Structured Review

TaKaRa dntps
Transcription- and translation-coupled DNA <t>(TTcDR)</t> replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including <t>dNTPs,</t> yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.
Dntps, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntps/product/TaKaRa
Average 75 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dntps - by Bioz Stars, 2020-01
75/100 stars

Related Products / Commonly Used Together

tgirt - iii
rnaseout recombinant ribonuclease inhibitor

Images

1) Product Images from "A transcription and translation-coupled DNA replication system using rolling-circle replication"

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication

Journal: Scientific Reports

doi: 10.1038/srep10404

Transcription- and translation-coupled DNA (TTcDR) replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including dNTPs, yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.
Figure Legend Snippet: Transcription- and translation-coupled DNA (TTcDR) replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including dNTPs, yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.

Techniques Used: Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Electrophoresis, Autoradiography, Marker, Purification

Translation of phi29 DNA polymerase from newly synthesized DNA in the TTcDR reaction. A ) Experimental procedure. First, we performed the optimized TTcDR reaction without [ 35 S]-methionine in the presence or absence of dNTPs, and one-tenth of the mixture was transferred to the second reaction mixture, which contained [ 35 S]-methionine, to detect translation from the replicated DNA product in the first reaction. After incubation at 30 °C for 12 h, an aliquot was used for 10% SDS-PAGE and autoradiography. B ) Translation results. Increased translation of the DNA polymerase was detected when the first reaction contained dNTPs, indicating that the translation occurred from the DNA produced in the first reaction.
Figure Legend Snippet: Translation of phi29 DNA polymerase from newly synthesized DNA in the TTcDR reaction. A ) Experimental procedure. First, we performed the optimized TTcDR reaction without [ 35 S]-methionine in the presence or absence of dNTPs, and one-tenth of the mixture was transferred to the second reaction mixture, which contained [ 35 S]-methionine, to detect translation from the replicated DNA product in the first reaction. After incubation at 30 °C for 12 h, an aliquot was used for 10% SDS-PAGE and autoradiography. B ) Translation results. Increased translation of the DNA polymerase was detected when the first reaction contained dNTPs, indicating that the translation occurred from the DNA produced in the first reaction.

Techniques Used: Synthesized, Incubation, SDS Page, Autoradiography, Produced

2) Product Images from "Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions"

Article Title: Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq914

Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using the natural and oxidized dNTPs (each dNTP at 10 µM) in the natural template. Lane 1 refers to the appropriate size markers. ( C ) Extension reactions in the presence of dGTP, dTTP, dATP and dC o TP (each dNTP at 10 µM) were shown in lanes 2 and 3 by KF (exo − ) and lanes 6 and 7 by Vent (exo − ). Extension reactions in the presence of dGTP, dTTP, dCTP and dA o TP (each dNTP at 10 µM) were shown in lanes 4 and 5 by KF (exo − ) and lanes 8 anmd 9 by Vent (exo − ). Lane 1 refer to the appropriate marker.
Figure Legend Snippet: Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using the natural and oxidized dNTPs (each dNTP at 10 µM) in the natural template. Lane 1 refers to the appropriate size markers. ( C ) Extension reactions in the presence of dGTP, dTTP, dATP and dC o TP (each dNTP at 10 µM) were shown in lanes 2 and 3 by KF (exo − ) and lanes 6 and 7 by Vent (exo − ). Extension reactions in the presence of dGTP, dTTP, dCTP and dA o TP (each dNTP at 10 µM) were shown in lanes 4 and 5 by KF (exo − ) and lanes 8 anmd 9 by Vent (exo − ). Lane 1 refer to the appropriate marker.

Techniques Used: Labeling, Polyacrylamide Gel Electrophoresis, Marker

Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using mixed dNTPs (each dNTP at 10 µM) in the oxidized templates. Lanes 1 refers to the appropriate marker. ( C ) PAGE analysis of extension reactions in the presence of dGTP, dTTP, dATP and dCTP (each dNTP at 10 µM). Lane 1 refer to the appropriate marker. Extension reactions by KF (exo − ) are shown in lanes 2–5, and its reactions by Vent (exo − ) are shown in lanes 6–9.
Figure Legend Snippet: Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using mixed dNTPs (each dNTP at 10 µM) in the oxidized templates. Lanes 1 refers to the appropriate marker. ( C ) PAGE analysis of extension reactions in the presence of dGTP, dTTP, dATP and dCTP (each dNTP at 10 µM). Lane 1 refer to the appropriate marker. Extension reactions by KF (exo − ) are shown in lanes 2–5, and its reactions by Vent (exo − ) are shown in lanes 6–9.

Techniques Used: Labeling, Polyacrylamide Gel Electrophoresis, Marker

Related Articles

Amplification:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The purified sscDNA library was analyzed on an RNA 6000 Pico chip on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) to confirm a size distribution between 450 to 750 nucleotides, and quantified with Quant-iT Ribogreen RNA Assay Kit (Invitrogen Corporation, Carlsbad, CA) on a Synergy HT (Bio-Tek Instruments Inc, Winooski, VT) instrument following the manufacturer’s instructions. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA). .. The amplification reaction was performed at: 96°C for 4 min; 94°C for 30 sec, 64°C for 30 sec, repeating steps 2 and 3 for a total of 20 cycles, followed by 68°C for 3 minutes.

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: PCR amplification of the V5-V4 regions of the bacterial 16S rRNA gene was performed using universal primers (515F 5′-GTGCCAGCMGCCGCGGTAA-3′and 907R 5′-CCGTCAATTCMTTTRAGT-3′) incorporating a unique sample barcode sequences. .. For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction. .. The PCR condition is as follows: 5 min initial denaturation at 95 °C; 28 cycles of denaturation at 95 °C (30 s), annealing at 55 °C (30 s), elongation at 72 °C (45 s), and final extension at 72 °C for 7 min.

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: Paragraph title: 2.10 PCR amplification of gene of interest using complementation primers ... 10 μM Comp forward primer (CF) 10 μM comp reverse primer (CR) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Genomic DNA: Reference strain ( see )

Article Title: Positive selection on schizophrenia-associated ST8SIA2 gene in post-glacial Asia
Article Snippet: To identify ST8SIA2 promoter types of all 63 individuals, approximately 4 kb sequences surrounding the three promoter SNPs were amplified by genomic PCR using ExTaq DNA Polymerase (TaKaRa, Otsu, Japan) with a pair of PCR primers (STXF1H and STXR1H; see ). .. PCR reactions were performed with 50 pmol of each primer and 1 μl of genomic DNA solution in a total volume of 50 μl containing 200 μM dNTPs and 1 μl PrimeSTAR GXL DNA Polymerase (TaKaRa).

Article Title: Investigation of Five Common Mutations on Phenylalanine Hydroxylase Gene of Phenylketonuria Patients from Two Provinces in North of Iran
Article Snippet: Polymerase chain reaction (PCR) - restriction fragment length polymorphism method was used to detect five mutations including c.1066-11G > A, p. R261Q, p. R252W, p. R261X, and c.1200 + 1G > C.[ ] The regions on PAH gene containing sites of mutations were amplified using PCR with specific primers derived from a published article. .. [ ] The PCR mixture included 200 ng of DNA, 12.5 μ of a 2X PCR master mix containing Taq enzyme, buffer and dNTPs (Takara, Japan), and 10 pmol of reverse and forward primers in total of 25 μ.

Article Title: A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8
Article Snippet: The genotype was validated by sequencing exon 2 of the Hspb8 mouse gene after amplification by PCR using the following primers: Hspb8_exon2_Fw GGAAGTTAGGGAGCAGGTGTCC and Hspb8_exon2_Rv GGAAGTTAGGGAGCAGGTGTCC. .. The PCR contained standard 10× PCR buffer, 50 mM MgCl2 (for the KO and Cre PCR) or 1 M betain (for Exon2 and LoxP PCR), 10 mM dNTPs, 0.10 µM of each primer, and 1 unit of Platinum Taq Polymerase (Clontech Laboratories, Mountain View, CA, USA) for the KO and Cre PCR.

Article Title: Immortalization of Porcine 11β-Hydroxysteroid Dehydrogenase Type 1-Transgenic Liver Cells Using SV40 Large T Antigen
Article Snippet: Genomic DNA was isolated with a G-DEX™ IIc Genomic DNA Extraction kit (iNtRON, Gyeonggi-do, South Korea). .. 100 ng of genomic DNA was amplified in a 20 μL PCR reaction containing 1 U i-Start Taq polymerase (iNtRON), 2 mM dNTPs (Takara) and 10 pmol of each specific primer listed in . .. Amplicons were separated on 1% or 1.5% agarose gel, stained with ethidium bromide, photographed under UV illumination, and scanned using GelDoc EQ (Bio-Rad, Hercules, CA, USA).

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: The cells were harvested from the culture dish using a cell scraper, and the cell-bound ssDNAs were eluted by heating at 95 °C for 10 min. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara. .. The double-stranded DNA (dsDNA) product in the PCR solution was separated by streptavidin-coated sepharose beads (GE Healthcare).

Article Title: Sirtuin-7 knockdown inhibits the growth of endometrial cancer cells by inducing apoptosis via the NF-κB signaling pathway
Article Snippet: Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol. .. Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol.

Expressing:

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: mRNA expression levels of the 10 selected candidate genes were validated by reverse transcription PCR (RT-PCR). .. Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O.

Stable Transfection:

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O. .. Gene quantification was performed using an SYBR green quantitative real-time PCR (qRT-PCR) array. qRT-PCR analysis was performed on an ABI PRISM 7500 Real-Time System (Applied Biosystems, Foster City, CA, USA) with 20-μL reaction volumes containing 1 μL of reverse transcription product as a template, 10 μL of Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, C11744-100), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer, and DEPC H2 O.

Synthesized:

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: The DNA oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and purified by high-performance liquid chromatography. .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China).

Article Title: Sirtuin-7 knockdown inhibits the growth of endometrial cancer cells by inducing apoptosis via the NF-κB signaling pathway
Article Snippet: Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol. .. The expressions levels of sirtuin-7 in cells were analyzed by RT-qPCR with β-actin as an endogenous control ( ).

Autoradiography:

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication
Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara). .. The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

Quantitative RT-PCR:

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O. .. The mixture was incubated at 42 °C for 60 min and then at 70 °C for 15 min. All reverse transcription reactions were performed in a PCR S1000 Thermocycler (Bio-Rad, Hercules, CA, USA).

Article Title: Sirtuin-7 knockdown inhibits the growth of endometrial cancer cells by inducing apoptosis via the NF-κB signaling pathway
Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis ... Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol.

Real-time Polymerase Chain Reaction:

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: Paragraph title: Gene quantification by quantitative real-time PCR ... Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O.

Article Title: Identification and characterization of novel PAX8 mutations in Congenital Hypothyroidism(CH) in a Chinese population
Article Snippet: This was followed by addition of 10 U RNase inhibitor, 100 U RTase M-MLV, 1x M-MLV buffer, and dNTPs (each at 0.5 mM) (Takara). .. The reaction mixtures were incubated first at 45°C for 1 hour and then at 70°C for 15 min. Real-time PCR for each cDNA was performed in triplicate in a 10-μl reaction mixture containing 2.5 ng cDNA, 0.2 μl each forward and reverse primer (both 10 mM), and 5 μl SYBR Green PCR master mix (Applied Biosystems).

Incubation:

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication
Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara). .. The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

Article Title: Identification and characterization of novel PAX8 mutations in Congenital Hypothyroidism(CH) in a Chinese population
Article Snippet: This was followed by addition of 10 U RNase inhibitor, 100 U RTase M-MLV, 1x M-MLV buffer, and dNTPs (each at 0.5 mM) (Takara). .. The reaction mixtures were incubated first at 45°C for 1 hour and then at 70°C for 15 min. Real-time PCR for each cDNA was performed in triplicate in a 10-μl reaction mixture containing 2.5 ng cDNA, 0.2 μl each forward and reverse primer (both 10 mM), and 5 μl SYBR Green PCR master mix (Applied Biosystems).

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara.

Mass Spectrometry:

Article Title: Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions
Article Snippet: MALDI-TOF mass spectroscopy was performed using Bruker Daltonics [Matrix: 3-hydroxypicolinic acid (100 mg/ml) in H2 O-diammoniumhydrogen citrate (100 mg/ml) in H2 O (10:1, v/v)]. .. DNA polymerase I Klenow fragment (exo+ ), Pyrobest polymerase, and dNTPs were purchased from Takara Bio, Inc. Vent (exo− ) DNA polymerase was purchased from New England Biolabs, Inc. ODNs used in the enzyme reactions and T m experiments were purchased from Sigma-Aldrich Japan.

Derivative Assay:

Article Title: Investigation of Five Common Mutations on Phenylalanine Hydroxylase Gene of Phenylketonuria Patients from Two Provinces in North of Iran
Article Snippet: Polymerase chain reaction (PCR) - restriction fragment length polymorphism method was used to detect five mutations including c.1066-11G > A, p. R261Q, p. R252W, p. R261X, and c.1200 + 1G > C.[ ] The regions on PAH gene containing sites of mutations were amplified using PCR with specific primers derived from a published article. .. [ ] The PCR mixture included 200 ng of DNA, 12.5 μ of a 2X PCR master mix containing Taq enzyme, buffer and dNTPs (Takara, Japan), and 10 pmol of reverse and forward primers in total of 25 μ.

Hybridization:

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: The initial ssDNA library (10 OD) dissolved in 1 mL of binding buffer was denatured at 95 °C for 5 min and then cooled immediately on ice for 10 min to reduce intermolecular hybridization. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara.

High Performance Liquid Chromatography:

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: The DNA oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and purified by high-performance liquid chromatography. .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China).

Transfection:

Article Title: Identification and characterization of novel PAX8 mutations in Congenital Hypothyroidism(CH) in a Chinese population
Article Snippet: Total RNA was isolated from transfected HeLa cells using Trizol agent. .. This was followed by addition of 10 U RNase inhibitor, 100 U RTase M-MLV, 1x M-MLV buffer, and dNTPs (each at 0.5 mM) (Takara).

Ligation:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The adaptor ligation reaction was carried out in Quick Ligase Buffer (New England Biolabs, Ipswich, MA) containing 1.67 µM of the Adaptor A, 6.67 µM of the Adaptor B and 2000 units of T4 DNA Ligase (New England Biolabs, Ipswich, MA) at 37°C for 2 hours. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA).

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China). .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China).

SYBR Green Assay:

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China). .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China).

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O. .. The mixture was incubated at 42 °C for 60 min and then at 70 °C for 15 min. All reverse transcription reactions were performed in a PCR S1000 Thermocycler (Bio-Rad, Hercules, CA, USA).

Generated:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA). .. The samples were purified using AMPure beads and diluted to a final working concentration of 200,000 molecules per µl.

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: Bacterial DNA was extracted and 16S rRNA gene amplicons were generated and sequenced on an Illumina MiSeq (Illumina Inc., San Diego, CA, USA) with MiSeq Control Software v. 2.2.0 (Illumina Inc., San Diego, CA, USA). .. For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

other:

Article Title: Real-time loop-mediated isothermal amplification for rapid detection of Enterocytozoon hepatopenaei
Article Snippet: The real-time LAMP buffer contains 20 mM Tris–HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , two mM MgSO4 , 0.1% of Triton X-100, 1.4 mM dNTPs (TaKaRa, Dalian, China) each, and sterile water was used to make up to 25 μl.

Sequencing:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: Paragraph title: 454 FLX Sequencing ... The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA).

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: Sequence data were processed and analyzed using QIIME. .. For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

Article Title: Positive selection on schizophrenia-associated ST8SIA2 gene in post-glacial Asia
Article Snippet: Paragraph title: Typing of the three promoter SNPs in human populations by direct sequencing ... PCR reactions were performed with 50 pmol of each primer and 1 μl of genomic DNA solution in a total volume of 50 μl containing 200 μM dNTPs and 1 μl PrimeSTAR GXL DNA Polymerase (TaKaRa).

Article Title: A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8
Article Snippet: Paragraph title: PCR analyses and sequencing ... The PCR contained standard 10× PCR buffer, 50 mM MgCl2 (for the KO and Cre PCR) or 1 M betain (for Exon2 and LoxP PCR), 10 mM dNTPs, 0.10 µM of each primer, and 1 unit of Platinum Taq Polymerase (Clontech Laboratories, Mountain View, CA, USA) for the KO and Cre PCR.

Binding Assay:

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: The initial ssDNA library (10 OD) dissolved in 1 mL of binding buffer was denatured at 95 °C for 5 min and then cooled immediately on ice for 10 min to reduce intermolecular hybridization. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara.

DNA Extraction:

Article Title: Investigation of Five Common Mutations on Phenylalanine Hydroxylase Gene of Phenylketonuria Patients from Two Provinces in North of Iran
Article Snippet: Genomic DNA was extracted from 200 μl of peripheral blood using Qiagen DNA extraction kit. .. [ ] The PCR mixture included 200 ng of DNA, 12.5 μ of a 2X PCR master mix containing Taq enzyme, buffer and dNTPs (Takara, Japan), and 10 pmol of reverse and forward primers in total of 25 μ.

Article Title: Immortalization of Porcine 11β-Hydroxysteroid Dehydrogenase Type 1-Transgenic Liver Cells Using SV40 Large T Antigen
Article Snippet: Paragraph title: 4.5. Genomic DNA Extraction and Confirmation of SV40T Integration ... 100 ng of genomic DNA was amplified in a 20 μL PCR reaction containing 1 U i-Start Taq polymerase (iNtRON), 2 mM dNTPs (Takara) and 10 pmol of each specific primer listed in .

Gene Knockout:

Article Title: A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8
Article Snippet: The genotype was validated by sequencing exon 2 of the Hspb8 mouse gene after amplification by PCR using the following primers: Hspb8_exon2_Fw GGAAGTTAGGGAGCAGGTGTCC and Hspb8_exon2_Rv GGAAGTTAGGGAGCAGGTGTCC. .. The PCR contained standard 10× PCR buffer, 50 mM MgCl2 (for the KO and Cre PCR) or 1 M betain (for Exon2 and LoxP PCR), 10 mM dNTPs, 0.10 µM of each primer, and 1 unit of Platinum Taq Polymerase (Clontech Laboratories, Mountain View, CA, USA) for the KO and Cre PCR. .. We used Titanium Taq polymerase (Clontech Laboratories, Mountain View, CA, USA) to perform the Exon 2 and LoxP PCR on 100 ng genomic DNA isolated from mouse ear or tail biopsies.

Magnetic Beads:

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction. .. The PCR condition is as follows: 5 min initial denaturation at 95 °C; 28 cycles of denaturation at 95 °C (30 s), annealing at 55 °C (30 s), elongation at 72 °C (45 s), and final extension at 72 °C for 7 min.

Isolation:

Article Title: Immortalization of Porcine 11β-Hydroxysteroid Dehydrogenase Type 1-Transgenic Liver Cells Using SV40 Large T Antigen
Article Snippet: Genomic DNA was isolated with a G-DEX™ IIc Genomic DNA Extraction kit (iNtRON, Gyeonggi-do, South Korea). .. 100 ng of genomic DNA was amplified in a 20 μL PCR reaction containing 1 U i-Start Taq polymerase (iNtRON), 2 mM dNTPs (Takara) and 10 pmol of each specific primer listed in .

Article Title: Identification and characterization of novel PAX8 mutations in Congenital Hypothyroidism(CH) in a Chinese population
Article Snippet: Total RNA was isolated from transfected HeLa cells using Trizol agent. .. This was followed by addition of 10 U RNase inhibitor, 100 U RTase M-MLV, 1x M-MLV buffer, and dNTPs (each at 0.5 mM) (Takara).

Subcloning:

Article Title: Positive selection on schizophrenia-associated ST8SIA2 gene in post-glacial Asia
Article Snippet: PCR reactions were performed with 50 pmol of each primer and 1 μl of genomic DNA solution in a total volume of 50 μl containing 200 μM dNTPs and 1 μl PrimeSTAR GXL DNA Polymerase (TaKaRa). .. PCR conditions were: denaturation at 94°C for 1 min, followed by 40 cycles at 98°C for 10 s and 68°C for 4 min, with a final extension at 72°C for 10 min. After degradation of PCR primers with ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific, Waltham, MA, USA), amplified products were directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

Polymerase Chain Reaction:

Article Title: A long-term demasculinization of X-linked intergenic noncoding RNAs in Drosophila melanogaster
Article Snippet: Five tenths micrograms 6-mer random primer (Takara Company) and 5 μL dNTPs (2.5 mM, Takara Company) per microgram of RNA sample were mixed in a total volume of ≤15 μL in a tube; the tube was heated for 5 min to 70°C to melt secondary structure; the tube was cooled immediately on ice for at least 3 min to prevent a secondary structure from reforming; 5 μL M-MLV 5×Reaction Buffer (Promega Company), 5 μL dNTPs (2.5 mM, Takara Company), 0.5 μL RNase Inhibitor (HPR I, Takara Company), and 1 μL M-MLV RTase (Promega Company) were added to the annealed primer/template. .. Five tenths micrograms 6-mer random primer (Takara Company) and 5 μL dNTPs (2.5 mM, Takara Company) per microgram of RNA sample were mixed in a total volume of ≤15 μL in a tube; the tube was heated for 5 min to 70°C to melt secondary structure; the tube was cooled immediately on ice for at least 3 min to prevent a secondary structure from reforming; 5 μL M-MLV 5×Reaction Buffer (Promega Company), 5 μL dNTPs (2.5 mM, Takara Company), 0.5 μL RNase Inhibitor (HPR I, Takara Company), and 1 μL M-MLV RTase (Promega Company) were added to the annealed primer/template.

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The purified sscDNA library was analyzed on an RNA 6000 Pico chip on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) to confirm a size distribution between 450 to 750 nucleotides, and quantified with Quant-iT Ribogreen RNA Assay Kit (Invitrogen Corporation, Carlsbad, CA) on a Synergy HT (Bio-Tek Instruments Inc, Winooski, VT) instrument following the manufacturer’s instructions. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA). .. The amplification reaction was performed at: 96°C for 4 min; 94°C for 30 sec, 64°C for 30 sec, repeating steps 2 and 3 for a total of 20 cycles, followed by 68°C for 3 minutes.

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: Paragraph title: 2.7. High Throughput Sequencing of Microbiota Using 16S rRNA PCR ... For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: 10 μM forward detect primer (FD1) 10 μM reverse detect primer (RD1) 10X PCR buffer with Mg2+ : contains 100 mM Tris-HCl pH 9, 15mM MgSO4 , 100 mM KCl, 80mM (NH4 )2 SO4 , 0.5% np-40; final MgCl2 concentration of 1.5mM) dNTPs Taq DNA polymerase (Denville Scientific Inc.) .. 10 μM forward primer (F1 or F2, if desired) 10 μM reverse primer (R1 or R2, if desired) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Template Plasmid: pDDB57 [ ] .. Use reagents in section 2.4, but use the heterozygous yfg1::dpl200/YFG1 strain as the transformation recipient instead of YFG1/YFG1 strain BWP17.

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: 10 M NH4 OAc. .. 10 μM Comp forward primer (CF) 10 μM comp reverse primer (CR) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Genomic DNA: Reference strain ( see ) .. S. cerevisiae BY4741Δ trp strain [ ] YPD plates (see item 2, section 2.4) YPD liquid medium (see item 3, section 2.4) pDDB78 plasmid, Pubmed accession number pending [ ] PCR product: wild type gene amplified using complementation primers Restriction Enzymes NotI and EcoRI (New England Biolabs) 10X NE Buffer 3 (New England Biolabs) 100X BSA (New England Biolabs) Calf thymus DNA (~10 mg/mL) (Sigma) PLATE (8 mL 50% PEG3350 (Sigma) + 1 mL 10X TE + 1 mL 1 M LiOAc) CSM-TRP plates: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.074% of CSM-TRP dropout medium (MP Biomedicals, LLC), 2% bacto-agar CSM-TRP liquid medium: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.074% of CSM-URA dropout medium (MP Biomedicals, LLC) Plasmid DNA Miniprep kit (Fermentas GeneJET™ Plasmid Miniprep Kit) Acid washed glass beads (size:425–600μm)

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: Plasmid DNA Miniprep kit (Fermentas GeneJET™ Plasmid Miniprep Kit) .. 10 μM forward primer (F1) 10 μM reverse primer (R1) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Template Plasmid: pDDB57, Pubmed accession number: [ ] .. C. albicans strain BWP17 [ ] YPD+Uri (80 μg/μL) plates: 2% glucose, 2% bacto-peptone, 1% bacto-yeast extract, 2% bacto-agar, 80 μg/μL of uridine YPD+Uri (80 μg/μL) liquid medium: 2% glucose, 2% bacto-peptone, 1% bacto-yeast extract, 80 μg/μL of uridine Ura-blister cassette PCR product LATE (0.1M LiOAc in 1X TE buffer): 0.372g/L 1mM EDTA disodium salt, 1.21g/L Tris, 10.2g/L Lithium acetate, pH 7.5 Calf thymus DNA (~10 mg/mL) (Sigma D8661-1ML) PLATE (8 mL 50% w/v PEG3350 (Sigma) + 1 mL 10X TE + 1 mL 1 M LiOAc): For 50% w/v PEG3350 dissolve 50g PEG3350 in 100 mL (final volume) of distilled water and filter sterilize after mixing; For 10x TE 3.72g/L 1mM EDTA disodium salt, 12.1g 10mM TRIS, pH 7.5; For 1M LiOAc 102g/L Lithium acetate pH 7.5.

Article Title: Investigation of Five Common Mutations on Phenylalanine Hydroxylase Gene of Phenylketonuria Patients from Two Provinces in North of Iran
Article Snippet: Polymerase chain reaction (PCR) - restriction fragment length polymorphism method was used to detect five mutations including c.1066-11G > A, p. R261Q, p. R252W, p. R261X, and c.1200 + 1G > C.[ ] The regions on PAH gene containing sites of mutations were amplified using PCR with specific primers derived from a published article. .. [ ] The PCR mixture included 200 ng of DNA, 12.5 μ of a 2X PCR master mix containing Taq enzyme, buffer and dNTPs (Takara, Japan), and 10 pmol of reverse and forward primers in total of 25 μ. .. The amplification program was as follows 5 min at 95°C, 35 cycles of 1 min at 95°C, 1 min at an appropriate annealing temperature, and 1 min at 72°C, ended by a final extension step for 7 min at 72°C.

Article Title: A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8
Article Snippet: The genotype was validated by sequencing exon 2 of the Hspb8 mouse gene after amplification by PCR using the following primers: Hspb8_exon2_Fw GGAAGTTAGGGAGCAGGTGTCC and Hspb8_exon2_Rv GGAAGTTAGGGAGCAGGTGTCC. .. The PCR contained standard 10× PCR buffer, 50 mM MgCl2 (for the KO and Cre PCR) or 1 M betain (for Exon2 and LoxP PCR), 10 mM dNTPs, 0.10 µM of each primer, and 1 unit of Platinum Taq Polymerase (Clontech Laboratories, Mountain View, CA, USA) for the KO and Cre PCR. .. We used Titanium Taq polymerase (Clontech Laboratories, Mountain View, CA, USA) to perform the Exon 2 and LoxP PCR on 100 ng genomic DNA isolated from mouse ear or tail biopsies.

Article Title: Immortalization of Porcine 11β-Hydroxysteroid Dehydrogenase Type 1-Transgenic Liver Cells Using SV40 Large T Antigen
Article Snippet: Genomic DNA was isolated with a G-DEX™ IIc Genomic DNA Extraction kit (iNtRON, Gyeonggi-do, South Korea). .. 100 ng of genomic DNA was amplified in a 20 μL PCR reaction containing 1 U i-Start Taq polymerase (iNtRON), 2 mM dNTPs (Takara) and 10 pmol of each specific primer listed in . .. Amplicons were separated on 1% or 1.5% agarose gel, stained with ethidium bromide, photographed under UV illumination, and scanned using GelDoc EQ (Bio-Rad, Hercules, CA, USA).

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: mRNA expression levels of the 10 selected candidate genes were validated by reverse transcription PCR (RT-PCR). .. Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O.

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: The cells were harvested from the culture dish using a cell scraper, and the cell-bound ssDNAs were eluted by heating at 95 °C for 10 min. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara. .. The double-stranded DNA (dsDNA) product in the PCR solution was separated by streptavidin-coated sepharose beads (GE Healthcare).

Article Title: Sirtuin-7 knockdown inhibits the growth of endometrial cancer cells by inducing apoptosis via the NF-κB signaling pathway
Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis ... Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol.

Size-exclusion Chromatography:

Article Title: Sirtuin-7 knockdown inhibits the growth of endometrial cancer cells by inducing apoptosis via the NF-κB signaling pathway
Article Snippet: Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol. .. Total RNA was extracted from tumor cells using RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA) in a 20 µl volume with 5 pmol of each primer and 1 µl of RNA, 0.5 µl reverse transcriptase, 2 µl buffer, 2 µl dNTPs (both Takara Biotechnology Co., Ltd., Dalian, China) and 18 µl deionized water for 2 h at 37°C according to manufacturer's protocol.

Purification:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The purified sscDNA library was analyzed on an RNA 6000 Pico chip on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) to confirm a size distribution between 450 to 750 nucleotides, and quantified with Quant-iT Ribogreen RNA Assay Kit (Invitrogen Corporation, Carlsbad, CA) on a Synergy HT (Bio-Tek Instruments Inc, Winooski, VT) instrument following the manufacturer’s instructions. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA).

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction. .. The PCR condition is as follows: 5 min initial denaturation at 95 °C; 28 cycles of denaturation at 95 °C (30 s), annealing at 55 °C (30 s), elongation at 72 °C (45 s), and final extension at 72 °C for 7 min.

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: The DNA oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and purified by high-performance liquid chromatography. .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: mRNA expression levels of the 10 selected candidate genes were validated by reverse transcription PCR (RT-PCR). .. Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O.

Article Title: Identification and characterization of novel PAX8 mutations in Congenital Hypothyroidism(CH) in a Chinese population
Article Snippet: Paragraph title: RT-PCR analysis ... This was followed by addition of 10 U RNase inhibitor, 100 U RTase M-MLV, 1x M-MLV buffer, and dNTPs (each at 0.5 mM) (Takara).

cDNA Library Assay:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: First strand cDNA library was prepared using Superscript II (Invitrogen) according to standard protocols and directional adaptors were ligated to the cDNA ends for clonal amplification and sequencing on the Genome Sequencer FLX. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA).

Chromatin Immunoprecipitation:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The purified sscDNA library was analyzed on an RNA 6000 Pico chip on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) to confirm a size distribution between 450 to 750 nucleotides, and quantified with Quant-iT Ribogreen RNA Assay Kit (Invitrogen Corporation, Carlsbad, CA) on a Synergy HT (Bio-Tek Instruments Inc, Winooski, VT) instrument following the manufacturer’s instructions. .. The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA).

Plasmid Preparation:

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication
Article Snippet: The phi29 phage was kindly provided by Osamu Makino of Sophia University, Japan. .. The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara). .. Most of the proteins described above were purified according to a previously described method except for yeast inorganic pyrophosphatase, ribonuclease inhibitor, and T7 RNA polymerase.

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: 10 μM forward detect primer (FD1) 10 μM reverse detect primer (RD1) 10X PCR buffer with Mg2+ : contains 100 mM Tris-HCl pH 9, 15mM MgSO4 , 100 mM KCl, 80mM (NH4 )2 SO4 , 0.5% np-40; final MgCl2 concentration of 1.5mM) dNTPs Taq DNA polymerase (Denville Scientific Inc.) .. 10 μM forward primer (F1 or F2, if desired) 10 μM reverse primer (R1 or R2, if desired) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Template Plasmid: pDDB57 [ ] .. Use reagents in section 2.4, but use the heterozygous yfg1::dpl200/YFG1 strain as the transformation recipient instead of YFG1/YFG1 strain BWP17.

Article Title: Mini-blaster-mediated targeted gene disruption and marker complementation in C. albicans
Article Snippet: Plasmid DNA Miniprep kit (Fermentas GeneJET™ Plasmid Miniprep Kit) .. 10 μM forward primer (F1) 10 μM reverse primer (R1) 10X Ex Taq Buffer PCR buffer (contains 20 mM Mg2+ ) dNTPs (2.5mM each) TaKaRa Ex Taq ™ DNA polymerase (Takara Bio Inc) Template Plasmid: pDDB57, Pubmed accession number: [ ] .. C. albicans strain BWP17 [ ] YPD+Uri (80 μg/μL) plates: 2% glucose, 2% bacto-peptone, 1% bacto-yeast extract, 2% bacto-agar, 80 μg/μL of uridine YPD+Uri (80 μg/μL) liquid medium: 2% glucose, 2% bacto-peptone, 1% bacto-yeast extract, 80 μg/μL of uridine Ura-blister cassette PCR product LATE (0.1M LiOAc in 1X TE buffer): 0.372g/L 1mM EDTA disodium salt, 1.21g/L Tris, 10.2g/L Lithium acetate, pH 7.5 Calf thymus DNA (~10 mg/mL) (Sigma D8661-1ML) PLATE (8 mL 50% w/v PEG3350 (Sigma) + 1 mL 10X TE + 1 mL 1 M LiOAc): For 50% w/v PEG3350 dissolve 50g PEG3350 in 100 mL (final volume) of distilled water and filter sterilize after mixing; For 10x TE 3.72g/L 1mM EDTA disodium salt, 12.1g 10mM TRIS, pH 7.5; For 1M LiOAc 102g/L Lithium acetate pH 7.5.

Software:

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: Bacterial DNA was extracted and 16S rRNA gene amplicons were generated and sequenced on an Illumina MiSeq (Illumina Inc., San Diego, CA, USA) with MiSeq Control Software v. 2.2.0 (Illumina Inc., San Diego, CA, USA). .. For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

Article Title: Digital gene expression profiling analysis and its application in the identification of genes associated with improved response to neoadjuvant chemotherapy in breast cancer
Article Snippet: Gene-specific primers were designed using Primer 5.0 software (data not shown). .. Each reaction was performed in a final volume of 10 μL containing 1 μg of total RNA, 1 μL of random primer (10 μM), 2 μL of 5× M-MLV buffer, 1 μL of dNTPs (10 mM; Takara, Tokyo, Japan), 0.5 μL of M-MLV reverse transcriptase (Takara), 0.5 μL of RNase inhibitor (Takara), and DEPC H2 O.

Electrophoresis:

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication
Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara). .. The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

Selection:

Article Title: Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX
Article Snippet: CHO-GCGR cells in a 100 mm diameter dish were incubated with the initial library for 2 h at 4 °C for positive selection. .. The supernatant was collected and amplified by PCR using FAM-labeled forward primer and biotin-labeled reverse primer under the following conditions: 95 °C for 3 min, 6–14 cycles of 30 s at 95 °C, 30 s annealing at 55.9 °C, and 30 s extension at 72 °C, followed by 72 °C for 5 min. PCR Taq polymerase and dNTPs were products of Takara.

Agarose Gel Electrophoresis:

Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication
Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara). .. The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

Next-Generation Sequencing:

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: Paragraph title: 2.7. High Throughput Sequencing of Microbiota Using 16S rRNA PCR ... For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

Concentration Assay:

Article Title: Transcriptome Sequencing to Detect Gene Fusions in Cancer
Article Snippet: The library was PCR amplified with 2 µM each of Primer A (5'-GCC TCC CTC GCG CCA-3') and Primer B (5'-GCC TTG CCA GCC CGC-3'), 400 µM dNTPs, 1X Advantage 2 buffer and 1 µl of Advantage 2 polymerase mix (Clontech, Mountain View, CA). .. The amplification reaction was performed at: 96°C for 4 min; 94°C for 30 sec, 64°C for 30 sec, repeating steps 2 and 3 for a total of 20 cycles, followed by 68°C for 3 minutes.

Article Title: Sodium Butyrate Reduces Colitogenic Immunoglobulin A-Coated Bacteria and Modifies the Composition of Microbiota in IL-10 Deficient Mice
Article Snippet: For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction. .. For amplicon library preparation, 20 ng of each genomic DNA, 1.25 U Taq DNA polymerase, 5 μL 10 × Ex Taq buffer (Mg2+ plus), 10 mM dNTPs (all reagents purchased from TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China), and 40 pmol primer mix was used per 50 μL amplification reaction.

Marker:

Article Title: Detection of KRAS mutation via ligation-initiated LAMP reaction
Article Snippet: Co., Ltd. (Shanghai, China). .. DNA marker, 6 × loading buffer and dNTPs were purchased from Takara (Dalian, China). .. TIANamp Genomic DNA Kit was purchased from Tiangen Biotech Co., Ltd. (Beijing, China).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    TaKaRa dntps
    Transcription- and translation-coupled DNA <t>(TTcDR)</t> replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including <t>dNTPs,</t> yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.
    Dntps, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/TaKaRa
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-01
    75/100 stars
      Buy from Supplier

    Image Search Results


    Transcription- and translation-coupled DNA (TTcDR) replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including dNTPs, yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.

    Journal: Scientific Reports

    Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication

    doi: 10.1038/srep10404

    Figure Lengend Snippet: Transcription- and translation-coupled DNA (TTcDR) replication. To perform the TTcDR reaction, circular plasmid DNA encoding phi29 DNA polymerase was incubated with the translation system optimized in a previous study 11 , including dNTPs, yeast ppiase, T7 RNA polymerase, and [ 32 P]-dCTP, for 12 h at 30 °C. An aliquot of the mixture after incubation was used in 1% agarose gel electrophoresis and autoradiography. The arrowhead indicates the product of the TTcDR reaction. Lane 1: lambda-BstPI marker. Lane 2: TTcDR reaction without plasmid DNA. Lane 3: TTcDR reaction with plasmid DNA. Lane 4: DNA polymerization with a purified phi29 in phi29 standard buffer.

    Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

    Techniques: Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Electrophoresis, Autoradiography, Marker, Purification

    Translation of phi29 DNA polymerase from newly synthesized DNA in the TTcDR reaction. A ) Experimental procedure. First, we performed the optimized TTcDR reaction without [ 35 S]-methionine in the presence or absence of dNTPs, and one-tenth of the mixture was transferred to the second reaction mixture, which contained [ 35 S]-methionine, to detect translation from the replicated DNA product in the first reaction. After incubation at 30 °C for 12 h, an aliquot was used for 10% SDS-PAGE and autoradiography. B ) Translation results. Increased translation of the DNA polymerase was detected when the first reaction contained dNTPs, indicating that the translation occurred from the DNA produced in the first reaction.

    Journal: Scientific Reports

    Article Title: A transcription and translation-coupled DNA replication system using rolling-circle replication

    doi: 10.1038/srep10404

    Figure Lengend Snippet: Translation of phi29 DNA polymerase from newly synthesized DNA in the TTcDR reaction. A ) Experimental procedure. First, we performed the optimized TTcDR reaction without [ 35 S]-methionine in the presence or absence of dNTPs, and one-tenth of the mixture was transferred to the second reaction mixture, which contained [ 35 S]-methionine, to detect translation from the replicated DNA product in the first reaction. After incubation at 30 °C for 12 h, an aliquot was used for 10% SDS-PAGE and autoradiography. B ) Translation results. Increased translation of the DNA polymerase was detected when the first reaction contained dNTPs, indicating that the translation occurred from the DNA produced in the first reaction.

    Article Snippet: The optimized composition of the TTcDR system was as follows: template plasmid DNA (1 ng/μl), dNTPs (0.3 mM each, Takara), [32 -P] dCTP (3.3 μM, PerkinElmer), magnesium acetate (7.9 mM, Wako), potassium glutamate (70 mM, Wako), spermidine (0.375 mM, Nakarai), dithiothreitol (6 mM, Nakarai), ATP (0.375 mM, GE Healthcare), GTP (0.25 mM, GE Healthcare), CTP (0.125 mM, GE Healthcare), UTP (0.125 mM, GE Healthcare), creatine phosphate (25 mM, Nakarai), E. coli tRNA mixture (0.518 μg/μl, Roche), 10-formyl-5,6,7,8-tetrahydrofolic acid (10 ng/μl), Cys (0.3 mM, Wako), Tyr (0.3 mM, Wako), the other 18 amino acids except for Cys and Tyr (0.36 mM, Wako), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (100 mM, pH 7.6, Sigma), ribosomes (1 μM), IF1 (25 μM), IF2 (1 μM), IF3 (4.9 μM), EF-G (1.1 μM), EF-Tu (80 μM), EF-Ts (3.3 μM), RF1 (0.05 μM), RF2 (0.05 μM), RF3 (0.17 μM), RRF (3.9 μM), AlaRS (730 nM), ArgRS (30 nM), AsnRS (420 nM), AspRS (120 nM), CysRS (20 nM), GlnRS (60 nM), GluRS (230 nM), GlyRS (90 nM), HisRS (90 nM), IleRS (370 nM), LeuRS (40 nM), LysRS (120 nM), MetRS (110 nM), PheRS (130 nM), ProRS (170 nM), SerRS (80 nM), ThrRS (80 nM), TrpRS (30 nM), TyrRS (150 nM), ValRS (20 nM), MTF (590 nM), creatine kinase (0.25 μM), myokinase (1.4 μM), nucleoside-diphosphate kinase (20 nM), pyrophosphatase (40 nM), yeast inorganic pyrophosphatase (0.2 mU/μl, New England BioLabs (NEB)), ribonuclease inhibitor (0.1 U/μl; Promega), and T7 RNA polymerase (0.42 U/μl; Takara).

    Techniques: Synthesized, Incubation, SDS Page, Autoradiography, Produced

    Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using the natural and oxidized dNTPs (each dNTP at 10 µM) in the natural template. Lane 1 refers to the appropriate size markers. ( C ) Extension reactions in the presence of dGTP, dTTP, dATP and dC o TP (each dNTP at 10 µM) were shown in lanes 2 and 3 by KF (exo − ) and lanes 6 and 7 by Vent (exo − ). Extension reactions in the presence of dGTP, dTTP, dCTP and dA o TP (each dNTP at 10 µM) were shown in lanes 4 and 5 by KF (exo − ) and lanes 8 anmd 9 by Vent (exo − ). Lane 1 refer to the appropriate marker.

    Journal: Nucleic Acids Research

    Article Title: Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    doi: 10.1093/nar/gkq914

    Figure Lengend Snippet: Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using the natural and oxidized dNTPs (each dNTP at 10 µM) in the natural template. Lane 1 refers to the appropriate size markers. ( C ) Extension reactions in the presence of dGTP, dTTP, dATP and dC o TP (each dNTP at 10 µM) were shown in lanes 2 and 3 by KF (exo − ) and lanes 6 and 7 by Vent (exo − ). Extension reactions in the presence of dGTP, dTTP, dCTP and dA o TP (each dNTP at 10 µM) were shown in lanes 4 and 5 by KF (exo − ) and lanes 8 anmd 9 by Vent (exo − ). Lane 1 refer to the appropriate marker.

    Article Snippet: DNA polymerase I Klenow fragment (exo+ ), Pyrobest polymerase, and dNTPs were purchased from Takara Bio, Inc. Vent (exo− ) DNA polymerase was purchased from New England Biolabs, Inc. ODNs used in the enzyme reactions and T m experiments were purchased from Sigma-Aldrich Japan.

    Techniques: Labeling, Polyacrylamide Gel Electrophoresis, Marker

    Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using mixed dNTPs (each dNTP at 10 µM) in the oxidized templates. Lanes 1 refers to the appropriate marker. ( C ) PAGE analysis of extension reactions in the presence of dGTP, dTTP, dATP and dCTP (each dNTP at 10 µM). Lane 1 refer to the appropriate marker. Extension reactions by KF (exo − ) are shown in lanes 2–5, and its reactions by Vent (exo − ) are shown in lanes 6–9.

    Journal: Nucleic Acids Research

    Article Title: Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    doi: 10.1093/nar/gkq914

    Figure Lengend Snippet: Extension reactions with mixed dNTPs. ( A ) Sequences of 5′-FAM labeled 18-nt primer and 26-nt templates. ( B ) PAGE analysis of extension reactions using mixed dNTPs (each dNTP at 10 µM) in the oxidized templates. Lanes 1 refers to the appropriate marker. ( C ) PAGE analysis of extension reactions in the presence of dGTP, dTTP, dATP and dCTP (each dNTP at 10 µM). Lane 1 refer to the appropriate marker. Extension reactions by KF (exo − ) are shown in lanes 2–5, and its reactions by Vent (exo − ) are shown in lanes 6–9.

    Article Snippet: DNA polymerase I Klenow fragment (exo+ ), Pyrobest polymerase, and dNTPs were purchased from Takara Bio, Inc. Vent (exo− ) DNA polymerase was purchased from New England Biolabs, Inc. ODNs used in the enzyme reactions and T m experiments were purchased from Sigma-Aldrich Japan.

    Techniques: Labeling, Polyacrylamide Gel Electrophoresis, Marker