dntps  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    TaKaRa Ex Taq DNA Polymerase
    Description:
    TaKaRa Ex Taq DNA Polymerase combines the proven performance of Takara Taq polymerase with the proofreading activity of an efficient 3 to 5 exonuclease for high sensitivity high efficiency PCR reactions It can also be used for long range PCR up to 20 kb from genomic DNA templates and up to 30 kb from lambda DNA templates Ex Taq polymerase has a higher fidelity than standard Taq with a mutation rate approximately 4 5 times lower as determined by the Kunkel method Ex Taq polymerase is supplied with optimized 10X buffer with or without Mg2 and dNTPs
    Catalog Number:
    rr001c
    Price:
    None
    Size:
    3 000 Units
    Category:
    Ex Taq polymerase Ex Taq products High yield PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa dntps
    TaKaRa Ex Taq DNA Polymerase combines the proven performance of Takara Taq polymerase with the proofreading activity of an efficient 3 to 5 exonuclease for high sensitivity high efficiency PCR reactions It can also be used for long range PCR up to 20 kb from genomic DNA templates and up to 30 kb from lambda DNA templates Ex Taq polymerase has a higher fidelity than standard Taq with a mutation rate approximately 4 5 times lower as determined by the Kunkel method Ex Taq polymerase is supplied with optimized 10X buffer with or without Mg2 and dNTPs
    https://www.bioz.com/result/dntps/product/TaKaRa
    Average 90 stars, based on 1488 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: Paragraph title: DNA isolation, cloning and sequencing ... High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation.

    Amplification:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: .. PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The amplification program consisted of one cycle of 94 °C for 3 min; 40 cycles of 94 °C for 45 s, 55 °C for 1 min, and 72 °C for 1.5 min; and finally one cycle of 72 °C for 10 min. Amplicons were separated by gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen, CA, USA).

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′. .. PCR products were subcloned into pCMV-Myc vector (Clontech, USA) with Eco RI and Not I.

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: .. PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan). .. The V3-V4 region of the 16S rRNA gene was amplified using eubacterial primers (341F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVGGGTWTCTAAT).

    Article Title: Expression of mouse Dab2ip transcript variants and gene methylation during brain development
    Article Snippet: .. One-tenth volume of the first-strand reaction was used as a template for PCR amplification using the TaKaRa EX-Taq polymerase (Clontech Laboratories) and the primers listed in . .. Thermal cycling program started with an initial denaturation at 95 °C for 5 min, followed by 35 cycles (94 °C, 1 min; 61 °C, 1 min; 72 °C, 50 s) of amplification, followed by a 5 min extension at 72 °C.

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: PCR amplification was performed in a 25-μl standard reaction mix containing 1× Ex-Taq buffer (as specified by the supplier [Boehringer, Mannheim, Germany]), 300 ng of plasmid DNA, 100 pmol of each primer per μl, and 2.5 mM deoxynucleoside triphosphates. .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer).

    Article Title: Mammalian-Specific Central Myelin Protein Opalin Is Redundant for Normal Myelination: Structural and Behavioral Assessments
    Article Snippet: .. Genomic DNA solution (2 μl) was added to 18 μl PCR buffer containing forward and reverse primer sets (0.25 μM each), EX Taq polymerase (0.5 U/μl, Cat. RR001A, TAKARA, Kyoto, Japan), and dNTP mix (0.2 mM each) in EX Taq reaction buffer recommended by the manufacturer, and was amplified using a thermal cycler (GeneAMP PCR System 9700, Applied Biosystems, Foster City, CA, USA) with a sequential reaction: initial denature step at 94°C for 2 min, 33 cycles of the amplification step consisting of denature at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 5 min. .. The forward (Fwd) and reverse (Rev) sequences of the primer sets P1 (to detect exon 6, WT allele), P2 (to detect neo plus, knockout allele), and P3 (to detect neo minus, Flpe-loxP) ( ) were as follows: P1, Fwd: 5′-CAGCTGCCTCTCACTCAACA-3′ and Rev: 5′-CCAAAGGCAGACTTCTCTCG-3′ (product size = 203bp); P2, Fwd: 5′-ATGACTGGGCACAACAGACA-3′ and Rev: 5′-ATACTTTCTCGGCAGGAGCA-3′ (product size = 276bp); P3, Fwd: 5′-GGTGAGTGGGTTTTCTTGGA-3′ and Rev: 5′-CCAGGCTATGGAATGATGCT-3′ (product size = 441 bp).

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: .. Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C. .. Amplified samples were used in NGS analysis using a GS Junior sequencer (Roche, Basel, Switzerland) following the manufacturer’s instruction with nebulizing processes.

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: Pgk1 gene sequences were amplified by using a pair of Pgk1 -specific primers, PGKF1 ( 5’-TCGTCCTAAGGGTGTTACTCCTAA-3’ ) and PGKR1 ( 5’-ACCACCAGTTGAGATGTGGCTCAT-3’ ) described by Huang et al. [ ]. .. High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation.

    Synthesized:

    Article Title: Expression of mouse Dab2ip transcript variants and gene methylation during brain development
    Article Snippet: Total RNA was extracted from mouse cerebellum at different ages (P8, P14, P21 and P30) using TRIzol reagent (Invitrogen). cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with 1 μg of total RNA and oligo-dT primer. .. One-tenth volume of the first-strand reaction was used as a template for PCR amplification using the TaKaRa EX-Taq polymerase (Clontech Laboratories) and the primers listed in .

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: .. Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C. .. Amplified samples were used in NGS analysis using a GS Junior sequencer (Roche, Basel, Switzerland) following the manufacturer’s instruction with nebulizing processes.

    Construct:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. For Illumina sequencing, DNA library was constructed using NEBNext Ultra DNA Library Prep Kit for Illumina (New England BioLabs, MA, USA), with some modifications of the manufacturer’s instructions.

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: Myc-tagged Hnf6 constructs were generated by PCR amplification. .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′.

    Random Hexamer Labeling:

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: To amplify cDNA libraries, random hexamer oligonucleotides with Tag sequences for PCR (5′-CGCTCTTCCGATCTNNNNNN-3′) were used as primers for first-strand cDNA synthesis according to previous studies . .. Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C.

    Luciferase:

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′. .. To generate the mNgn3 distal promoter reporter, Ngn3D-Luc, mNgn3(2.5), mNgn3(1.5), and mNgn3(0.6)-Luc, PCR amplification was performed with Ngn3 promoter specific primers and PCR products were subcloned into pTAL-luc (Clontech) or pGL4.10 luciferase reporter vector (Promega, USA) with Kpn I and Bgl II restriction sites or Kpn I and Hin dIII restriction sites.

    Activity Assay:

    Article Title: Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice, et al. Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice
    Article Snippet: Presumptive H. pylori isolates were counted and then checked for urease activity using urease indicator broth (0.33 mol/L urea, 0.2% Phenol Red, 0.02% NaN3 , 0.01 mol/L pH 6.5 NaPO4 buffer). .. Extracted DNA was tested for the presence of the H. pylori VacA gene by PCR using the Takara PCR kit (Fisher, TAK RR001A) and primers VagA‐F (5‐CAATCTGTCCAATCAAGCGAG) and VagA‐R (5‐GCGTCAAAATAATTCCAAGG).

    Expressing:

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: Flag-tagged deletion expression constructs of Glis3 were generated by PCR amplification using Glis3 specific primer sets, deltaN-Forward; 5′-TCAGGGTCCCCCACCCCCATACCA-3′, and deltaC-Forward; 5′-CTCCTCCCAGTTACCTCCACTCAC AGC-3′ with Glis3-Reverse; 5′-GCCTTCGGTATACACAGAGG AGAG-3′, and Glis3-Forward; 5′-ATGGTTCAGCGACTGGGA CCCATT-3′ with N-reverse; 5′-GCAGTGCTTCCCCCCTGA GTCTTCCT-3′ and were subcloned into p3×Flag-CMV vector (Sigma, USA). .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′.

    Western Blot:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: The collections of Arabidopsis thaliana mutants screened by PCR for disruption of the PHYC ), consisting of a population of Columbia (Col-0) lines transformed with pROK2 plasmid ( ); the BASTA collection of T-DNA insertional mutants from the Arabidopsis Knockout Facility at the University of Wisconsin , consisting of a population of Wassilewskija (Ws) lines transformed with pSK1015 plasmid ( ); and the Maxygen collection of fast-neutron deletion mutants in the Col-0 ecotype ( ). phyC-1 was detected by DNA gel blot analysis of PCR-amplified products in DNA superpool 17 of the BASTA collection using primers phyC-R (EMO2, 5′-GAAGACTTTCAAAAACACCACACTTATTC-3′) and JL202 (EMO115, 5′-CATTTTATAATAACGCTGCGGACATCTAC-3′). .. PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: The GCR1 mutant was detected by DNA gel blot analysis of PCR-amplified products in DNA super-pool 40 of the BASTA population using combinations of GCR1-specific primers KK66 [located upstream of the ATG start codon of GCR1 ORF] (5′-AAATCGTCAATTCAATCTCTCAGATCAGT-3′) or KK68 [locates downstream of the TGA stop codon of GCR1 ORF] (5′-GCGCCGGTTTAAGTGATAGTATTTTCATA-3′) with the left T-DNA border specific primer JL202 (5′-CATTTTATAATAACGCTGCGGACATCTAC-3′). .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Transformation Assay:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: The collections of Arabidopsis thaliana mutants screened by PCR for disruption of the PHYC ), consisting of a population of Columbia (Col-0) lines transformed with pROK2 plasmid ( ); the BASTA collection of T-DNA insertional mutants from the Arabidopsis Knockout Facility at the University of Wisconsin , consisting of a population of Wassilewskija (Ws) lines transformed with pSK1015 plasmid ( ); and the Maxygen collection of fast-neutron deletion mutants in the Col-0 ecotype ( ). phyC-1 was detected by DNA gel blot analysis of PCR-amplified products in DNA superpool 17 of the BASTA collection using primers phyC-R (EMO2, 5′-GAAGACTTTCAAAAACACCACACTTATTC-3′) and JL202 (EMO115, 5′-CATTTTATAATAACGCTGCGGACATCTAC-3′). .. PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer). .. About 0.5 to 1 μg of the PCR product was used for yeast transformation into diploid wild-type strain FY1679, and transformants were selected on plates containing Geneticin (G418; 200 μg/ml; Calbiochem).

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Isolation of GCR1 mutant A T-DNA tagged mutant population from the Arabidopsis Knockout Facility at the University of Wisconsin [ ] was screened by PCR for disruption of GCR1 gene: The population consisted of 72,960 BASTA (glufosinate)-resistant lines of Arabidopsis thaliana ecotype Ws2 transformed with an activation-Tag vector pSK1015 [ ]. .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Concentration Assay:

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: Pyrosequencing The normalized concentration of purified genomic DNA was used as a template to analyzed microbial communities. .. PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan).

    Infection:

    Article Title: Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice, et al. Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice
    Article Snippet: Paragraph title: Mouse euthanasia, verification and quantification of infection ... Extracted DNA was tested for the presence of the H. pylori VacA gene by PCR using the Takara PCR kit (Fisher, TAK RR001A) and primers VagA‐F (5‐CAATCTGTCCAATCAAGCGAG) and VagA‐R (5‐GCGTCAAAATAATTCCAAGG).

    Generated:

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: Myc-tagged Hnf6 constructs were generated by PCR amplification. .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′.

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: Using the two primers pYDL015cGA5→ and pYDL015cMX6← (Table ) a 2,550-bp fragment was generated by PCR. .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer).

    other:

    Article Title: Variation in shade-induced flowering in Arabidopsis thaliana results from FLOWERING LOCUS T allelic variation
    Article Snippet: Genotypes were determined by SSLP or CAPS markers using TaKaRa ExTaq RR001A.

    Polymerase Chain Reaction:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: .. PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The amplification program consisted of one cycle of 94 °C for 3 min; 40 cycles of 94 °C for 45 s, 55 °C for 1 min, and 72 °C for 1.5 min; and finally one cycle of 72 °C for 10 min. Amplicons were separated by gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen, CA, USA).

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: .. PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase. .. PCR conditions were 96°C for 5 min and 36 cycles of 94°C for 15 s, 65°C for 30 s, and 72°C for 4 min. phyC-2 was detected by DNA gel blot analysis of PCR-amplified products in the 40K set of DNAs of the Ecker/Alonso collection using primers phyC-F (EMO51, 5′-CGGTCTAGCACTGCAAAACAGATCAAGTGG-3′) and JMLB1 (EMO49, 5′-GGCAATCAGCTGTTGCCCGTCTCACTGGTG-3′).

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′. .. PCR products were subcloned into pCMV-Myc vector (Clontech, USA) with Eco RI and Not I.

    Article Title: Emergence and evolution of inter-specific segregating retrocopies in cynomolgus monkey (Macaca fascicularis) and rhesus macaque (Macaca mulatta)
    Article Snippet: .. Regular PCR was performed using TAKARA Ex-Taq polymerase and LA-Taq polymerase in 25 ul reaction volume with template DNA (10 ng/ul). .. We further carried out G-50 purification on Resin-purified PCR products and Sanger sequencing following the recommended protocol to confirm the presence of retroposition ultimately.

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: .. PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan). .. The V3-V4 region of the 16S rRNA gene was amplified using eubacterial primers (341F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVGGGTWTCTAAT).

    Article Title: Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice, et al. Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice
    Article Snippet: .. Extracted DNA was tested for the presence of the H. pylori VacA gene by PCR using the Takara PCR kit (Fisher, TAK RR001A) and primers VagA‐F (5‐CAATCTGTCCAATCAAGCGAG) and VagA‐R (5‐GCGTCAAAATAATTCCAAGG). ..

    Article Title: Expression of mouse Dab2ip transcript variants and gene methylation during brain development
    Article Snippet: .. One-tenth volume of the first-strand reaction was used as a template for PCR amplification using the TaKaRa EX-Taq polymerase (Clontech Laboratories) and the primers listed in . .. Thermal cycling program started with an initial denaturation at 95 °C for 5 min, followed by 35 cycles (94 °C, 1 min; 61 °C, 1 min; 72 °C, 50 s) of amplification, followed by a 5 min extension at 72 °C.

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer). .. The fragment was amplified during eight cycles of 30 s at 94°C, 30 s at 54°C, and 150 s at 72°C, 25 cycles of 30 s at 94°C and 180 s at 72°C, and a final elongation step of 12 min at 72°C.

    Article Title: Mammalian-Specific Central Myelin Protein Opalin Is Redundant for Normal Myelination: Structural and Behavioral Assessments
    Article Snippet: .. Genomic DNA solution (2 μl) was added to 18 μl PCR buffer containing forward and reverse primer sets (0.25 μM each), EX Taq polymerase (0.5 U/μl, Cat. RR001A, TAKARA, Kyoto, Japan), and dNTP mix (0.2 mM each) in EX Taq reaction buffer recommended by the manufacturer, and was amplified using a thermal cycler (GeneAMP PCR System 9700, Applied Biosystems, Foster City, CA, USA) with a sequential reaction: initial denature step at 94°C for 2 min, 33 cycles of the amplification step consisting of denature at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 5 min. .. The forward (Fwd) and reverse (Rev) sequences of the primer sets P1 (to detect exon 6, WT allele), P2 (to detect neo plus, knockout allele), and P3 (to detect neo minus, Flpe-loxP) ( ) were as follows: P1, Fwd: 5′-CAGCTGCCTCTCACTCAACA-3′ and Rev: 5′-CCAAAGGCAGACTTCTCTCG-3′ (product size = 203bp); P2, Fwd: 5′-ATGACTGGGCACAACAGACA-3′ and Rev: 5′-ATACTTTCTCGGCAGGAGCA-3′ (product size = 276bp); P3, Fwd: 5′-GGTGAGTGGGTTTTCTTGGA-3′ and Rev: 5′-CCAGGCTATGGAATGATGCT-3′ (product size = 441 bp).

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: .. Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C. .. Amplified samples were used in NGS analysis using a GS Junior sequencer (Roche, Basel, Switzerland) following the manufacturer’s instruction with nebulizing processes.

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: .. High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. After estimating the size by 1.0% agarose gel, PCR products were purified using the QIAquick gel extraction kit (QIAGEN Inc., USA).

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase. ..

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: .. PCR reagents were 1× Takara Ex-Taq polymerase buffer, 0.2 mM dNTPs, 0.3 μM forward (F) primer, 0.3 μM reverse (R) primer, and 0.025 unit/μL Takara Ex-Taq polymerase. ..

    DNA Extraction:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: Paragraph title: DNA extraction and sequencing ... PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: Paragraph title: DNA isolation, cloning and sequencing ... High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation.

    Nucleic Acid Electrophoresis:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The amplification program consisted of one cycle of 94 °C for 3 min; 40 cycles of 94 °C for 45 s, 55 °C for 1 min, and 72 °C for 1.5 min; and finally one cycle of 72 °C for 10 min. Amplicons were separated by gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen, CA, USA).

    Mutagenesis:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: Paragraph title: Isolation of phyC Mutant Alleles ... PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′. .. Ngn3D-Luc mutation constructs containing TGG AA GGGA instead of TGGGGGGGA, were generated using site-directed mutagenesis according to the manufacturer’s instructions (Stratagene, USA).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: .. High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. After estimating the size by 1.0% agarose gel, PCR products were purified using the QIAquick gel extraction kit (QIAGEN Inc., USA).

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Paragraph title: Isolation of GCR1 mutant ... The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Isolation:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: Paragraph title: Isolation of phyC Mutant Alleles ... PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: Genomic DNA was isolated from fresh leaves of single plants following a standard CTAB protocol [ ]. .. High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation.

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Paragraph title: Isolation of GCR1 mutant ... The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Purification:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The amplification program consisted of one cycle of 94 °C for 3 min; 40 cycles of 94 °C for 45 s, 55 °C for 1 min, and 72 °C for 1.5 min; and finally one cycle of 72 °C for 10 min. Amplicons were separated by gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen, CA, USA).

    Article Title: Emergence and evolution of inter-specific segregating retrocopies in cynomolgus monkey (Macaca fascicularis) and rhesus macaque (Macaca mulatta)
    Article Snippet: Regular PCR was performed using TAKARA Ex-Taq polymerase and LA-Taq polymerase in 25 ul reaction volume with template DNA (10 ng/ul). .. We further carried out G-50 purification on Resin-purified PCR products and Sanger sequencing following the recommended protocol to confirm the presence of retroposition ultimately.

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: Pyrosequencing The normalized concentration of purified genomic DNA was used as a template to analyzed microbial communities. .. PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan).

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer). .. The resulting PCR fragment was purified by using a QIAquick PCR purification kit (Qiagen).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. After estimating the size by 1.0% agarose gel, PCR products were purified using the QIAquick gel extraction kit (QIAGEN Inc., USA).

    Sequencing:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: Paragraph title: DNA extraction and sequencing ... PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′).

    Article Title: Emergence and evolution of inter-specific segregating retrocopies in cynomolgus monkey (Macaca fascicularis) and rhesus macaque (Macaca mulatta)
    Article Snippet: Regular PCR was performed using TAKARA Ex-Taq polymerase and LA-Taq polymerase in 25 ul reaction volume with template DNA (10 ng/ul). .. We further carried out G-50 purification on Resin-purified PCR products and Sanger sequencing following the recommended protocol to confirm the presence of retroposition ultimately.

    Article Title: Expression of mouse Dab2ip transcript variants and gene methylation during brain development
    Article Snippet: Based on the sequence information acquired from UCSC genome browser (mouse genome assembly mm9, July 2007), PCR primers were designed against specific 5′ exons of mDab2ip ( ). .. One-tenth volume of the first-strand reaction was used as a template for PCR amplification using the TaKaRa EX-Taq polymerase (Clontech Laboratories) and the primers listed in .

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: The downstream primer contained 26 nucleotides homologous to the kanMX6 sequence and 47 nucleotides homologous to the chromosomal sequence downstream of the YDL015c reading frame. .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer).

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C. .. The NGS data were deposited in the DDBJ Sequence Read Archive (DRA) under accession code DRA001134.

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: Paragraph title: DNA isolation, cloning and sequencing ... High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation.

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase. .. Sequencing of KK66-JL202 and KK68-JL202 PCR products revealed multiple T-DNA integration.

    Mouse Assay:

    Article Title: Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice, et al. Reduced infectivity of waterborne viable but nonculturable Helicobacter pylori strain SS1 in mice
    Article Snippet: 2.6 Mouse euthanasia, verification and quantification of infection After exposure, the mice were euthanized and their stomachs were collected. .. Extracted DNA was tested for the presence of the H. pylori VacA gene by PCR using the Takara PCR kit (Fisher, TAK RR001A) and primers VagA‐F (5‐CAATCTGTCCAATCAAGCGAG) and VagA‐R (5‐GCGTCAAAATAATTCCAAGG).

    Article Title: Mammalian-Specific Central Myelin Protein Opalin Is Redundant for Normal Myelination: Structural and Behavioral Assessments
    Article Snippet: Mouse genotyping Tail biopsy samples were obtained from mice at P10–14 and were digested in 100 μl proteinase K solution (0.5 mg/ml proteinase K, 0.1 mg/ml gelatin, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2 , 0.45% NP40, and 0.45% Tween20) overnight at 55°C. .. Genomic DNA solution (2 μl) was added to 18 μl PCR buffer containing forward and reverse primer sets (0.25 μM each), EX Taq polymerase (0.5 U/μl, Cat. RR001A, TAKARA, Kyoto, Japan), and dNTP mix (0.2 mM each) in EX Taq reaction buffer recommended by the manufacturer, and was amplified using a thermal cycler (GeneAMP PCR System 9700, Applied Biosystems, Foster City, CA, USA) with a sequential reaction: initial denature step at 94°C for 2 min, 33 cycles of the amplification step consisting of denature at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 5 min.

    Plasmid Preparation:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: The collections of Arabidopsis thaliana mutants screened by PCR for disruption of the PHYC ), consisting of a population of Columbia (Col-0) lines transformed with pROK2 plasmid ( ); the BASTA collection of T-DNA insertional mutants from the Arabidopsis Knockout Facility at the University of Wisconsin , consisting of a population of Wassilewskija (Ws) lines transformed with pSK1015 plasmid ( ); and the Maxygen collection of fast-neutron deletion mutants in the Col-0 ecotype ( ). phyC-1 was detected by DNA gel blot analysis of PCR-amplified products in DNA superpool 17 of the BASTA collection using primers phyC-R (EMO2, 5′-GAAGACTTTCAAAAACACCACACTTATTC-3′) and JL202 (EMO115, 5′-CATTTTATAATAACGCTGCGGACATCTAC-3′). .. PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Glis3 Regulates Neurogenin 3 Expression in Pancreatic ?-Cells and Interacts with Its Activator, Hnf6
    Article Snippet: Flag-tagged deletion expression constructs of Glis3 were generated by PCR amplification using Glis3 specific primer sets, deltaN-Forward; 5′-TCAGGGTCCCCCACCCCCATACCA-3′, and deltaC-Forward; 5′-CTCCTCCCAGTTACCTCCACTCAC AGC-3′ with Glis3-Reverse; 5′-GCCTTCGGTATACACAGAGG AGAG-3′, and Glis3-Forward; 5′-ATGGTTCAGCGACTGGGA CCCATT-3′ with N-reverse; 5′-GCAGTGCTTCCCCCCTGA GTCTTCCT-3′ and were subcloned into p3×Flag-CMV vector (Sigma, USA). .. PCR products were amplified using by Takara Ex-Taq polymerase (TakaraBio, USA) with Hnf6 specific primers: Hnf6-Forward, 5′-ATGAACGCGCAGCTGACCATGG AA-3′, Hnf6-reverse 1, 5′-CTGCCCTGAATTACTTCCATTGC-3′, Hnf6-reverse 2, 5′-CGGCTCCTGCAGCCACTTCCACAT-3′, and Hnf6-reverse 3, 5′-CCACTTGTCCAGACTCCTCCTTC-3′.

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: PCR amplification was performed in a 25-μl standard reaction mix containing 1× Ex-Taq buffer (as specified by the supplier [Boehringer, Mannheim, Germany]), 300 ng of plasmid DNA, 100 pmol of each primer per μl, and 2.5 mM deoxynucleoside triphosphates. .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. The purified products were cloned into the pMD19-T vector (Takara) following the manufacturer's instructions.

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Isolation of GCR1 mutant A T-DNA tagged mutant population from the Arabidopsis Knockout Facility at the University of Wisconsin [ ] was screened by PCR for disruption of GCR1 gene: The population consisted of 72,960 BASTA (glufosinate)-resistant lines of Arabidopsis thaliana ecotype Ws2 transformed with an activation-Tag vector pSK1015 [ ]. .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Software:

    Article Title: Emergence and evolution of inter-specific segregating retrocopies in cynomolgus monkey (Macaca fascicularis) and rhesus macaque (Macaca mulatta)
    Article Snippet: Then primers spanning exon-exon junctions were designed using Primer5 software ( http://www.premierbiosoft.com/primerdesign/index.html ) to confirm the presence and inserted position of retroposition ( ). .. Regular PCR was performed using TAKARA Ex-Taq polymerase and LA-Taq polymerase in 25 ul reaction volume with template DNA (10 ng/ul).

    Selection:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The size selection of adaptor-ligated DNA and cleanup of PCR amplification steps were replaced with PCR purification using a QIAquick PCR Purification Kit (Qiagen, CA, USA).

    Agarose Gel Electrophoresis:

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan). .. PCR reactions were performed by initial denaturation at 94 °C for 3 min and then 28 cycles of 94 °C for 30 s, 53 °C for 40 s and 72 °C for 1 min, followed by a final elongation step at 72 °C for 5 min. Amplicon libraries were separated by agarose gel electrophoresis and purified using a QIA quick Gel Extraction Kit (Qiagen, Valencia, CA, USA).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. After estimating the size by 1.0% agarose gel, PCR products were purified using the QIAquick gel extraction kit (QIAGEN Inc., USA).

    Next-Generation Sequencing:

    Article Title: A nairovirus isolated from African bats causes haemorrhagic gastroenteritis and severe hepatic disease in mice
    Article Snippet: Paragraph title: Sample collection and NGS analysis ... Synthesized double-stranded cDNA samples were amplified using PCR with a Takara Ex-Taq polymerase (Takara Bio), the primer (5′-CGCTCTTCCGATCT-3′) and a reaction protocol of 2 min at 95 °C, 30 cycles of 15 s at 95 °C, 15 s at 40 °C, 30 s at 72 °C and then 5 min at 72 °C.

    Knock-Out:

    Article Title: Isolation and Characterization of phyC Mutants in Arabidopsis Reveals Complex Crosstalk between Phytochrome Signaling Pathways
    Article Snippet: The collections of Arabidopsis thaliana mutants screened by PCR for disruption of the PHYC ), consisting of a population of Columbia (Col-0) lines transformed with pROK2 plasmid ( ); the BASTA collection of T-DNA insertional mutants from the Arabidopsis Knockout Facility at the University of Wisconsin , consisting of a population of Wassilewskija (Ws) lines transformed with pSK1015 plasmid ( ); and the Maxygen collection of fast-neutron deletion mutants in the Col-0 ecotype ( ). phyC-1 was detected by DNA gel blot analysis of PCR-amplified products in DNA superpool 17 of the BASTA collection using primers phyC-R (EMO2, 5′-GAAGACTTTCAAAAACACCACACTTATTC-3′) and JL202 (EMO115, 5′-CATTTTATAATAACGCTGCGGACATCTAC-3′). .. PCR reagents were 1× Takara Ex-Taq polymerase buffer (Takara Mirus Bio, Madison, WI), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μL phyC-R primer, 0.24 pmol/μL JL202 primer, and 0.05 unit/μL Takara Ex-Taq polymerase.

    Article Title: Mammalian-Specific Central Myelin Protein Opalin Is Redundant for Normal Myelination: Structural and Behavioral Assessments
    Article Snippet: Genomic DNA solution (2 μl) was added to 18 μl PCR buffer containing forward and reverse primer sets (0.25 μM each), EX Taq polymerase (0.5 U/μl, Cat. RR001A, TAKARA, Kyoto, Japan), and dNTP mix (0.2 mM each) in EX Taq reaction buffer recommended by the manufacturer, and was amplified using a thermal cycler (GeneAMP PCR System 9700, Applied Biosystems, Foster City, CA, USA) with a sequential reaction: initial denature step at 94°C for 2 min, 33 cycles of the amplification step consisting of denature at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 5 min. .. The forward (Fwd) and reverse (Rev) sequences of the primer sets P1 (to detect exon 6, WT allele), P2 (to detect neo plus, knockout allele), and P3 (to detect neo minus, Flpe-loxP) ( ) were as follows: P1, Fwd: 5′-CAGCTGCCTCTCACTCAACA-3′ and Rev: 5′-CCAAAGGCAGACTTCTCTCG-3′ (product size = 203bp); P2, Fwd: 5′-ATGACTGGGCACAACAGACA-3′ and Rev: 5′-ATACTTTCTCGGCAGGAGCA-3′ (product size = 276bp); P3, Fwd: 5′-GGTGAGTGGGTTTTCTTGGA-3′ and Rev: 5′-CCAGGCTATGGAATGATGCT-3′ (product size = 441 bp).

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Isolation of GCR1 mutant A T-DNA tagged mutant population from the Arabidopsis Knockout Facility at the University of Wisconsin [ ] was screened by PCR for disruption of GCR1 gene: The population consisted of 72,960 BASTA (glufosinate)-resistant lines of Arabidopsis thaliana ecotype Ws2 transformed with an activation-Tag vector pSK1015 [ ]. .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Activation Assay:

    Article Title: Transcriptome Analysis of Arabidopsis GCR1 Mutant Reveals Its Roles in Stress, Hormones, Secondary Metabolism and Phosphate Starvation
    Article Snippet: Isolation of GCR1 mutant A T-DNA tagged mutant population from the Arabidopsis Knockout Facility at the University of Wisconsin [ ] was screened by PCR for disruption of GCR1 gene: The population consisted of 72,960 BASTA (glufosinate)-resistant lines of Arabidopsis thaliana ecotype Ws2 transformed with an activation-Tag vector pSK1015 [ ]. .. The PCR reaction contained 1X Takara Ex-Taq polymerase buffer (Takara), 0.2 mM deoxynucleotide triphosphates (dNTPs), 0.24 pmol/μl gene-specific primer, 0.24 pmol/μl JL202 primer, and 0.05 unit/μl Takara Ex-Taq polymerase.

    Marker:

    Article Title: Tsc13p Is Required for Fatty Acid Elongation and Localizes to a Novel Structure at the Nuclear-Vacuolar Interface in Saccharomyces cerevisiae
    Article Snippet: Plasmid pMK199-GA5-yEGFP-kanMX6 containing a five-copy glycine-alanine (GA5) linker fused to yeast enhanced green fluorescent protein (yEGFP) and the kanMX6 resistance marker, was used as the template for PCRs to amplify the integration cassette ( ). .. After the initial denaturation step at 94°C for 5 min, the PCR was started by the addition of 2 U of Takara Ex-Taq polymerase (Boehringer).

    Gel Extraction:

    Article Title: Relationship between the microbiota in different sections of the gastrointestinal tract, and the body weight of broiler chickens
    Article Snippet: PCR amplification was performed using the Takara Ex-taq polymerase (Takara Bio, Shiga, Japan) and universal primers (forward: 5′-GGACTACHVGGGTWTCTAAT-3′, reverse: 5′-GTGCCAGCMGCCGCGGTAA-3′). .. The amplification program consisted of one cycle of 94 °C for 3 min; 40 cycles of 94 °C for 45 s, 55 °C for 1 min, and 72 °C for 1.5 min; and finally one cycle of 72 °C for 10 min. Amplicons were separated by gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen, CA, USA).

    Article Title: Supplementation of amylase combined with glucoamylase or protease changes intestinal microbiota diversity and benefits for broilers fed a diet of newly harvested corn
    Article Snippet: PCR amplification was performed using Takara Ex-Taq polymerase (Takara Bio, Shiga, Japan). .. PCR reactions were performed by initial denaturation at 94 °C for 3 min and then 28 cycles of 94 °C for 30 s, 53 °C for 40 s and 72 °C for 1 min, followed by a final elongation step at 72 °C for 5 min. Amplicon libraries were separated by agarose gel electrophoresis and purified using a QIA quick Gel Extraction Kit (Qiagen, Valencia, CA, USA).

    Article Title: Phylogenetic relationships in the genus Avena based on the nuclear Pgk1 gene
    Article Snippet: High fidelity Taq DNA polymerase ( Ex - Taq , Takara, Japan, Cat# RR001A) was used to reduce the potential PCR-based mutation. .. After estimating the size by 1.0% agarose gel, PCR products were purified using the QIAquick gel extraction kit (QIAGEN Inc., USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa dntp mixture
    Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mixture/product/TaKaRa
    Average 90 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    dntp mixture - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    TaKaRa takara dntp mixture
    Takara Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/takara dntp mixture/product/TaKaRa
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    takara dntp mixture - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Our dNTPs for PCR are 98 pure and are tested for quality control in a variety of applications Individual dNTPs are supplied at a concentration of 100 mM and can
      Buy from Supplier

    Image Search Results