Structured Review

Roche dntpack
Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntpack/product/Roche
Average 99 stars, based on 46 article reviews
Price from $9.99 to $1999.99
dntpack - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: Paragraph title: Cloning ... Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ).

Article Title: Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents
Article Snippet: To further confirm that DV effects were not due to any single clone-specific irregularities, we also cloned DV into the vector pCepPu (provided by Maurizio Mongiat, Center for Cancer Research, Aviano, Italy) using the following primers: NHEI whole DV forward 5′-AGGCTAGCGATCAAGATCACCTTCCGGC-3′; XHOI HIS DV reverse 5′-AGCTCGAGCATGATGATGATGATGATGCGAGG-3′. .. The DV cDNA was amplified from HUVEC cDNA using a GC-rich PCR system and dNTPack (Roche Applied Science).

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Amplification:

Article Title: Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants
Article Snippet: We used the FastStart High Fidelity PCR System, dNTPack (Roche), which was also used in the Access Array, to assemble the reactions. .. We used the same thermal cycling protocol as the Access Array for the amplification.

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: .. Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ). .. PCR products were TA-cloned into the double IPTG inducible T7 RNA polymerase promoter vector pLitmus28i and their identity confirmed by sequencing.

Article Title: Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents
Article Snippet: .. The DV cDNA was amplified from HUVEC cDNA using a GC-rich PCR system and dNTPack (Roche Applied Science). .. Maxi-preps of DV DNA were transfected into 293FT (for pSecTag2A vector, ATCC) or 293 EBNA (for pCepPu vector) cells via Lipofectamine (Invitrogen).

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: Paragraph title: RT-PCR amplification for direct and deep sequencing. ... Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ).

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. ..

Article Title: Targeting CAG repeat RNAs reduces Huntington’s disease phenotype independently of huntingtin levels
Article Snippet: Equal amounts of RNA samples (1 μg) were treated with DNAse I (Ambion, Thermo Fisher Scientific), and 500 ng was reverse transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s protocol, and PCR was performed using the FastStart Taq DNA Polymerase, dNTPack (Roche). sCAGs were determined as previously described ( ). .. Then, PCR amplification was performed using primers recognizing the adapter and sCAG.

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Article Title: Transcriptional Reprogramming of Arabidopsis thaliana Defence Pathways by the Entomopathogen Beauveria bassiana Correlates With Resistance Against a Fungal Pathogen but Not Against Insects
Article Snippet: A total of 2 μg of DNase-treated RNA was then reverse-transcribed into the first-strand cDNA using SuperScript® III First-Strand Synthesis System (Invitrogen). cDNA synthesis was performed according to the manufacturer’s instructions, using Oligo dB 12-18 primer and including an RNase H digestion as a last step to remove RNA template from the cDNA:RNA hybrid molecule. qPCR was performed in triplicate from three biological replicates with a reaction mixture containing gene specific primers, cDNA template with a dilution value of 1:10, SYBR Green reagent, ROX Reference Dye to normalise the fluorescent reporter signal and the FastStartTM Taq DNA Polymerase, dNTPack (Roche). .. The thermal cycling conditions were 95°C for 10 min followed by 95°C for 15′′ , 60°C for 45′′ and 72°C for 45′′ for 40 cycles, followed by melting curve step at 95°C for 15′′ , 60°C for 1′ and 95°C for 15′′ to validate amplicon specificity.

Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

Article Title: Mutation status of RAD51C,PALB2 and BRIP1 in 100 Japanese familial breast cancer cases without BRCA1 and BRCA2 mutations
Article Snippet: .. PCR‐direct sequencing The genomic DNA was amplified by PCR with the Expand High Fidelity PCR System, dNTPack (Roche Diagnostics, Basel, Switzerland) following the manufacturer's protocol. .. The forward and reverse primers for RAD51C , BRIP1 and PALB2 were designed for amplification of all the coding sequences for each gene (Table ).

Article Title: Genomic Expression Libraries for the Identification of Cross-Reactive Orthopoxvirus Antigens
Article Snippet: .. For the amplification of long inserts (≥3 kb) the “Expand Long Range, dNTPack” (Roche Diagnostics GmbH, Mannheim, Germany) was used according to the manufacturer's instructions as a 25 µl reaction containing 3% DMSO. .. The amplification of shorter fragments was performed as a 25 µl reaction containing 1×PCR Buffer (Invitrogen), 4 mM MgCl2 , 100 µM dNTPs, 0.3 µM of each primer (T7 primer: gTAATACgACTCACTATAgggCg and T3 primer: ATTAACCCTCACTAAAgggA ), 1 unit of Platinum Taq DNA polymerase (Invitrogen), and about 50 ng of template DNA.

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: .. The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. The PCR reaction mixture contained 0.2 μM of each primer, 10 ng of template DNA, 5 μl of 10 × PCR reaction buffer, 200 μM of each deoxyribonucleotide triphosphate, 2.5 μL bovine serum albumin (New England Biolabs, Ipswich, MA) at 1 mg/mL (final concentration 100 μg/mL), 1.8 mM MgCl2 and 1.25 U of FastStart Hi-Fi enzyme blend in a total volume of 25 μL.

Picogreen Assay:

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. Prior to pyrosequencing, DNA concentration was measured with Quant-iT PicoGreen dsDNA Assay Kits (Life technologies, Grand Island, NY) and DNA quality was assessed using a 2100 Bioanalyzer (Agilent, Santa Clara, CA).

Construct:

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Electrophoresis:

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. ..

Article Title: Targeting CAG repeat RNAs reduces Huntington’s disease phenotype independently of huntingtin levels
Article Snippet: Equal amounts of RNA samples (1 μg) were treated with DNAse I (Ambion, Thermo Fisher Scientific), and 500 ng was reverse transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s protocol, and PCR was performed using the FastStart Taq DNA Polymerase, dNTPack (Roche). sCAGs were determined as previously described ( ). .. PCR products were resolved by electrophoresis in 2% agarose gels and quantified using ImageJ software (NIH).

Article Title: Transcriptional Reprogramming of Arabidopsis thaliana Defence Pathways by the Entomopathogen Beauveria bassiana Correlates With Resistance Against a Fungal Pathogen but Not Against Insects
Article Snippet: RNA quality check was performed by electrophoresis and photometrical measurement with the Nanodrop 2000 spectrophotometer (Thermo Scientific). .. A total of 2 μg of DNase-treated RNA was then reverse-transcribed into the first-strand cDNA using SuperScript® III First-Strand Synthesis System (Invitrogen). cDNA synthesis was performed according to the manufacturer’s instructions, using Oligo dB 12-18 primer and including an RNase H digestion as a last step to remove RNA template from the cDNA:RNA hybrid molecule. qPCR was performed in triplicate from three biological replicates with a reaction mixture containing gene specific primers, cDNA template with a dilution value of 1:10, SYBR Green reagent, ROX Reference Dye to normalise the fluorescent reporter signal and the FastStartTM Taq DNA Polymerase, dNTPack (Roche).

Incubation:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: Samples were homogenized in a MagNALyser Instrument (2 × 6000 rpm for 30 s, separated by 1 min cooling), treated with 25 μl lysozyme (Roth, Karlsruhe, Germany) at 37°C for 30 min, and then with 43.3 μl proteinase K (Roche) at 60°C for 1 h. Lysates were incubated at 95°C for 10 min, cooled on ice for 5 min, and centrifuged for 5 min at full speed. .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Article Title: Reduced Human Platelet Uptake by Pig Livers Deficient in the Asialoglycoprotein Receptor-1 Protein
Article Snippet: Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, IN) was used and PCR conditions were as follows: 94°C, 2 minutes; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds for 15 cycles; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds with 5 seconds added to each elongation for 25 cycles; and a final extension step of 72°C for 5 minutes. .. 1 µl of enhancer and 1 µl of Nuclease S (Transgenomic, Omaha, NE) was added to each reaction and incubated at 42°C for 40 minutes.

Cell Culture:

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ).

Real-time Polymerase Chain Reaction:

Article Title: Transcriptional Reprogramming of Arabidopsis thaliana Defence Pathways by the Entomopathogen Beauveria bassiana Correlates With Resistance Against a Fungal Pathogen but Not Against Insects
Article Snippet: .. A total of 2 μg of DNase-treated RNA was then reverse-transcribed into the first-strand cDNA using SuperScript® III First-Strand Synthesis System (Invitrogen). cDNA synthesis was performed according to the manufacturer’s instructions, using Oligo dB 12-18 primer and including an RNase H digestion as a last step to remove RNA template from the cDNA:RNA hybrid molecule. qPCR was performed in triplicate from three biological replicates with a reaction mixture containing gene specific primers, cDNA template with a dilution value of 1:10, SYBR Green reagent, ROX Reference Dye to normalise the fluorescent reporter signal and the FastStartTM Taq DNA Polymerase, dNTPack (Roche). .. The thermal cycling conditions were 95°C for 10 min followed by 95°C for 15′′ , 60°C for 45′′ and 72°C for 45′′ for 40 cycles, followed by melting curve step at 95°C for 15′′ , 60°C for 1′ and 95°C for 15′′ to validate amplicon specificity.

Derivative Assay:

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Transfection:

Article Title: Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents
Article Snippet: The DV cDNA was amplified from HUVEC cDNA using a GC-rich PCR system and dNTPack (Roche Applied Science). .. Maxi-preps of DV DNA were transfected into 293FT (for pSecTag2A vector, ATCC) or 293 EBNA (for pCepPu vector) cells via Lipofectamine (Invitrogen).

Sequencing:

Article Title: Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants
Article Snippet: Paragraph title: Library construction and sequencing ... We used the FastStart High Fidelity PCR System, dNTPack (Roche), which was also used in the Access Array, to assemble the reactions.

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ). .. PCR products were TA-cloned into the double IPTG inducible T7 RNA polymerase promoter vector pLitmus28i and their identity confirmed by sequencing.

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: Paragraph title: RT-PCR amplification for direct and deep sequencing. ... Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ).

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: A second internal or nested PCR amplifying a shorter fragment was performed to obtain sufficient DNA product for sequencing. .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel.

Article Title: A genome-wide association study reveals a locus for bilateral iridal hypopigmentation in Holstein Friesian cattle
Article Snippet: Paragraph title: Polymerase chain reaction (PCR) and sanger sequencing of RAB38 ... PCR was performed in a total volume of 25 μl using FastStart Taq DNA Polymerase, dNTPack (Roche Diagnostics, Mannheim, Germany).

Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
Article Snippet: Paragraph title: Sanger sequencing ... UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols.

Article Title: Mutation status of RAD51C,PALB2 and BRIP1 in 100 Japanese familial breast cancer cases without BRCA1 and BRCA2 mutations
Article Snippet: .. PCR‐direct sequencing The genomic DNA was amplified by PCR with the Expand High Fidelity PCR System, dNTPack (Roche Diagnostics, Basel, Switzerland) following the manufacturer's protocol. .. The forward and reverse primers for RAD51C , BRIP1 and PALB2 were designed for amplification of all the coding sequences for each gene (Table ).

Introduce:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C. .. Fifteen microliters of the normalized PCR product were used as template for indexing PCR in a 50 μl single reaction to introduce barcode sequences to each sample according to Kozich et al. ( ).

DNA Sequencing:

Article Title: Mutation status of RAD51C,PALB2 and BRIP1 in 100 Japanese familial breast cancer cases without BRCA1 and BRCA2 mutations
Article Snippet: PCR‐direct sequencing The genomic DNA was amplified by PCR with the Expand High Fidelity PCR System, dNTPack (Roche Diagnostics, Basel, Switzerland) following the manufacturer's protocol. .. DNA sequencing was performed by Eurofins DNA sequence service (Eurofins genomics, Tokyo, Japan).

Article Title: Genomic Expression Libraries for the Identification of Cross-Reactive Orthopoxvirus Antigens
Article Snippet: Paragraph title: PCR and DNA sequencing ... For the amplification of long inserts (≥3 kb) the “Expand Long Range, dNTPack” (Roche Diagnostics GmbH, Mannheim, Germany) was used according to the manufacturer's instructions as a 25 µl reaction containing 3% DMSO.

Reverse Transcription Polymerase Chain Reaction:

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: Paragraph title: RT-PCR amplification for direct and deep sequencing. ... Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ).

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: Reverse transcription and PCR (RT-PCR) were performed using the OneStep RT-PCR Transcriptor kit (Roche Applied Science, Basel, Switzerland). .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel.

Article Title: Targeting CAG repeat RNAs reduces Huntington’s disease phenotype independently of huntingtin levels
Article Snippet: Paragraph title: Semiquantitative RT-PCR of human HTT ... Equal amounts of RNA samples (1 μg) were treated with DNAse I (Ambion, Thermo Fisher Scientific), and 500 ng was reverse transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s protocol, and PCR was performed using the FastStart Taq DNA Polymerase, dNTPack (Roche). sCAGs were determined as previously described ( ).

DNA Extraction:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: Next-generation sequencing Total DNA was extracted from saliva samples using the MagNAPure LC DNA Isolation Kit III (Bacteria, Fungi) on the MagNA Pure Instrument (Roche, Rotkreuz, Switzerland). .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Mutagenesis:

Article Title: Reduced Human Platelet Uptake by Pig Livers Deficient in the Asialoglycoprotein Receptor-1 Protein
Article Snippet: Paragraph title: SURVEYOR Mutation Detection Assay (CEL I assay) ... Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, IN) was used and PCR conditions were as follows: 94°C, 2 minutes; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds for 15 cycles; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds with 5 seconds added to each elongation for 25 cycles; and a final extension step of 72°C for 5 minutes.

Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
Article Snippet: Sanger sequencing For mutation analysis of patient 4, UBE2A (ENSG00000077721) coding sequence and adjacent intronic sequences of the longest transcript (ENST00000371558) were taken from ENSEMBL genome browser ( http://www.ensembl.org/ ). .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols.

Isolation:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: DNA was isolated from 200 μl lysate supernatant by the MagNAPure Instrument using the manufacturer's software and eluted in 100 μl elution buffer. .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ).

Article Title: Genomic Expression Libraries for the Identification of Cross-Reactive Orthopoxvirus Antigens
Article Snippet: PCR and DNA sequencing The isolated pBK-CMV phagemid vectors were used as templates for PCR. .. For the amplification of long inserts (≥3 kb) the “Expand Long Range, dNTPack” (Roche Diagnostics GmbH, Mannheim, Germany) was used according to the manufacturer's instructions as a 25 µl reaction containing 3% DMSO.

Detection Assay:

Article Title: Reduced Human Platelet Uptake by Pig Livers Deficient in the Asialoglycoprotein Receptor-1 Protein
Article Snippet: Paragraph title: SURVEYOR Mutation Detection Assay (CEL I assay) ... Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, IN) was used and PCR conditions were as follows: 94°C, 2 minutes; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds for 15 cycles; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds with 5 seconds added to each elongation for 25 cycles; and a final extension step of 72°C for 5 minutes.

Size-exclusion Chromatography:

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. PCR was performed in a DNAEngine (Bio-Rad, Hercules, CA) under the following conditions: 94C for 3 min followed by 25 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min, and a final elongation step at 72°C for 7 min. After PCR, the amplicons from 3 separate reactions were pooled and purified using Agencourt AMPure XP according to manufacturer instructions (Beckman Coulter, Inc., Brea, CA).

Labeling:

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: Briefly, reverse transcription was performed using a Transcriptor One Step reverse RT-PCR kit (Roche Applied Science, Basel, Switzerland), 20 pmol of the downstream primer labeled 5Bo8707, and 20 pmol of the upstream primer labeled 5Bo8254 ( ). .. Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ).

Purification:

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. .. Size-specific expected bands were purified from agarose gel (Agarose MP, Roche Indianapolis, IN, USA) using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA) and quantified using Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA).

Article Title: A genome-wide association study reveals a locus for bilateral iridal hypopigmentation in Holstein Friesian cattle
Article Snippet: PCR was performed in a total volume of 25 μl using FastStart Taq DNA Polymerase, dNTPack (Roche Diagnostics, Mannheim, Germany). .. Cycling conditions were 95 °C for 10 min, followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. Final elongation step was 72 °C for 5 min. PCR products were sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Fisher Scientific GmbH, Schwerte, Germany) on an ABI PRISM 3130xl Genetic Analyzer (Life Technologies, Foster City, USA) after purification using Rapid PCR Cleanup Enzyme Set (New England Biolabs GmbH, Frankfurt am Main, Germany).

Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. PCR was performed in a DNAEngine (Bio-Rad, Hercules, CA) under the following conditions: 94C for 3 min followed by 25 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min, and a final elongation step at 72°C for 7 min. After PCR, the amplicons from 3 separate reactions were pooled and purified using Agencourt AMPure XP according to manufacturer instructions (Beckman Coulter, Inc., Brea, CA).

Polymerase Chain Reaction:

Article Title: Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants
Article Snippet: .. We used the FastStart High Fidelity PCR System, dNTPack (Roche), which was also used in the Access Array, to assemble the reactions. ..

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C. .. Triplicates were pooled, checked on a 1% agarose gel, and 15 μl of pooled PCR product were normalized according to manufacturer's instructions on a SequalPrep Normalization Plate (Life Technologies, Vienna, Austria).

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: .. Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ). .. PCR products were TA-cloned into the double IPTG inducible T7 RNA polymerase promoter vector pLitmus28i and their identity confirmed by sequencing.

Article Title: Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents
Article Snippet: .. The DV cDNA was amplified from HUVEC cDNA using a GC-rich PCR system and dNTPack (Roche Applied Science). .. Maxi-preps of DV DNA were transfected into 293FT (for pSecTag2A vector, ATCC) or 293 EBNA (for pCepPu vector) cells via Lipofectamine (Invitrogen).

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: .. Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ). ..

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. ..

Article Title: Targeting CAG repeat RNAs reduces Huntington’s disease phenotype independently of huntingtin levels
Article Snippet: .. Equal amounts of RNA samples (1 μg) were treated with DNAse I (Ambion, Thermo Fisher Scientific), and 500 ng was reverse transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s protocol, and PCR was performed using the FastStart Taq DNA Polymerase, dNTPack (Roche). sCAGs were determined as previously described ( ). ..

Article Title: A genome-wide association study reveals a locus for bilateral iridal hypopigmentation in Holstein Friesian cattle
Article Snippet: .. PCR was performed in a total volume of 25 μl using FastStart Taq DNA Polymerase, dNTPack (Roche Diagnostics, Mannheim, Germany). .. One reaction mix (25 μl) included 1.5 U Faststart Taq DNA Polymerase, 200 μmol/L dNTP, 0.4 μmol/L of each primer, 1× PCR reaction buffer (including 20 mM MgCl2 ), 1× Q-Solution (Qiagen, Hilden, Germany) and 40 ng of DNA.

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Article Title: Reduced Human Platelet Uptake by Pig Livers Deficient in the Asialoglycoprotein Receptor-1 Protein
Article Snippet: .. Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, IN) was used and PCR conditions were as follows: 94°C, 2 minutes; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds for 15 cycles; 94°C, 15 seconds, 60°C, 30 seconds and 72°C, 50 seconds with 5 seconds added to each elongation for 25 cycles; and a final extension step of 72°C for 5 minutes. ..

Article Title: Mutation status of RAD51C,PALB2 and BRIP1 in 100 Japanese familial breast cancer cases without BRCA1 and BRCA2 mutations
Article Snippet: .. PCR‐direct sequencing The genomic DNA was amplified by PCR with the Expand High Fidelity PCR System, dNTPack (Roche Diagnostics, Basel, Switzerland) following the manufacturer's protocol. .. The forward and reverse primers for RAD51C , BRIP1 and PALB2 were designed for amplification of all the coding sequences for each gene (Table ).

Article Title: Genomic Expression Libraries for the Identification of Cross-Reactive Orthopoxvirus Antigens
Article Snippet: Paragraph title: PCR and DNA sequencing ... For the amplification of long inserts (≥3 kb) the “Expand Long Range, dNTPack” (Roche Diagnostics GmbH, Mannheim, Germany) was used according to the manufacturer's instructions as a 25 µl reaction containing 3% DMSO.

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: .. The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. The PCR reaction mixture contained 0.2 μM of each primer, 10 ng of template DNA, 5 μl of 10 × PCR reaction buffer, 200 μM of each deoxyribonucleotide triphosphate, 2.5 μL bovine serum albumin (New England Biolabs, Ipswich, MA) at 1 mg/mL (final concentration 100 μg/mL), 1.8 mM MgCl2 and 1.25 U of FastStart Hi-Fi enzyme blend in a total volume of 25 μL.

Gel Extraction:

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. .. Size-specific expected bands were purified from agarose gel (Agarose MP, Roche Indianapolis, IN, USA) using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA) and quantified using Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA).

Nested PCR:

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. ..

Plasmid Preparation:

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ). .. PCR products were TA-cloned into the double IPTG inducible T7 RNA polymerase promoter vector pLitmus28i and their identity confirmed by sequencing.

Article Title: Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents
Article Snippet: To further confirm that DV effects were not due to any single clone-specific irregularities, we also cloned DV into the vector pCepPu (provided by Maurizio Mongiat, Center for Cancer Research, Aviano, Italy) using the following primers: NHEI whole DV forward 5′-AGGCTAGCGATCAAGATCACCTTCCGGC-3′; XHOI HIS DV reverse 5′-AGCTCGAGCATGATGATGATGATGATGCGAGG-3′. .. The DV cDNA was amplified from HUVEC cDNA using a GC-rich PCR system and dNTPack (Roche Applied Science).

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

Software:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: DNA was isolated from 200 μl lysate supernatant by the MagNAPure Instrument using the manufacturer's software and eluted in 100 μl elution buffer. .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Article Title: Targeting CAG repeat RNAs reduces Huntington’s disease phenotype independently of huntingtin levels
Article Snippet: Equal amounts of RNA samples (1 μg) were treated with DNAse I (Ambion, Thermo Fisher Scientific), and 500 ng was reverse transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s protocol, and PCR was performed using the FastStart Taq DNA Polymerase, dNTPack (Roche). sCAGs were determined as previously described ( ). .. PCR products were resolved by electrophoresis in 2% agarose gels and quantified using ImageJ software (NIH).

Article Title: A genome-wide association study reveals a locus for bilateral iridal hypopigmentation in Holstein Friesian cattle
Article Snippet: Polymerase chain reaction (PCR) and sanger sequencing of RAB38 RAB38 primers were designed using the online software tool Primer-Blast [ ] with the following sequences RAB38_Ex1_F: 5’-CTTCCCGGGTCCGCAG-3’, RAB38_Ex1_R: 5’-CTGGCACAGGAGATGGTCTG-3’, RAB38_Ex2_F: 5’-ACTTTGCGGAGTGATCTGCT-3’, RAB38_Ex2_R: 5’-GCTGCCTTAGCCACAAACAC-3’, RAB38_Ex3_F: 5’-CATGGGACAGGGTTTAGAAAGAGA-3’, RAB38_Ex3_R: 5’-AGGCATAGGTCTTTGGCTTG-3’. .. PCR was performed in a total volume of 25 μl using FastStart Taq DNA Polymerase, dNTPack (Roche Diagnostics, Mannheim, Germany).

Article Title: Mutation status of RAD51C,PALB2 and BRIP1 in 100 Japanese familial breast cancer cases without BRCA1 and BRCA2 mutations
Article Snippet: PCR‐direct sequencing The genomic DNA was amplified by PCR with the Expand High Fidelity PCR System, dNTPack (Roche Diagnostics, Basel, Switzerland) following the manufacturer's protocol. .. The DNA chromatogram was aligned to the National Center for Biotechnology Information (NCBI) reference sequence (RefSeq) for RAD51C (NM_058216.1), PALB2 (NM_024675.3) and BRIP1 (NM_032043.2) by SeqScape Software 3 (ver.

SYBR Green Assay:

Article Title: Transcriptional Reprogramming of Arabidopsis thaliana Defence Pathways by the Entomopathogen Beauveria bassiana Correlates With Resistance Against a Fungal Pathogen but Not Against Insects
Article Snippet: .. A total of 2 μg of DNase-treated RNA was then reverse-transcribed into the first-strand cDNA using SuperScript® III First-Strand Synthesis System (Invitrogen). cDNA synthesis was performed according to the manufacturer’s instructions, using Oligo dB 12-18 primer and including an RNase H digestion as a last step to remove RNA template from the cDNA:RNA hybrid molecule. qPCR was performed in triplicate from three biological replicates with a reaction mixture containing gene specific primers, cDNA template with a dilution value of 1:10, SYBR Green reagent, ROX Reference Dye to normalise the fluorescent reporter signal and the FastStartTM Taq DNA Polymerase, dNTPack (Roche). .. The thermal cycling conditions were 95°C for 10 min followed by 95°C for 15′′ , 60°C for 45′′ and 72°C for 45′′ for 40 cycles, followed by melting curve step at 95°C for 15′′ , 60°C for 1′ and 95°C for 15′′ to validate amplicon specificity.

Multiplex Assay:

Article Title: High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods
Article Snippet: Heminested PCR was performed using a FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Basel, Switzerland), 5 μl from the PCR, and a pair of upstream (13N5Bo8254) and downstream (13N5Bo8641) primers ( ). .. To identify every patient, the final product of heminested amplification was subjected to 15 cycles of reamplification using primers composed of a complementary universal M13 primer (either upstream or downstream) followed by a Roche's Validated Multiplex IDentifier (MID) with oligonucleotide A or B at the 5′ or 3′ end of the upstream or downstream primer, respectively ( ).

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: Each forward primer (from 5′ to 3′) included: GS FLX Titanium Primer A (CCATCTCATCCCTGCGTGTCTCCGACTCAG), a Multiplex Identifier that was unique to each sample, and 27F-DegS ( ). .. The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification.

Agarose Gel Electrophoresis:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C. .. Triplicates were pooled, checked on a 1% agarose gel, and 15 μl of pooled PCR product were normalized according to manufacturer's instructions on a SequalPrep Normalization Plate (Life Technologies, Vienna, Austria).

Article Title: Baseline hepatitis C virus resistance-associated substitutions present at frequencies lower than 15% may be clinically significant
Article Snippet: .. This nested PCR used the FastStart High Fidelity PCR system, dNTPack (Roche Applied Science), with a previously described protocol.56 Amplification products were analyzed by electrophoresis on 2% agarose gel. ..

In Vitro:

Article Title: Establishing RNAi in a Non-Model Organism: The Antarctic Nematode Panagrolaimus sp. DAW1
Article Snippet: Target genes were PCR amplified from cDNA with gene specific primers using the Taq DNA Polymerase, dNTPack (Roche, Basel, Switzerland) (Table A in ). .. Plasmids with a perfect sequence match were either re-transformed into the E . coli HT115 feeding strain for RNAi-feeding or linearized using M13 PCR for in vitro transcription and RNAi-soaking.

Transgenic Assay:

Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
Article Snippet: Paragraph title: Amphioxus (B. f loridae ) Transgenic Experiment ... The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ).

Next-Generation Sequencing:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: Paragraph title: Next-generation sequencing ... A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Spectrophotometry:

Article Title: Transcriptional Reprogramming of Arabidopsis thaliana Defence Pathways by the Entomopathogen Beauveria bassiana Correlates With Resistance Against a Fungal Pathogen but Not Against Insects
Article Snippet: RNA quality check was performed by electrophoresis and photometrical measurement with the Nanodrop 2000 spectrophotometer (Thermo Scientific). .. A total of 2 μg of DNase-treated RNA was then reverse-transcribed into the first-strand cDNA using SuperScript® III First-Strand Synthesis System (Invitrogen). cDNA synthesis was performed according to the manufacturer’s instructions, using Oligo dB 12-18 primer and including an RNase H digestion as a last step to remove RNA template from the cDNA:RNA hybrid molecule. qPCR was performed in triplicate from three biological replicates with a reaction mixture containing gene specific primers, cDNA template with a dilution value of 1:10, SYBR Green reagent, ROX Reference Dye to normalise the fluorescent reporter signal and the FastStartTM Taq DNA Polymerase, dNTPack (Roche).

Concentration Assay:

Article Title: Fecal Microbiota Composition of Breast-fed Infants is Correlated with Human Milk Oligosaccharides Consumed
Article Snippet: The FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Indianapolis, IN) was used for PCR amplification. .. The PCR reaction mixture contained 0.2 μM of each primer, 10 ng of template DNA, 5 μl of 10 × PCR reaction buffer, 200 μM of each deoxyribonucleotide triphosphate, 2.5 μL bovine serum albumin (New England Biolabs, Ipswich, MA) at 1 mg/mL (final concentration 100 μg/mL), 1.8 mM MgCl2 and 1.25 U of FastStart Hi-Fi enzyme blend in a total volume of 25 μL.

Lysis:

Article Title: The Salivary Microbiome in Polycystic Ovary Syndrome (PCOS) and Its Association with Disease-Related Parameters: A Pilot Study
Article Snippet: Saliva was thawed, vortexed, and 250 μl saliva was added to 250 μl bacteria lysis buffer in a sample tube containing MagNALyser Green Beads (1.4 mm diameter ceramic beads, Roche). .. A PCR reaction was performed to amplify the V1-2 region of the bacterial 16S rRNA gene using the primers F27 (AGAGTTTGATCCTGGCTCAG) and R357 (CTGCTGCCTYCCGTA; Eurofins Genomics, Ebersberg, Germany) and the FastStart High Fidelity PCR System, dNTPack (Roche) with initial denaturation at 95°C for 3 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, one cycle of final extension at 72°C for 7 min, and a final cooling step to 10°C.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche dntpack
    Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntpack/product/Roche
    Average 99 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    dntpack - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    81
    Roche long range dntpack
    Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range dntpack/product/Roche
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    long range dntpack - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    96
    Roche expand long range dntpack kit
    Expand Long Range Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack kit/product/Roche
    Average 96 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack kit - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    Image Search Results