dntps  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 DNA Ligase (2,000,000 units/ml)
    Description:

    Catalog Number:
    M0202T
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs dntps
    ( a ) Template-primer strand duplex used in the running start experiment showing the numbering scheme. ( b ) Typical running start primer extension experiments catalyzed by BF as a function of incubation time (min). Extension of the primer strand, a 22-mer with the terminal 3′-G base opposite the template base C labeled ‘–3’ on the template strand. The position of the [BP]G* is labeled ‘0’ (25-mer). The ‘–1’ position denotes a 24-mer. The lane marked ‘M’ contains 22-mer, 24-mer, 25-mer and 43-mer primer strands (the 43-mer corresponds to the length of a fully extended primer strand). Reactions were initiated with 4.5 nM of the primer/template duplex (1:1.5 ratio), 20 nM of BF, and 200 μM of <t>dNTPs</t> at 37°C. ( c ) Typical single step 2′-deoxynucleotide triphosphate (dNTP) insertion catalyzed by BF. The primer strand was 24 nucleotides long with the terminal 3′-C positioned opposite the template base labeled ‘–1’ which corresponds to the darkest bands in this figure. Incorporation of each individual dNTP opposite the [BP]G* adduct results in the lighter bands just above the darkest bands, where A = <t>dATP,</t> C = dCTP, G = dGTP, T = dTTP, and Ctr = ‘–1’ and ‘0’ position marker. Reactions were initiated at 2 mM of each dNTP, 15 nM of [DNA], and 2 nM of BF at 37°C for 30 min.

    https://www.bioz.com/result/dntps/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2019-10
    99/100 stars

    Related Products / Commonly Used Together

    tgirt - iii
    rnaseout recombinant ribonuclease inhibitor

    Images

    1) Product Images from "Following an environmental carcinogen N2-dG adduct through replication: elucidating blockage and bypass in a high-fidelity DNA polymerase"

    Article Title: Following an environmental carcinogen N2-dG adduct through replication: elucidating blockage and bypass in a high-fidelity DNA polymerase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm416

    ( a ) Template-primer strand duplex used in the running start experiment showing the numbering scheme. ( b ) Typical running start primer extension experiments catalyzed by BF as a function of incubation time (min). Extension of the primer strand, a 22-mer with the terminal 3′-G base opposite the template base C labeled ‘–3’ on the template strand. The position of the [BP]G* is labeled ‘0’ (25-mer). The ‘–1’ position denotes a 24-mer. The lane marked ‘M’ contains 22-mer, 24-mer, 25-mer and 43-mer primer strands (the 43-mer corresponds to the length of a fully extended primer strand). Reactions were initiated with 4.5 nM of the primer/template duplex (1:1.5 ratio), 20 nM of BF, and 200 μM of dNTPs at 37°C. ( c ) Typical single step 2′-deoxynucleotide triphosphate (dNTP) insertion catalyzed by BF. The primer strand was 24 nucleotides long with the terminal 3′-C positioned opposite the template base labeled ‘–1’ which corresponds to the darkest bands in this figure. Incorporation of each individual dNTP opposite the [BP]G* adduct results in the lighter bands just above the darkest bands, where A = dATP, C = dCTP, G = dGTP, T = dTTP, and Ctr = ‘–1’ and ‘0’ position marker. Reactions were initiated at 2 mM of each dNTP, 15 nM of [DNA], and 2 nM of BF at 37°C for 30 min.
    Figure Legend Snippet: ( a ) Template-primer strand duplex used in the running start experiment showing the numbering scheme. ( b ) Typical running start primer extension experiments catalyzed by BF as a function of incubation time (min). Extension of the primer strand, a 22-mer with the terminal 3′-G base opposite the template base C labeled ‘–3’ on the template strand. The position of the [BP]G* is labeled ‘0’ (25-mer). The ‘–1’ position denotes a 24-mer. The lane marked ‘M’ contains 22-mer, 24-mer, 25-mer and 43-mer primer strands (the 43-mer corresponds to the length of a fully extended primer strand). Reactions were initiated with 4.5 nM of the primer/template duplex (1:1.5 ratio), 20 nM of BF, and 200 μM of dNTPs at 37°C. ( c ) Typical single step 2′-deoxynucleotide triphosphate (dNTP) insertion catalyzed by BF. The primer strand was 24 nucleotides long with the terminal 3′-C positioned opposite the template base labeled ‘–1’ which corresponds to the darkest bands in this figure. Incorporation of each individual dNTP opposite the [BP]G* adduct results in the lighter bands just above the darkest bands, where A = dATP, C = dCTP, G = dGTP, T = dTTP, and Ctr = ‘–1’ and ‘0’ position marker. Reactions were initiated at 2 mM of each dNTP, 15 nM of [DNA], and 2 nM of BF at 37°C for 30 min.

    Techniques Used: Incubation, Labeling, Marker

    2) Product Images from "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins"

    Article Title: Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1321

    The effect of SSBs on the primer extension activity of PrimPol. (A) Primer-template substrates (20 nM) and dNTPs (100 μM) were incubated with PrimPol (100 nM), either alone or with RPA (400 nM), mtSSB (200 nM) or T4 SSB (400 nM), for increasing times (1, 3, 5, 10 min). In the presence of SSBs, full-length PrimPol's primer extension activity is severely impeded. The primer runs at the position indicated ‘ N ’, with full extension denoted by ‘ N + 77’. ‘C’ indicates the no enzyme control. For each gel, the 10-min time-point was quantified to identify the percentage of primers extended more than 1, 5, 10, 15, 20 or 25 bases. This quantification is shown on the right of the gels. (B) The primer extension activity of PrimPol 24–354 is also restricted in the presence of SSBs. Quantification of the 10-min time-point for each gel is again shown to the right of the gels. (C) Schematic representation of the inhibitory effect of SSBs on the primer extension activity of PrimPol.
    Figure Legend Snippet: The effect of SSBs on the primer extension activity of PrimPol. (A) Primer-template substrates (20 nM) and dNTPs (100 μM) were incubated with PrimPol (100 nM), either alone or with RPA (400 nM), mtSSB (200 nM) or T4 SSB (400 nM), for increasing times (1, 3, 5, 10 min). In the presence of SSBs, full-length PrimPol's primer extension activity is severely impeded. The primer runs at the position indicated ‘ N ’, with full extension denoted by ‘ N + 77’. ‘C’ indicates the no enzyme control. For each gel, the 10-min time-point was quantified to identify the percentage of primers extended more than 1, 5, 10, 15, 20 or 25 bases. This quantification is shown on the right of the gels. (B) The primer extension activity of PrimPol 24–354 is also restricted in the presence of SSBs. Quantification of the 10-min time-point for each gel is again shown to the right of the gels. (C) Schematic representation of the inhibitory effect of SSBs on the primer extension activity of PrimPol.

    Techniques Used: Activity Assay, Incubation, Recombinase Polymerase Amplification

    The effect of SSBs on the primase activity of human PrimPol. Single-stranded poly-dT templates (500 nM) were incubated with dNTPs or rNTPs (500 μM) and human PrimPol (1 μM), either alone or in the presence of RPA (8 μM), mtSSB (4 μM) or T4 SSB (8 μM) for 1 h at 37ºC (see ‘Materials and Methods’ for details). In the absence of SSBs PrimPol is capable of de novo primer synthesis using either dNTPs or rNTPs. However, when templates are coated with SSBs PrimPol is unable to synthesize primers. The schematic above represents how this inhibition is likely a result of RPA and mtSSB blocking PrimPol binding sites on the ssDNA.
    Figure Legend Snippet: The effect of SSBs on the primase activity of human PrimPol. Single-stranded poly-dT templates (500 nM) were incubated with dNTPs or rNTPs (500 μM) and human PrimPol (1 μM), either alone or in the presence of RPA (8 μM), mtSSB (4 μM) or T4 SSB (8 μM) for 1 h at 37ºC (see ‘Materials and Methods’ for details). In the absence of SSBs PrimPol is capable of de novo primer synthesis using either dNTPs or rNTPs. However, when templates are coated with SSBs PrimPol is unable to synthesize primers. The schematic above represents how this inhibition is likely a result of RPA and mtSSB blocking PrimPol binding sites on the ssDNA.

    Techniques Used: Activity Assay, Incubation, Recombinase Polymerase Amplification, Inhibition, Blocking Assay, Binding Assay

    3) Product Images from "Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)"

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0067558

    PAGE electrophoresis of PEAR products. For dNTPs, lowercase letters (agct) represents natural dNTPs, and uppercase letters (AGCT) represents dNTPαSs. (A) PEAR products incorporating natural or dATPαS, dGTPαS, dCTPαS, dTTPαS: Lane 1: natural dNTPs; Lane 2: dATPαSs; Lane 3: No PspGI control; Lane 4: No Phusion DNA polymerase control; Lane 5: No dATP control; Lane 6∶10bp DNA ladder; Lane 7: dGTPαS; Lane 8: No PspGI control; Lane 9: No Phusion DNA polymerase control; Lane 10: No dCTP control; Lane 11: dCTPαSs; Lane 12: No PspGI control; Lane 13: No Phusion DNA polymerase control; Lane 14: No dCTP control; Lane 15: dTTPαSs; Lane 16: No PspGI control; Lane 17: No Phusion DNA polymerase control; Lane 18: No dTTP control; Lane 19∶10bp DNA ladder. (B) PEAR products incorporating one or two kind of dNTPαSs: Lane 1: natural dNTPs; Lane 2–5: one kind of dNTPαSs; Lane 6–8: two kind of dNTPαSs; Lane 9: No dNTPs control; Lane 10∶10bp DNA ladder; (C) Full digestion of PEAR products incorporating different dNTPs or dNTPαSs.
    Figure Legend Snippet: PAGE electrophoresis of PEAR products. For dNTPs, lowercase letters (agct) represents natural dNTPs, and uppercase letters (AGCT) represents dNTPαSs. (A) PEAR products incorporating natural or dATPαS, dGTPαS, dCTPαS, dTTPαS: Lane 1: natural dNTPs; Lane 2: dATPαSs; Lane 3: No PspGI control; Lane 4: No Phusion DNA polymerase control; Lane 5: No dATP control; Lane 6∶10bp DNA ladder; Lane 7: dGTPαS; Lane 8: No PspGI control; Lane 9: No Phusion DNA polymerase control; Lane 10: No dCTP control; Lane 11: dCTPαSs; Lane 12: No PspGI control; Lane 13: No Phusion DNA polymerase control; Lane 14: No dCTP control; Lane 15: dTTPαSs; Lane 16: No PspGI control; Lane 17: No Phusion DNA polymerase control; Lane 18: No dTTP control; Lane 19∶10bp DNA ladder. (B) PEAR products incorporating one or two kind of dNTPαSs: Lane 1: natural dNTPs; Lane 2–5: one kind of dNTPαSs; Lane 6–8: two kind of dNTPαSs; Lane 9: No dNTPs control; Lane 10∶10bp DNA ladder; (C) Full digestion of PEAR products incorporating different dNTPs or dNTPαSs.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis

    4) Product Images from "microDuMIP: target-enrichment technique for microarray-based duplex molecular inversion probes"

    Article Title: microDuMIP: target-enrichment technique for microarray-based duplex molecular inversion probes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1188

    Relative quantity of circularized MIP products. The y-axis shows the ‘percentage of unique reads’, with unique reads defined as those having distinct barcodes and arm sequence combinations. Since the number of unique reads increases as total number of reads increases, in order to normalize it, we randomly selected 2 million reads for each condition, counted the number of unique reads and calculated the percentage of unique reads. As the amount of gDNA or hybridization time increased, more unique reads were detected, indicating that more circularized product was obtained. A 1:500 gDNA:probe ratio and 10x dNTPs were used for all conditions.
    Figure Legend Snippet: Relative quantity of circularized MIP products. The y-axis shows the ‘percentage of unique reads’, with unique reads defined as those having distinct barcodes and arm sequence combinations. Since the number of unique reads increases as total number of reads increases, in order to normalize it, we randomly selected 2 million reads for each condition, counted the number of unique reads and calculated the percentage of unique reads. As the amount of gDNA or hybridization time increased, more unique reads were detected, indicating that more circularized product was obtained. A 1:500 gDNA:probe ratio and 10x dNTPs were used for all conditions.

    Techniques Used: Sequencing, Hybridization

    Comparison of capture efficiencies under different conditions. The effects of varying ( A ) the gDNA:probe ratio, and ( B ) the amount of dNTPs are shown. Band intensity (∼200 bp, red arrows) is proportional to the amount of captured product on each of the capture parameters, because the number of PCR cycles was held constant at 26 cycles. The amount of captured products was saturated at 1:500 gDNA:probe ratio and 10x dNTPs. ( C ) and ( D ) Captured products were detected around 200 bp for all conditions, and only products in these bands were separated and used for further analysis.
    Figure Legend Snippet: Comparison of capture efficiencies under different conditions. The effects of varying ( A ) the gDNA:probe ratio, and ( B ) the amount of dNTPs are shown. Band intensity (∼200 bp, red arrows) is proportional to the amount of captured product on each of the capture parameters, because the number of PCR cycles was held constant at 26 cycles. The amount of captured products was saturated at 1:500 gDNA:probe ratio and 10x dNTPs. ( C ) and ( D ) Captured products were detected around 200 bp for all conditions, and only products in these bands were separated and used for further analysis.

    Techniques Used: Polymerase Chain Reaction

    5) Product Images from "Selection of self-priming molecular replicators"

    Article Title: Selection of self-priming molecular replicators

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkz044

    High-throughput sequencing for PS-THSP products of random sequences with a serial dilution. ( A ) PS-THSP was performed with a PS-THSP probe 1 (100 nM) and different amount of dNTPs (M: 50 bp DNA ladder, lane 1: 0 μM, lane 2: 2 μM, lane 3: 20 μM, lane 4: 200 μM, lane 5: 2 mM). The product of first round was 10 times serially diluted to fourth round and PS-THSP was performed for each round. ( B ) The flow chart shows that how the next generation sequencing data for PS-THSP products was analysed. ( C ) The four-way Venn diagram was prepared with the analysed NGS data for all the rounds.
    Figure Legend Snippet: High-throughput sequencing for PS-THSP products of random sequences with a serial dilution. ( A ) PS-THSP was performed with a PS-THSP probe 1 (100 nM) and different amount of dNTPs (M: 50 bp DNA ladder, lane 1: 0 μM, lane 2: 2 μM, lane 3: 20 μM, lane 4: 200 μM, lane 5: 2 mM). The product of first round was 10 times serially diluted to fourth round and PS-THSP was performed for each round. ( B ) The flow chart shows that how the next generation sequencing data for PS-THSP products was analysed. ( C ) The four-way Venn diagram was prepared with the analysed NGS data for all the rounds.

    Techniques Used: Next-Generation Sequencing, Serial Dilution, Flow Cytometry

    Related Articles

    Clone Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Paragraph title: Generation of chimeric infectious clones ... The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Centrifugation:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Amplification:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In a subset of pYC vectors, the gut fungal FEX gene is preceded by a 5′ Preproleader sequence, which, including a 3’ cloning scar, translates into the following peptide: MKVLIVLLAIFAALPLALAQPVISTTVGSAAEGSLDKREARPDV ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Filtration:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    De-Phosphorylation Assay:

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: Digestion of pAAV-CFP-Neo was performed with AfeI (New England Biolabs, Ipswich, MA) for 2 h at 37 °C, followed by dephosphorylation of the 5′ and 3′ ends with Alkaline phosphatase (New England Biolabs, Ipswich, MA) for 20 minutes at 37 °C. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    DNA Ligation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Synthesized:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Construct:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Paragraph title: pPAL-LACK, pPAL-IL-12p35 and pPAL-IL-12p40 plasmid constructs ... The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: New sgRNA plasmids were then constructed using inverse PCR. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Real-time Polymerase Chain Reaction:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ). .. Correct clones were identified after DNA extraction by digestion with Hin dIII/Pst I, Ahd I, and Bgl I. Plasmid expression of hFX expression was assessed by ELISA after transient transfection of HepG2 cells with Fugene (Roche, Basel, Switzerland), and clones were amplified with Megaprep (Qiagen, Limberg, The Netherlands). scAAV-LP1-hFIXco and scAAV-LP1-hFXco plasmids were used in adenovirus-free transient transfection of 293T cells to generate scAAV5 and scAAV8 pseudotypes, as described by Nakai et al . ( ).

    Incubation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Samples were heated to 95°C for 5 min then 80°C for 5 min, cooled to 60°C (4 min/1°C), and finally slowly cooled to 4°C (6 min/1°C). .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After staining with ethidium bromide, the band of correctly assembled cages was cut out of the gel and grounded into a fine powder, by freezing with liquid nitrogen.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Activity Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: Paragraph title: Validating enhancer activity in HeLa S3 and neuroblastoma cells ... 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Introduce:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Expressing:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Paragraph title: Construction of plasmids for expression of sgRNAs. ... Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Modification:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Transformation Assay:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Derivative Assay:

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The reciprocal version, IE/IAB, had the 5′ UTR and nonstructural protein gene region of IE 68U201 and structural protein gene region and 3′ UTR derived from IAB TrD. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    High Performance Liquid Chromatography:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Transfection:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Inverse PCR:

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: The DNA was eluted or resuspended in 30 µl of water. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. Splinkerette PCR was performed as previously reported ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Ligation:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ). .. To monitor ligation and recovery, the central U6 fragments were trace-labelled with γ-[32 P] ATP (Perkin Elmer) and polynucleotide kinase (NEB).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Cell Culture:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. 20 µL of competent cells were transformed with 2 µL of phagemid DNA ligation mix.

    Generated:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Single-stranded DNA was generated using asymmetric production with 200 ng of purified dsDNA and 1 μM 5′-phosphorylated primer and Accustart HiFi polymerase (QuantaBio, Inc., Beverly, MA) in 1× Accustart HiFi buffer with 2 mM MgCl2 , and cycled 25 times, as previously described . .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Initially, for each reciprocal chimera, two overlapping fragments that encompassed the fusion site of the two genomes were generated by PCR using a forward primer from within the nsP4 region (7041 F IAB AND 6509 F IE) with a reverse fusion primer (IAB/IE R and IE/IAB R) and reverse primer downstream of the junction site (8007 R IAB and 8312 R) paired with a forward fusion primer for each chimera (IAB/IE F and IE/IAB R) ( ). .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Sequencing:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR reaction was performed in 50 μl reaction to amplify each sequence of interest from 100 ng of human cerebellum tissue gDNA using One Taq DNA polymerase Kit (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: This step was followed by a mammalian signal sequence and a 20-base pair overhang with the N-terminal mature sequence of the omalizumab-specific murine antibody (5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGC AACTGGAGTACATTCACAGGTTCAGCTGCAGCAGTC-3′) and a 3′-reverse oligonucleotide that introduced a Xho1 site at the 3′-end of the variable heavy region (5′-GATGGGGGTGTCGTTTTGGCACTCGAGACGGTGACTGTGGTTCC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Double stranded DNA was generated by amplification of the synthetic gBlock f1 sequence with Phusion™ polymerase (New England Biolabs, Inc., Ipswitch, MA). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Recombinant:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Isolation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. 10% of total transformation mixture volumes were plated onto LB-agar containing 5μM triclosan and grown at 37°C for 16h.

    Purification:

    Article Title: In vitro reconstitution of DNA replication initiated by genetic recombination: a T4 bacteriophage model for a type of DNA synthesis important for all cells
    Article Snippet: All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed. .. All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed.

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ).

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: CIP and nls-CIP PCR products were digested with AfeI and demethylated (DpnI) for 2 h at 37 °C and then purified. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Once pGH-IL12-p40 and pPAL MluI digests were purified, the entire process was repeated with XbaI. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: After column purification, sequences were ligated into a version of the low-copy plasmid pUA66, which contains a gfpmut2 open reading frame downstream of a strong ribosomal binding site ( ). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Twenty five microgram of forward and reverse oligonucleotides of telomeric, variant repeat or control sequences ( ) were denatured at 80°C and annealed by cooling. .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Chemically synthesized DNA was immobilized on 0.5 mg streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidin C1, Invitrogen) for 15 min at RT and incubated with 400–800 μg protein lysates diluted in PBB buffer (150 mM NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 0.5% IGEPAL CA-630, 1 μM Pepstatin, 1 μg/ml Leupeptin and 0.5 mM PMSF) for 1.5 h on a rotation wheel at 4°C.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Polymerase Chain Reaction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Lineage-specific RUNX2 super-enhancer activates MYC and promotes the development of blastic plasmacytoid dendritic cell neoplasm
    Article Snippet: Paragraph title: Chromosome conformation capture (3C)-quantitative PCR ... Nuclei samples were digested with EcoRI at 37 °C 16 h and then ligated using T4 DNA ligase (NEB) .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: A GA reaction was performed by mixing an equal volume of 2 × GA Master Mix (Cat #E2611L; NEB) with 1 pmoL PCR-amplified and DpnI-treated pRV (BB_GAR-F: 5′-ACTTGTTCACTTTGATGGCGAGG-3′, BB_GAR-R: 5′-CTGCACACGACATGACATCACG-3′) and 1 pmol of the recovered shuffled capsids, at 50°C for 30 min. DNA was ethanol precipitated and electroporated into SS320 electro-competent E. coli (Cat #60512-2; Lucigen). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. The gene encoding Fex1p was amplified from the S. cerevisiae genome using primers 1 and 2 ( ) and subcloned into pYC2/CT.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The two individual fragments were joined by a PCR reaction on both templates utilizing the outermost primer sets. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: We gel-purified the double-stranded PCR product and double-digested it using BamHI and XhoI. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    3C-Seq:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Concentration Assay:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Briefly, cages were assembled by combining equimolar amounts of each strand at a concentration of 1 μM in an assembly buffer containing 40 mM Tris-acetate (pH 8.0) and 15 mM MgCl2 . .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Agarose Gel Electrophoresis:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Plasmid Preparation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 1 μl of ligation reaction was transformed to 100 μl of DH5α competent cells (Invitrogen).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: Paragraph title: Vector production ... AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Paragraph title: Plasmid assembly by single-stranded DNA ... The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Functional Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Binding Assay:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Base-pairing sequences binding to the nontemplate DNA strand were selected. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Sample Prep:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Transgenic Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: Paragraph title: Construction of piggyBac transgenic vectors ... The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Spectrophotometry:

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Activation Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Produced:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: scAAV-LP1-hFIXco was produced as described by Nathwani et al . ( ). scAAV-LP1-hFXco was produced similarly, replacing the hFIXco with the codon-optimized hFX transgene (hFXco), from pAV-LP1-hFX with a truncated poly-A. .. AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Oligonucleotide Synthesis:

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Gel Extraction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The bands were excised and purified with QIAquick Gel Extraction Kit (Qiagen), and the 50μL eluate was diluted to 100μL with milliQ water and precipitated with 0.1 volume of 3M sodium acetate and 2.5 volumes of pre-chilled absolute ethanol at -20°C for 30 min. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Variant Assay:

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 77
    New England Biolabs dntps
    The effect of SSBs on the primer extension activity of PrimPol. (A) Primer-template substrates (20 nM) and <t>dNTPs</t> (100 μM) were incubated with PrimPol (100 nM), either alone or with RPA (400 nM), mtSSB (200 nM) or <t>T4</t> SSB (400 nM), for increasing times (1, 3, 5, 10 min). In the presence of SSBs, full-length PrimPol's primer extension activity is severely impeded. The primer runs at the position indicated ‘ N ’, with full extension denoted by ‘ N + 77’. ‘C’ indicates the no enzyme control. For each gel, the 10-min time-point was quantified to identify the percentage of primers extended more than 1, 5, 10, 15, 20 or 25 bases. This quantification is shown on the right of the gels. (B) The primer extension activity of PrimPol 24–354 is also restricted in the presence of SSBs. Quantification of the 10-min time-point for each gel is again shown to the right of the gels. (C) Schematic representation of the inhibitory effect of SSBs on the primer extension activity of PrimPol.
    Dntps, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2019-10
    77/100 stars
      Buy from Supplier

    Image Search Results


    The effect of SSBs on the primer extension activity of PrimPol. (A) Primer-template substrates (20 nM) and dNTPs (100 μM) were incubated with PrimPol (100 nM), either alone or with RPA (400 nM), mtSSB (200 nM) or T4 SSB (400 nM), for increasing times (1, 3, 5, 10 min). In the presence of SSBs, full-length PrimPol's primer extension activity is severely impeded. The primer runs at the position indicated ‘ N ’, with full extension denoted by ‘ N + 77’. ‘C’ indicates the no enzyme control. For each gel, the 10-min time-point was quantified to identify the percentage of primers extended more than 1, 5, 10, 15, 20 or 25 bases. This quantification is shown on the right of the gels. (B) The primer extension activity of PrimPol 24–354 is also restricted in the presence of SSBs. Quantification of the 10-min time-point for each gel is again shown to the right of the gels. (C) Schematic representation of the inhibitory effect of SSBs on the primer extension activity of PrimPol.

    Journal: Nucleic Acids Research

    Article Title: Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins

    doi: 10.1093/nar/gku1321

    Figure Lengend Snippet: The effect of SSBs on the primer extension activity of PrimPol. (A) Primer-template substrates (20 nM) and dNTPs (100 μM) were incubated with PrimPol (100 nM), either alone or with RPA (400 nM), mtSSB (200 nM) or T4 SSB (400 nM), for increasing times (1, 3, 5, 10 min). In the presence of SSBs, full-length PrimPol's primer extension activity is severely impeded. The primer runs at the position indicated ‘ N ’, with full extension denoted by ‘ N + 77’. ‘C’ indicates the no enzyme control. For each gel, the 10-min time-point was quantified to identify the percentage of primers extended more than 1, 5, 10, 15, 20 or 25 bases. This quantification is shown on the right of the gels. (B) The primer extension activity of PrimPol 24–354 is also restricted in the presence of SSBs. Quantification of the 10-min time-point for each gel is again shown to the right of the gels. (C) Schematic representation of the inhibitory effect of SSBs on the primer extension activity of PrimPol.

    Article Snippet: Extensions were carried out at 37°C in 20 μl volumes containing; 100 nM of the assayed polymerase (or 3U/ml of T4 Pol), 20 nM primer-template substrate, 100 μM dNTPs (NEB), 50 mM Potassium acetate, 20 mM Tris-acetate pH 7.9, 10 mM Magnesium acetate, 1 mM DTT and 2 μg bovine serum albumin (BSA; NEB).

    Techniques: Activity Assay, Incubation, Recombinase Polymerase Amplification

    The effect of SSBs on the primase activity of human PrimPol. Single-stranded poly-dT templates (500 nM) were incubated with dNTPs or rNTPs (500 μM) and human PrimPol (1 μM), either alone or in the presence of RPA (8 μM), mtSSB (4 μM) or T4 SSB (8 μM) for 1 h at 37ºC (see ‘Materials and Methods’ for details). In the absence of SSBs PrimPol is capable of de novo primer synthesis using either dNTPs or rNTPs. However, when templates are coated with SSBs PrimPol is unable to synthesize primers. The schematic above represents how this inhibition is likely a result of RPA and mtSSB blocking PrimPol binding sites on the ssDNA.

    Journal: Nucleic Acids Research

    Article Title: Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins

    doi: 10.1093/nar/gku1321

    Figure Lengend Snippet: The effect of SSBs on the primase activity of human PrimPol. Single-stranded poly-dT templates (500 nM) were incubated with dNTPs or rNTPs (500 μM) and human PrimPol (1 μM), either alone or in the presence of RPA (8 μM), mtSSB (4 μM) or T4 SSB (8 μM) for 1 h at 37ºC (see ‘Materials and Methods’ for details). In the absence of SSBs PrimPol is capable of de novo primer synthesis using either dNTPs or rNTPs. However, when templates are coated with SSBs PrimPol is unable to synthesize primers. The schematic above represents how this inhibition is likely a result of RPA and mtSSB blocking PrimPol binding sites on the ssDNA.

    Article Snippet: Extensions were carried out at 37°C in 20 μl volumes containing; 100 nM of the assayed polymerase (or 3U/ml of T4 Pol), 20 nM primer-template substrate, 100 μM dNTPs (NEB), 50 mM Potassium acetate, 20 mM Tris-acetate pH 7.9, 10 mM Magnesium acetate, 1 mM DTT and 2 μg bovine serum albumin (BSA; NEB).

    Techniques: Activity Assay, Incubation, Recombinase Polymerase Amplification, Inhibition, Blocking Assay, Binding Assay

    Relative quantity of circularized MIP products. The y-axis shows the ‘percentage of unique reads’, with unique reads defined as those having distinct barcodes and arm sequence combinations. Since the number of unique reads increases as total number of reads increases, in order to normalize it, we randomly selected 2 million reads for each condition, counted the number of unique reads and calculated the percentage of unique reads. As the amount of gDNA or hybridization time increased, more unique reads were detected, indicating that more circularized product was obtained. A 1:500 gDNA:probe ratio and 10x dNTPs were used for all conditions.

    Journal: Nucleic Acids Research

    Article Title: microDuMIP: target-enrichment technique for microarray-based duplex molecular inversion probes

    doi: 10.1093/nar/gku1188

    Figure Lengend Snippet: Relative quantity of circularized MIP products. The y-axis shows the ‘percentage of unique reads’, with unique reads defined as those having distinct barcodes and arm sequence combinations. Since the number of unique reads increases as total number of reads increases, in order to normalize it, we randomly selected 2 million reads for each condition, counted the number of unique reads and calculated the percentage of unique reads. As the amount of gDNA or hybridization time increased, more unique reads were detected, indicating that more circularized product was obtained. A 1:500 gDNA:probe ratio and 10x dNTPs were used for all conditions.

    Article Snippet: Then, 2 U of AmpliTaq® DNA polymerase (Life Technologies), 4 U of Ampligase DNA ligase (Epicentre® ), 10x dNTPs (NEB® Inc), 0.2 μl of Ampligase buffer (Epicentre® ) were added and the mixtures were incubated for 24 h at 60°C.

    Techniques: Sequencing, Hybridization

    Comparison of capture efficiencies under different conditions. The effects of varying ( A ) the gDNA:probe ratio, and ( B ) the amount of dNTPs are shown. Band intensity (∼200 bp, red arrows) is proportional to the amount of captured product on each of the capture parameters, because the number of PCR cycles was held constant at 26 cycles. The amount of captured products was saturated at 1:500 gDNA:probe ratio and 10x dNTPs. ( C ) and ( D ) Captured products were detected around 200 bp for all conditions, and only products in these bands were separated and used for further analysis.

    Journal: Nucleic Acids Research

    Article Title: microDuMIP: target-enrichment technique for microarray-based duplex molecular inversion probes

    doi: 10.1093/nar/gku1188

    Figure Lengend Snippet: Comparison of capture efficiencies under different conditions. The effects of varying ( A ) the gDNA:probe ratio, and ( B ) the amount of dNTPs are shown. Band intensity (∼200 bp, red arrows) is proportional to the amount of captured product on each of the capture parameters, because the number of PCR cycles was held constant at 26 cycles. The amount of captured products was saturated at 1:500 gDNA:probe ratio and 10x dNTPs. ( C ) and ( D ) Captured products were detected around 200 bp for all conditions, and only products in these bands were separated and used for further analysis.

    Article Snippet: Then, 2 U of AmpliTaq® DNA polymerase (Life Technologies), 4 U of Ampligase DNA ligase (Epicentre® ), 10x dNTPs (NEB® Inc), 0.2 μl of Ampligase buffer (Epicentre® ) were added and the mixtures were incubated for 24 h at 60°C.

    Techniques: Polymerase Chain Reaction

    High-throughput sequencing for PS-THSP products of random sequences with a serial dilution. ( A ) PS-THSP was performed with a PS-THSP probe 1 (100 nM) and different amount of dNTPs (M: 50 bp DNA ladder, lane 1: 0 μM, lane 2: 2 μM, lane 3: 20 μM, lane 4: 200 μM, lane 5: 2 mM). The product of first round was 10 times serially diluted to fourth round and PS-THSP was performed for each round. ( B ) The flow chart shows that how the next generation sequencing data for PS-THSP products was analysed. ( C ) The four-way Venn diagram was prepared with the analysed NGS data for all the rounds.

    Journal: Nucleic Acids Research

    Article Title: Selection of self-priming molecular replicators

    doi: 10.1093/nar/gkz044

    Figure Lengend Snippet: High-throughput sequencing for PS-THSP products of random sequences with a serial dilution. ( A ) PS-THSP was performed with a PS-THSP probe 1 (100 nM) and different amount of dNTPs (M: 50 bp DNA ladder, lane 1: 0 μM, lane 2: 2 μM, lane 3: 20 μM, lane 4: 200 μM, lane 5: 2 mM). The product of first round was 10 times serially diluted to fourth round and PS-THSP was performed for each round. ( B ) The flow chart shows that how the next generation sequencing data for PS-THSP products was analysed. ( C ) The four-way Venn diagram was prepared with the analysed NGS data for all the rounds.

    Article Snippet: Bst 2.0 DNA polymerase and dNTPs (10 mM each) were purchased from New England Biolabs (NEB; Ipswitch, MA, USA).

    Techniques: Next-Generation Sequencing, Serial Dilution, Flow Cytometry

    PAGE electrophoresis of PEAR products. For dNTPs, lowercase letters (agct) represents natural dNTPs, and uppercase letters (AGCT) represents dNTPαSs. (A) PEAR products incorporating natural or dATPαS, dGTPαS, dCTPαS, dTTPαS: Lane 1: natural dNTPs; Lane 2: dATPαSs; Lane 3: No PspGI control; Lane 4: No Phusion DNA polymerase control; Lane 5: No dATP control; Lane 6∶10bp DNA ladder; Lane 7: dGTPαS; Lane 8: No PspGI control; Lane 9: No Phusion DNA polymerase control; Lane 10: No dCTP control; Lane 11: dCTPαSs; Lane 12: No PspGI control; Lane 13: No Phusion DNA polymerase control; Lane 14: No dCTP control; Lane 15: dTTPαSs; Lane 16: No PspGI control; Lane 17: No Phusion DNA polymerase control; Lane 18: No dTTP control; Lane 19∶10bp DNA ladder. (B) PEAR products incorporating one or two kind of dNTPαSs: Lane 1: natural dNTPs; Lane 2–5: one kind of dNTPαSs; Lane 6–8: two kind of dNTPαSs; Lane 9: No dNTPs control; Lane 10∶10bp DNA ladder; (C) Full digestion of PEAR products incorporating different dNTPs or dNTPαSs.

    Journal: PLoS ONE

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)

    doi: 10.1371/journal.pone.0067558

    Figure Lengend Snippet: PAGE electrophoresis of PEAR products. For dNTPs, lowercase letters (agct) represents natural dNTPs, and uppercase letters (AGCT) represents dNTPαSs. (A) PEAR products incorporating natural or dATPαS, dGTPαS, dCTPαS, dTTPαS: Lane 1: natural dNTPs; Lane 2: dATPαSs; Lane 3: No PspGI control; Lane 4: No Phusion DNA polymerase control; Lane 5: No dATP control; Lane 6∶10bp DNA ladder; Lane 7: dGTPαS; Lane 8: No PspGI control; Lane 9: No Phusion DNA polymerase control; Lane 10: No dCTP control; Lane 11: dCTPαSs; Lane 12: No PspGI control; Lane 13: No Phusion DNA polymerase control; Lane 14: No dCTP control; Lane 15: dTTPαSs; Lane 16: No PspGI control; Lane 17: No Phusion DNA polymerase control; Lane 18: No dTTP control; Lane 19∶10bp DNA ladder. (B) PEAR products incorporating one or two kind of dNTPαSs: Lane 1: natural dNTPs; Lane 2–5: one kind of dNTPαSs; Lane 6–8: two kind of dNTPαSs; Lane 9: No dNTPs control; Lane 10∶10bp DNA ladder; (C) Full digestion of PEAR products incorporating different dNTPs or dNTPαSs.

    Article Snippet: Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc .

    Techniques: Polyacrylamide Gel Electrophoresis, Electrophoresis