq and microarrays with proteomics
    Article Snippet: The first strand cDNA synthesis was performed according to the standard protocol. .. Specifically, in reaction mix containing 400 U of Superscript II reverse transcriptase, 75 mM Tris Hcl, pH7.5, 100 mM KCl, 5 mM MgCl2, 0.01 M DTT, and 20 mM dNTPs (Invitrogen) in a total volume of 25 ul; this reaction mix was incubated at 42°C for 60 minutes. .. The resulting first strand cDNA was used to make second strand cDNA in a reaction mix containing 20 mM dNTPs, 15 U of E. coli DNA Polymerase I and 2 U of E. coli RNase H in a total volume of 100 ul; this reaction mix was incubated at 16°C for 2 hours.

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: For chimeric protein whose NTD and CTD domains were from the same virus IN, 10 units of Dpn I was added after the first reaction step and incubated at 37°C for 2 hrs to eliminate the template. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: This reaction mixture was incubated at 42°C for 1 h followed by incubation at 94°C for 5 min. For detection of IL-10, TGF-β, IFN-γ, and TNF-α TaqMan technology was conducted using an iQ5 Multicolor RT-PCR Detection System (Bio-Rad Laboratories, Germany). .. The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes.

    Expressing:

    Article Title: Effect of Regular Circus Physical Exercises on Lymphocytes in Overweight Children
    Article Snippet: Paragraph title: Determination of IL-35, IL-10, TGF-alpha, and IL-2 mRNA expression ... Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL.

    Article Title: Natural antisense transcript of natriuretic peptide precursor A (NPPA): structural organization and modulation of NPPA expression
    Article Snippet: Expression analysis of NPPA and NPPA-AS was carried out using Human Multiple Tissue cDNA panels MTC I and II (BD Biosciences) and primers [see Additional file – Table S2] that were designed using Primer3 program . .. PCR conditions were: 75 mM Tris-HCl (pH 8.8), 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 2.5 mM MgCl2 , 250 μM dNTPs and 2.5 u per 100 μl Taq DNA Polymerase (Fermentas).

    Article Title: The depalmitoylase APT1 directs the asymmetric partitioning of Notch and Wnt signaling during cell division
    Article Snippet: To confirm the expression of FLAG-CDC42 plasmids in shCDC42 MDA-MB-231 cells, we isolated RNA and prepared cDNA from FLAG-prenylated CDC42, FLAG-CDC42-V12, FLAG-CDC42-N17, FLAG-CDC42-F28, FLAG-palmitoylated CDC42 cell lines. .. PCR reaction was performed using 2ug of cDNA, 10X PCR buffer (Sigma; Cat. No. P2192), 10mM dNTPs (Life Technologies; Cat. no. 18252015), Taq polymerase (Sigma; Cat. No D1806) and 10μM of hCDC42-palm and hCDC42-prenyl primers mentioned above, which are designed to span the alternatively spliced exon.

    Real-time Polymerase Chain Reaction:

    Article Title: Effect of Regular Circus Physical Exercises on Lymphocytes in Overweight Children
    Article Snippet: Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL. .. Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL.

    Article Title: Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor 3 Inhibits Gamma Interferon and Major Histocompatibility Complex Class II Expression
    Article Snippet: Paragraph title: Real-time PCR. ... Briefly, 45 cycles of amplification were done with a reaction mixture containing cDNA and 0.2 mM Rox, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 0.1× SYBR green (Invitrogen), 10 pmol of each primer, 0.6-fold Taq PCR buffer, and 0.25 μl AmpliTaq Gold DNA polymerase (Applied Biosystems) in a final volume of 50 μl.

    High Performance Liquid Chromatography:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain
    Article Snippet: Human Aβ40 and Aβ42 were synthesized at the W. M. Keck Facility (Yale University), using solid-phase N-t -butyloxycarbonyl chemistry, and purified by HPLC. .. Primers were synthesized by Integrated DNA Technologies (Coralville, IA), and dNTPs were obtained from Invitrogen.

    Gas Chromatography:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Ligation:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: PRV transcripts were sequenced on MinION device using the 1D Strand switching cDNA by ligation method (Version: SSE_9011_v108_revS_18Oct2016) and the ONT Ligation Sequencing Kit 1D (SQK-LSK108). .. Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min.

    Mutagenesis:

    Article Title: Determinants of selection in yeast evolved by genome shuffling
    Article Snippet: We genotyped 86 backcrossed isolates at 18 of the mutant loci identified in R57 by PCR amplicon sequencing. .. PCRs contained genomic DNA template, 0.5 μM primers, 200 μM dNTPs, 1× high fidelity Phusion buffer (Thermo Fisher), 1.5% DMSO and 1 U of Phusion High Fidelity DNA polymerase (Thermo Fisher) in 50 μl.

    Polymerase Chain Reaction:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min. .. Buffer and DTT from SuperScipt IV Reverse Transcriptase kit (Life Technologies), RNase OUT (Life Technologies) and strand-switching oligo with three O-methyl-guanine RNA bases (PCR_Sw_mod_3G; ordered from Bio Basic, Canada) were added and the sample was incubated at 42 °C for 2 min. 200U SuperScript IV Reverse Transcriptase enzyme was measured into the mix.

    Article Title: Effect of Regular Circus Physical Exercises on Lymphocytes in Overweight Children
    Article Snippet: Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL. .. Afterwards, 10 mM dNTPs and 1 μL of the enzyme Revertaid MMuLV-RT (Fermentas) were added, resulting in a final reactive volume of 20 μL.

    Article Title: Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand. Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand
    Article Snippet: 2.9 PCR primers to hsdMSR (Forward 5′‐TGAATCGGAAACCGATGGAC‐3′; Reverse 5′‐ TGCCACTTGGCTTCATTTCT‐3′), thiHG (Forward 5′‐ RCGCTTGTGTCCAKCTAAAT‐3′; Reverse 5′‐ GCCGGGTATGGAGYTAATTG‐3′), lipAS (Forward 5′‐ TGTGACGAAGCTAATTGTCCT‐3′; Reverse 5′‐ CTTTTTCCCCAAGACCTACCA‐3′) and dapL (Forward 5′‐ ACGCCTTCTGTAGCATCAAA‐3′; Reverse 5′‐ GCCTGGACTTTAGGTACTGC‐3′) gene sequences were used in this study (Weigand et al., ). .. Each 25 μl PCR mixture contained 0.2 mmol/L of each dNTPs (Invitrogen), 1 μmol/L of forward and reverse primers, 1X reaction buffer (Invitrogen) with 1 mmol/L of MgCl2 (Invitrogen), 1.25 U of Taq polymerase (Invitrogen) and 2 μl of DNA. .. All reagents were procured from Life Technologies and nuclease free water was used in all the reactions.

    Article Title: Determinants of selection in yeast evolved by genome shuffling
    Article Snippet: We genotyped 86 backcrossed isolates at 18 of the mutant loci identified in R57 by PCR amplicon sequencing. .. PCRs contained genomic DNA template, 0.5 μM primers, 200 μM dNTPs, 1× high fidelity Phusion buffer (Thermo Fisher), 1.5% DMSO and 1 U of Phusion High Fidelity DNA polymerase (Thermo Fisher) in 50 μl.

    Article Title: Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters
    Article Snippet: Paragraph title: PCR ... The reaction was carried out utilizing the oligonucleotides reported by Guedes et al. [ ] with the following modifications: in a 25-μL final reaction volume, we used 30 ng of genomic DNA, 2.0 mM MgCl2 , 200 μM dNTPs (Applied Biosystems, Inc., Foster City, CA, USA), 1.0 U Taq polymerase (Applied Biosystems), and 50 pmol/μL of each oligonucleotide.

    Article Title: Estimating accuracy of RNA-Seq and microarrays with proteomics
    Article Snippet: Specifically, in reaction mix containing 400 U of Superscript II reverse transcriptase, 75 mM Tris Hcl, pH7.5, 100 mM KCl, 5 mM MgCl2, 0.01 M DTT, and 20 mM dNTPs (Invitrogen) in a total volume of 25 ul; this reaction mix was incubated at 42°C for 60 minutes. .. The resulting first strand cDNA was used to make second strand cDNA in a reaction mix containing 20 mM dNTPs, 15 U of E. coli DNA Polymerase I and 2 U of E. coli RNase H in a total volume of 100 ul; this reaction mix was incubated at 16°C for 2 hours.

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: These primer extension and PCR amplification reactions were performed in a thermal cycler using the following protocol: 10 min denaturation step at 95°C, followed by 30 cycles of 20 sec at 95°C, 20 sec at 62°C, and 40 sec at 72°C, and a final step of 5 min at 72°C. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Article Title: High Degree of Plasmodium vivax Diversity in the Peruvian Amazon Demonstrated by Tandem Repeat Polymorphism Analysis
    Article Snippet: The 9 TR markers were chosen based on a preliminary study of seven patients from different areas of Iquitos, in whom 24 of the TR markers were not found to discriminate between P. vivax strains, but 9 TR markers proved to have at least two alleles each (data not shown). .. Briefly, 4 μL of DNA extracted from 200 μL of whole blood was added to 45 μL of PCR mix containing 5 μL of 10×PCR buffer, 1.0 μL of dNTPs (10 mM), and 0.1 μL (5 U/μL) of Taq polymerase (Invitrogen, Carlsbad, CA). .. A single cycling protocol was used: 947°C for 2 min, 35 cycles of 94°C for 20 sec, 55°C for 10 sec, and 65°C for 2 min, and a final extension time of 5 min at 65°C using a MJR PTC-100 thermal cycler (Bio-Rad, Hercules, CA).

    Article Title: Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma
    Article Snippet: Sequencing was performed using the BigDye terminator sequencing kit, Version 3.1 (Applied Biosystems). .. PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen). .. Cycling conditions consisted of a single denaturation step at 95°C for 3 min, followed by 35 cycles of 95°C for 1 min, 58°C for 1 min, 72°C for 11.5 min and a final extension step at 72°C for 15 min. For the amplification of overlapping subfragments of HAND2 , the primer combinations F1 + R4 and F3 + R3 (table ) were used.

    Article Title: Natural antisense transcript of natriuretic peptide precursor A (NPPA): structural organization and modulation of NPPA expression
    Article Snippet: PCR on mouse tissue-specific cDNAs was performed using oligonucleotides designed according to mouse Nppa gene and EST BQ771223 (for Nppa-as ). .. PCR conditions were: 75 mM Tris-HCl (pH 8.8), 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 2.5 mM MgCl2 , 250 μM dNTPs and 2.5 u per 100 μl Taq DNA Polymerase (Fermentas). .. Cycling conditions followed the touch-down procedure, namely initial denaturation at 94°C for 2 m, followed by 11 cycles at 94°C for 30 s, annealing for 30 s at temperatures decreasing from 62 to 57°C (with 0.5°C decremental in each cycle), 72°C for 60 s, and 30 cycles at 94°C for 30 s, 57°C for 30 s, 72°C for 60 s, and ending with an extension step at 72°C for 5 m. For sequencing, PCR products were extracted from agarose gel using NucleoSpin Extract II (Macherey-Nagel) and either cloned into the pTZ57R vector using InsT/Aclone Kit (Fermentas) or sequenced directly after ExoI/SAP (both Fermentas) treatment.

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: This reaction mixture was incubated at 42°C for 1 h followed by incubation at 94°C for 5 min. For detection of IL-10, TGF-β, IFN-γ, and TNF-α TaqMan technology was conducted using an iQ5 Multicolor RT-PCR Detection System (Bio-Rad Laboratories, Germany). .. The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA − strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides (Table ), which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. The amplification conditions were: 1 cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2% agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: The sequences of primers used in the PCR reactions are as below: (1) β-actin follows: 5′-3′AGAGATGGCCACGGCTGCTT (forward); 5′-3′ATTTGCGGTGGACGATGGAG (reverse). (2) Heat shock protein 27 (HSP27) follows: 5′-3′ ACGAGCATGGCTACATCTCC (forward); 5′-3′ CTTTACTTGGCGGCAGTCTC (reverse). (3) Thioredoxin peroxidase 2 (PRDX2) follows: 5′-3′GTGTCCTTCGCCAGATCACT (forward); 5′-3′ ACGTTGGGCTTAATCGTGTC (reverse). (4) Glucose-regulated protein 78 (GRP78) follows: 5′-3′ TCCTATGTCGCCTTCACT (forward); 5′-3′ ACAGACGGGTCATTCCAC (reverse). (5) Glucose-regulated protein 94 (GRP94) follows: 5′-3′ GGGAGGTCACCTTCAAGTCG (forward); 5′-3′ GGGTGTAGACGTGGAGCTC (reverse). .. For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min. .. The three stages of 30 cycles of PCR were accomplished as follows: denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, elongation at 72 °C for 30 s and extension was completed at 72 °C for 10 min.

    Article Title: Expression of 10 S-Class SLF-like Genes in Nicotiana alata Pollen and Its Implications for Understanding the Pollen Factor of the S Locus
    Article Snippet: PCR was performed with ∼50 ng of genomic DNA or 1 μl of cDNA template. .. Reactions were carried out in a final volume of 20 μl of 1× PCR buffer (Invitrogen, San Diego) containing template DNA, 0.2–0.5 μ m of each primer, 0.2 m m dNTPs, 1.5 m m MgCl2 , and 2 units of Taq polymerase (Invitrogen) on a GeneAmp 2700 thermal cycler (Applied Biosystems, Foster City, CA). .. Rapid amplification of cDNA ends (RACE) PCR was performed using the Smart RACE kit (CLONTECH), as described in the manufacturer's instructions.

    Article Title: Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor 3 Inhibits Gamma Interferon and Major Histocompatibility Complex Class II Expression
    Article Snippet: Quantitative real-time PCR (qPCR) was performed in an ABI Prism 7500 Thermocycler (Applied Biosystems, Foster City, CA) using the oligonucleotides given in Table S1 in the supplemental material and SYBR green dye. .. Briefly, 45 cycles of amplification were done with a reaction mixture containing cDNA and 0.2 mM Rox, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 0.1× SYBR green (Invitrogen), 10 pmol of each primer, 0.6-fold Taq PCR buffer, and 0.25 μl AmpliTaq Gold DNA polymerase (Applied Biosystems) in a final volume of 50 μl. .. MHC II transcripts were normalized to β-actin using the Pfaffl method ( ).

    Article Title: The depalmitoylase APT1 directs the asymmetric partitioning of Notch and Wnt signaling during cell division
    Article Snippet: To confirm the expression of FLAG-CDC42 plasmids in shCDC42 MDA-MB-231 cells, we isolated RNA and prepared cDNA from FLAG-prenylated CDC42, FLAG-CDC42-V12, FLAG-CDC42-N17, FLAG-CDC42-F28, FLAG-palmitoylated CDC42 cell lines. .. PCR reaction was performed using 2ug of cDNA, 10X PCR buffer (Sigma; Cat. No. P2192), 10mM dNTPs (Life Technologies; Cat. no. 18252015), Taq polymerase (Sigma; Cat. No D1806) and 10μM of hCDC42-palm and hCDC42-prenyl primers mentioned above, which are designed to span the alternatively spliced exon. .. The reaction was run out on a 1.4% agarose gel.

    Article Title: Clovamide and rosmarinic acid induce neuroprotective effects in in vitro models of neuronal death
    Article Snippet: RNA extraction and RT-PCR analyses were performed as previously described ( ). .. PCR was performed in a 25 µL reaction mixture containing 2 µg of cDNA, 2.5 µL of ×10 buffer, 1.5 µL of MgCl2 (50 mmol·L−1 ), 0.5 µL of a dNTPs mix (10 mmol·L−1 ) (Invitrogen), 2.5 U of Taq DNA polymerase (Invitrogen) and 2.5 µL of each primer ( ). .. RT-PCR amplicons were resolved in a 2% agarose gel by electrophoresis, and signals were quantified with densitometric analysis software (NIH Image 1.32; National Institutes of Health, Bethesda, MD, USA).

    Sequencing:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: Paragraph title: Oxford Nanopore cDNA sequencing ... Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min.

    Article Title: Determinants of selection in yeast evolved by genome shuffling
    Article Snippet: Both forward and reverse primers consisted of a common 5′ heel sequence (forward: 5′-CGTTCAACCTTGTCCAACAGTG-3′ and reverse: 5′-GAAGCGATGACTCGAGCGTATT-3′) and a 24–28 nucleotide gene-specific sequence at the 3′ end. .. PCRs contained genomic DNA template, 0.5 μM primers, 200 μM dNTPs, 1× high fidelity Phusion buffer (Thermo Fisher), 1.5% DMSO and 1 U of Phusion High Fidelity DNA polymerase (Thermo Fisher) in 50 μl.

    Article Title: Natural antisense transcript of natriuretic peptide precursor A (NPPA): structural organization and modulation of NPPA expression
    Article Snippet: Paragraph title: PCR and sequencing ... PCR conditions were: 75 mM Tris-HCl (pH 8.8), 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 2.5 mM MgCl2 , 250 μM dNTPs and 2.5 u per 100 μl Taq DNA Polymerase (Fermentas).

    Cellular Antioxidant Activity Assay:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Countercurrent Chromatography:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Multiple Displacement Amplification:

    Article Title: The depalmitoylase APT1 directs the asymmetric partitioning of Notch and Wnt signaling during cell division
    Article Snippet: To confirm the expression of FLAG-CDC42 plasmids in shCDC42 MDA-MB-231 cells, we isolated RNA and prepared cDNA from FLAG-prenylated CDC42, FLAG-CDC42-V12, FLAG-CDC42-N17, FLAG-CDC42-F28, FLAG-palmitoylated CDC42 cell lines. .. PCR reaction was performed using 2ug of cDNA, 10X PCR buffer (Sigma; Cat. No. P2192), 10mM dNTPs (Life Technologies; Cat. no. 18252015), Taq polymerase (Sigma; Cat. No D1806) and 10μM of hCDC42-palm and hCDC42-prenyl primers mentioned above, which are designed to span the alternatively spliced exon.

    Isolation:

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: Paragraph title: 4.6. RNA Isolation and RT-PCR ... For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min.

    Article Title: The depalmitoylase APT1 directs the asymmetric partitioning of Notch and Wnt signaling during cell division
    Article Snippet: To confirm the expression of FLAG-CDC42 plasmids in shCDC42 MDA-MB-231 cells, we isolated RNA and prepared cDNA from FLAG-prenylated CDC42, FLAG-CDC42-V12, FLAG-CDC42-N17, FLAG-CDC42-F28, FLAG-palmitoylated CDC42 cell lines. .. PCR reaction was performed using 2ug of cDNA, 10X PCR buffer (Sigma; Cat. No. P2192), 10mM dNTPs (Life Technologies; Cat. no. 18252015), Taq polymerase (Sigma; Cat. No D1806) and 10μM of hCDC42-palm and hCDC42-prenyl primers mentioned above, which are designed to span the alternatively spliced exon.

    Article Title: Clovamide and rosmarinic acid induce neuroprotective effects in in vitro models of neuronal death
    Article Snippet: Paragraph title: mRNA isolation and reverse transcriptase-PCR (RT-PCR) ... PCR was performed in a 25 µL reaction mixture containing 2 µg of cDNA, 2.5 µL of ×10 buffer, 1.5 µL of MgCl2 (50 mmol·L−1 ), 0.5 µL of a dNTPs mix (10 mmol·L−1 ) (Invitrogen), 2.5 U of Taq DNA polymerase (Invitrogen) and 2.5 µL of each primer ( ).

    Size-exclusion Chromatography:

    Article Title: Transcriptome-wide survey of pseudorabies virus using next- and third-generation sequencing platforms
    Article Snippet: Poly(T)-containing anchored primer [(VN)T20 ; ordered from Bio Basic, Canada, ( )] and dNTPs (10 mM, Thermo Scientific) was added to the RNA samples and then the mixture was incubated at 65 °C for 5 min. .. First-strand cDNA synthesis was carried out at 50 °C for 10 min; it was followed by the strand switching step at 42 °C for 10 min. Enzymes were inactivated at 80 °C for 10 min. Five μl from the prepared double-stranded cDNA was amplified in a single PCR reaction using KAPA HiFi DNA Polymerase (Kapa Biosystems) and Ligation Sequencing Kit Primer Mix (provided by the 1D Kit).

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: These primer extension and PCR amplification reactions were performed in a thermal cycler using the following protocol: 10 min denaturation step at 95°C, followed by 30 cycles of 20 sec at 95°C, 20 sec at 62°C, and 40 sec at 72°C, and a final step of 5 min at 72°C. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Purification:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain
    Article Snippet: Human Aβ40 and Aβ42 were synthesized at the W. M. Keck Facility (Yale University), using solid-phase N-t -butyloxycarbonyl chemistry, and purified by HPLC. .. Primers were synthesized by Integrated DNA Technologies (Coralville, IA), and dNTPs were obtained from Invitrogen.

    Article Title: Estimating accuracy of RNA-Seq and microarrays with proteomics
    Article Snippet: DNA-free total RNA was purified with the RNeasy MinElute Kit according to the manufacturer's instructions (Qiagen, Valencia, CA). .. Specifically, in reaction mix containing 400 U of Superscript II reverse transcriptase, 75 mM Tris Hcl, pH7.5, 100 mM KCl, 5 mM MgCl2, 0.01 M DTT, and 20 mM dNTPs (Invitrogen) in a total volume of 25 ul; this reaction mix was incubated at 42°C for 60 minutes.

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma
    Article Snippet: Paragraph title: Reverse transcriptase (RT)-PCR ... PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen).

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: This reaction mixture was incubated at 42°C for 1 h followed by incubation at 94°C for 5 min. For detection of IL-10, TGF-β, IFN-γ, and TNF-α TaqMan technology was conducted using an iQ5 Multicolor RT-PCR Detection System (Bio-Rad Laboratories, Germany). .. The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes.

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: Paragraph title: 4.6. RNA Isolation and RT-PCR ... For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min.

    Article Title: Clovamide and rosmarinic acid induce neuroprotective effects in in vitro models of neuronal death
    Article Snippet: Paragraph title: mRNA isolation and reverse transcriptase-PCR (RT-PCR) ... PCR was performed in a 25 µL reaction mixture containing 2 µg of cDNA, 2.5 µL of ×10 buffer, 1.5 µL of MgCl2 (50 mmol·L−1 ), 0.5 µL of a dNTPs mix (10 mmol·L−1 ) (Invitrogen), 2.5 U of Taq DNA polymerase (Invitrogen) and 2.5 µL of each primer ( ).

    IA:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain
    Article Snippet: Human Aβ40 and Aβ42 were synthesized at the W. M. Keck Facility (Yale University), using solid-phase N-t -butyloxycarbonyl chemistry, and purified by HPLC. .. Primers were synthesized by Integrated DNA Technologies (Coralville, IA), and dNTPs were obtained from Invitrogen. .. Purified recombinant full-length wild type ligand binding cluster IV of LRP1 (WT-LRPIV) was used for generating rabbit polyclonal LRPIV antibody (GeneScript, Piscataway, NJ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    RNA Extraction:

    Article Title: Effects of nerve growth factor (NGF) on blood vessels area and expression of the angiogenic factors VEGF and TGFbeta1 in the rat ovary
    Article Snippet: Paragraph title: RNA extraction and reverse transcription reaction ... The reaction tubes contained 0.5 μl random hexamers (500 ng/μl, Invitrogen, Foster City CA, USA), 1 μl dNTPs (10 mM, Invitrogen, Foster City CA, USA), 4 μl 5× reaction buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2, Invitrogen, Foster City CA, USA), 2 μl DTT (0.1 M, Invitrogen, Foster City CA, USA), 1 μl ribonuclease inhibitor (10 U/μl, Invitrogen, Foster City CA, USA) and 1 μl M-MLV reverse transcriptase (200 U/μl, Invitrogen, Foster City CA, USA).

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: Total RNA was isolated from both cholesteatoma and normal retroauricular skin samples using TRIzol reagent RNA Extraction Kits (Qiagen, Hilden, Germany). .. For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min.

    Article Title: Clovamide and rosmarinic acid induce neuroprotective effects in in vitro models of neuronal death
    Article Snippet: RNA extraction and RT-PCR analyses were performed as previously described ( ). .. PCR was performed in a 25 µL reaction mixture containing 2 µg of cDNA, 2.5 µL of ×10 buffer, 1.5 µL of MgCl2 (50 mmol·L−1 ), 0.5 µL of a dNTPs mix (10 mmol·L−1 ) (Invitrogen), 2.5 U of Taq DNA polymerase (Invitrogen) and 2.5 µL of each primer ( ).

    Plasmid Preparation:

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: The first reaction step used the constituent IN plasmid gene templates and bipartite primers corresponding to the desired NTD, CCD, and CTD domains to be joined. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    Software:

    Article Title: Natural antisense transcript of natriuretic peptide precursor A (NPPA): structural organization and modulation of NPPA expression
    Article Snippet: PCR conditions were: 75 mM Tris-HCl (pH 8.8), 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 2.5 mM MgCl2 , 250 μM dNTPs and 2.5 u per 100 μl Taq DNA Polymerase (Fermentas). .. Sequencing reactions were performed using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to manufacturer's instructions and analyzed on ABI Prism™ 3730xl DNA Analyzer.

    Electron Paramagnetic Resonance:

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA − strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides (Table ), which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL.

    Negative Control:

    Article Title: Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma
    Article Snippet: PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen). .. PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen).

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. The amplification conditions were: 1 cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2% agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Agarose Gel Electrophoresis:

    Article Title: Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters
    Article Snippet: The reaction was carried out utilizing the oligonucleotides reported by Guedes et al. [ ] with the following modifications: in a 25-μL final reaction volume, we used 30 ng of genomic DNA, 2.0 mM MgCl2 , 200 μM dNTPs (Applied Biosystems, Inc., Foster City, CA, USA), 1.0 U Taq polymerase (Applied Biosystems), and 50 pmol/μL of each oligonucleotide. .. The amplification program comprised one 3-min cycle at 95°C followed by 35 1-min cycles at 95°C, 1 min at 55°C, 1 min at 72°C, and a final 5-min cycle at 72°C to ensure full extension of all amplified products.

    Article Title: High Degree of Plasmodium vivax Diversity in the Peruvian Amazon Demonstrated by Tandem Repeat Polymorphism Analysis
    Article Snippet: Tandem repeat polymorphisms in all clinical samples were determined by agarose gel electrophoresis analysis of a single-step PCR reaction using 9 of 33 previously published PCR oligonucleotide primer pairs, according to the published cycling protocol. .. Briefly, 4 μL of DNA extracted from 200 μL of whole blood was added to 45 μL of PCR mix containing 5 μL of 10×PCR buffer, 1.0 μL of dNTPs (10 mM), and 0.1 μL (5 U/μL) of Taq polymerase (Invitrogen, Carlsbad, CA).

    Article Title: Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma
    Article Snippet: PCR was carried out in a total volume of 50 μl containing 1 μl first strand cDNA, 2 U HiFi Platinum-Taq DNA Polymerase (Invitrogen), 125 nM sense and anti-sense primer each, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 200 nM dNTPs each and 1.5 mM MgSO4 (Invitrogen). .. Cycling conditions consisted of a single denaturation step at 95°C for 3 min, followed by 35 cycles of 95°C for 1 min, 58°C for 1 min, 72°C for 11.5 min and a final extension step at 72°C for 15 min. For the amplification of overlapping subfragments of HAND2 , the primer combinations F1 + R4 and F3 + R3 (table ) were used.

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min. .. For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min.

    Electrophoresis:

    Article Title: Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters
    Article Snippet: The reaction was carried out utilizing the oligonucleotides reported by Guedes et al. [ ] with the following modifications: in a 25-μL final reaction volume, we used 30 ng of genomic DNA, 2.0 mM MgCl2 , 200 μM dNTPs (Applied Biosystems, Inc., Foster City, CA, USA), 1.0 U Taq polymerase (Applied Biosystems), and 50 pmol/μL of each oligonucleotide. .. The reaction was carried out utilizing the oligonucleotides reported by Guedes et al. [ ] with the following modifications: in a 25-μL final reaction volume, we used 30 ng of genomic DNA, 2.0 mM MgCl2 , 200 μM dNTPs (Applied Biosystems, Inc., Foster City, CA, USA), 1.0 U Taq polymerase (Applied Biosystems), and 50 pmol/μL of each oligonucleotide.

    Spectrophotometry:

    Article Title: Effects of nerve growth factor (NGF) on blood vessels area and expression of the angiogenic factors VEGF and TGFbeta1 in the rat ovary
    Article Snippet: Concentration and purity of RNA were measured using a spectrophotometer at 260 and 280 nm. .. The reaction tubes contained 0.5 μl random hexamers (500 ng/μl, Invitrogen, Foster City CA, USA), 1 μl dNTPs (10 mM, Invitrogen, Foster City CA, USA), 4 μl 5× reaction buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2, Invitrogen, Foster City CA, USA), 2 μl DTT (0.1 M, Invitrogen, Foster City CA, USA), 1 μl ribonuclease inhibitor (10 U/μl, Invitrogen, Foster City CA, USA) and 1 μl M-MLV reverse transcriptase (200 U/μl, Invitrogen, Foster City CA, USA).

    Article Title: Upregulation of Phosphorylated HSP27, PRDX2, GRP75, GRP78 and GRP94 in Acquired Middle Ear Cholesteatoma Growth
    Article Snippet: The RNA concentrations were measured using a GeneQuant 1300 spectrophotometer (GE Healthcare, Buckinghamshire, UK). .. For PCR, the reaction tubes containing 10× buffer, MgCl2 , dNTPs, Taq DNA polymerase (Invitrogen, Grand Island, NY, USA) and each of the forward and reverse primers were preheated at 95 °C for 3 min.

    Concentration Assay:

    Article Title: Effects of nerve growth factor (NGF) on blood vessels area and expression of the angiogenic factors VEGF and TGFbeta1 in the rat ovary
    Article Snippet: Concentration and purity of RNA were measured using a spectrophotometer at 260 and 280 nm. .. The reaction tubes contained 0.5 μl random hexamers (500 ng/μl, Invitrogen, Foster City CA, USA), 1 μl dNTPs (10 mM, Invitrogen, Foster City CA, USA), 4 μl 5× reaction buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2, Invitrogen, Foster City CA, USA), 2 μl DTT (0.1 M, Invitrogen, Foster City CA, USA), 1 μl ribonuclease inhibitor (10 U/μl, Invitrogen, Foster City CA, USA) and 1 μl M-MLV reverse transcriptase (200 U/μl, Invitrogen, Foster City CA, USA).

    Article Title: Directed DNA Shuffling of Retrovirus and Retrotransposon Integrase Protein Domains
    Article Snippet: The necessary template IN pCRII-Blunt-TOPO clones containing full-length IN (50 ng each) were added to a primer extension reaction composed of the appropriate bipartite primers at a final concentration of 0.2µM each, along with 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene), 300 µM dNTPs (Fermentas), and 1X PfuUltra reaction buffer. .. Next, 0.2µM of 5′ and 3′ end primers, 300 µM dNTPs (Fermentas, Waltham, MA), and an extra 2.5 U of PfuUltra™ II Fusion HS DNA polymerase (Stratagene Corp., La Jolla, CA) were added.

    CTG Assay:

    Article Title: Plasma Cell Alloantigen 1 and IL-10 Secretion Define Two Distinct Peritoneal B1a B Cell Subsets With Opposite Functions, PC1high Cells Being Protective and PC1low Cells Harmful for the Growing Fetus
    Article Snippet: The amplification reactions (12 µl) consisted of 1 µl of cDNA, 6.25 µl of mastermix containing PCR buffer, dNTPs, MgCl2 , and Ampli-Taq DNA polymerase (Thermo Fisher Scientific, Germany), 3 µl of the primer mix, 1.25 µl of water, and 0.5 µl of the fluorescent probes. .. PCR reaction was performed as follows: 2 min at 50°C followed by an initial denaturation step of 10 min at 95°C, followed by 15 s at 95°C, and 1 min at the appropriate annealing temperature for 40 cycles. β-Actin was employed as housekeeping gene, and relative gene expression was calculated by 2−ΔCT .

    Staining:

    Article Title: Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand. Farm level survey of spore‐forming bacteria on four dairy farms in the Waikato region of New Zealand
    Article Snippet: Each 25 μl PCR mixture contained 0.2 mmol/L of each dNTPs (Invitrogen), 1 μmol/L of forward and reverse primers, 1X reaction buffer (Invitrogen) with 1 mmol/L of MgCl2 (Invitrogen), 1.25 U of Taq polymerase (Invitrogen) and 2 μl of DNA. .. Each 25 μl PCR mixture contained 0.2 mmol/L of each dNTPs (Invitrogen), 1 μmol/L of forward and reverse primers, 1X reaction buffer (Invitrogen) with 1 mmol/L of MgCl2 (Invitrogen), 1.25 U of Taq polymerase (Invitrogen) and 2 μl of DNA.

    Hood:

    Article Title: Ammonium Concentrations in Produced Waters from a Mesothermic Oil Field Subjected to Nitrate Injection Decrease through Formation of Denitrifying Biomass and Anammox Activity
    Article Snippet: Deoxynucleoside triphosphates (dNTPs) and SYBR green I were purchased from Invitrogen. .. Other PCR reagents were obtained from Qiagen.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher dntp set 100 mm
    Dntp Set 100 Mm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp set 100 mm/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntp set 100 mm - by Bioz Stars, 2019-12
    90/100 stars
      Buy from Supplier

    92
    Thermo Fisher dntp solution
    ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the <t>Bsm</t> DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M <t>dNTP,</t> FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.
    Dntp Solution, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp solution/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntp solution - by Bioz Stars, 2019-12
    92/100 stars
      Buy from Supplier

    Image Search Results


    ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the Bsm DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M dNTP, FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the Bsm DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M dNTP, FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: Modification, Selection, Concentration Assay

    ( a ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( b ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase; ( c ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( d ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 1.0 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: ( a ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( b ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase; ( c ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( d ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 1.0 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: Selection, Concentration Assay

    Kinetics of Bsm DNA polymerase reaction (after subtraction of the background) monitored by spectrofluorimeter in different buffers and probes. Conditions: buffer, 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase, 0.1 pmol/μL DP/B1.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: Kinetics of Bsm DNA polymerase reaction (after subtraction of the background) monitored by spectrofluorimeter in different buffers and probes. Conditions: buffer, 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase, 0.1 pmol/μL DP/B1.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: