dntpack pcr amplification kit  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche dntpack pcr amplification kit
    Dntpack Pcr Amplification Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntpack pcr amplification kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntpack pcr amplification kit - by Bioz Stars, 2021-06
    86/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy
    Article Snippet: .. PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche). ..

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa
    Article Snippet: PCR analysis of genomic DNA Genomic DNA of transduced keratinocytes was isolated using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. .. For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol. ..

    Article Title: Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans
    Article Snippet: .. Mapping full-length K222 A full-length proviral genome of K222 was amplified from human H9 and HUT78 cell lines and some human DNA samples, in which the centromeric K111 5′ end was not detected using the Expand Long Range dNTPack PCR kit (Roche Applied Science). .. PCR reactions contained 50 ng genomic DNA, 2.5 mM MgCl2 , 500 μM dNTPs, 300 nM of each primer, and 3.5 units of Expand Long Range Enzyme Mix.

    Article Title: HIV infection reveals widespread expansion of novel centromeric human endogenous retroviruses
    Article Snippet: ChIP assays to assess the association of centromeric proteins and heterochromatic marks with K111 were performed using antibodies to the centromere proteins CENPA and CENPB and the heterochromatic histone mark H3K9me3 or with nonspecific IgG antibodies, while assays to assess the effect of Tat on chromatin were performed with antibodies to the heterochromatic marks H3K9me3 and H4K20me3 (for additional information, see Supplemental Material). .. The K111-related variants inserted in New and Old World monkeys, humans, and human/rodent chromosomal somatic hybrid DNA were amplified by PCR using the Expand Long Range dNTPack PCR kit (Roche Applied Science). ..

    Amplification:

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy
    Article Snippet: .. PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche). ..

    Article Title: Next generation sequencing and comparative analyses of Xenopus mitogenomes
    Article Snippet: DNA pellets were recovered from the ethanol via centrifugation (as above), air-dried and resuspended in 100 ul of nuclease-free water by heating for 1 h at 65°C. .. Long-PCR amplification of two mitochondrial genome regions The complete mitochondrial genome of each Xenopus species was amplified by long-PCR as two amplicons (1: ~7,961bp, containing the rrnL and cox1 genes and 2: ~9,649bp) using the Expand Long Range dNTPack kit (Roche). .. Each (50 μL) PCR contained 10 ng total DNA; 2 x buffer, 2.5 mM MgCl2, 0.5 μM each dNTP, 0.3 μM each of primers Long F1 and R2 (Amplicon 1) or Long F2 and R1 (Amplicon 2; Table and Figure ), 1.4% (v/v) DMSO and 0.7 μl of enzyme mix and was run on a GeneAmp® PCR system 9700 at 92°C for 2 min; 10 cycles at 92°C for 10 s, 55°C for 15 s, 68°C for 10 min; 20 cycles at 92°C for 10 s, 55°C for 15 s, 68°C for 10 min + 10 s per cycle; followed by 68°C for 7 min. Amplicons were resolved on 1% (w/v) agarose gels at 100V for 1 h, purified using the QIAquick® PCR purification Kit (QIAGEN, Hilden, Germany) and quantified using the Quant-iT™ PicoGreen® dsDNA assay Kit (Invitrogen) and a Spectramax microplate reader; Molecular Devices Ltd, Wokingham, UK).

    Article Title: Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans
    Article Snippet: .. Mapping full-length K222 A full-length proviral genome of K222 was amplified from human H9 and HUT78 cell lines and some human DNA samples, in which the centromeric K111 5′ end was not detected using the Expand Long Range dNTPack PCR kit (Roche Applied Science). .. PCR reactions contained 50 ng genomic DNA, 2.5 mM MgCl2 , 500 μM dNTPs, 300 nM of each primer, and 3.5 units of Expand Long Range Enzyme Mix.

    Article Title: Expanding the Host Range of Hepatitis C Virus through Viral Adaptation
    Article Snippet: HCV genome sequencing. .. Serum samples from mice inoculated with Jc1/mCD81 were subjected to RNA purification (high pure viral RNA kit; Roche, Basel, Switzerland) and cDNA amplification (Transcriptor high-fidelity cDNA synthesis kit; Roche, Basel, Switzerland) with an antisense primer situated on the NS2 gene. cDNA content was determined by qRT-PCR. .. For amplicon library preparation, six contigs which covered the signal peptide genes of E1, E2, and p7 (amino acids 131 to 813, corresponding to the polyprotein sequence of the reference strain Jc1) were generated with the Expand Long Range dNTPack kit (Roche, Basel, Switzerland) by nested PCR utilizing 12 primers tagged at the 5′ end.

    Article Title: HIV infection reveals widespread expansion of novel centromeric human endogenous retroviruses
    Article Snippet: ChIP assays to assess the association of centromeric proteins and heterochromatic marks with K111 were performed using antibodies to the centromere proteins CENPA and CENPB and the heterochromatic histone mark H3K9me3 or with nonspecific IgG antibodies, while assays to assess the effect of Tat on chromatin were performed with antibodies to the heterochromatic marks H3K9me3 and H4K20me3 (for additional information, see Supplemental Material). .. The K111-related variants inserted in New and Old World monkeys, humans, and human/rodent chromosomal somatic hybrid DNA were amplified by PCR using the Expand Long Range dNTPack PCR kit (Roche Applied Science). ..

    Mouse Assay:

    Article Title: Expanding the Host Range of Hepatitis C Virus through Viral Adaptation
    Article Snippet: HCV genome sequencing. .. Serum samples from mice inoculated with Jc1/mCD81 were subjected to RNA purification (high pure viral RNA kit; Roche, Basel, Switzerland) and cDNA amplification (Transcriptor high-fidelity cDNA synthesis kit; Roche, Basel, Switzerland) with an antisense primer situated on the NS2 gene. cDNA content was determined by qRT-PCR. .. For amplicon library preparation, six contigs which covered the signal peptide genes of E1, E2, and p7 (amino acids 131 to 813, corresponding to the polyprotein sequence of the reference strain Jc1) were generated with the Expand Long Range dNTPack kit (Roche, Basel, Switzerland) by nested PCR utilizing 12 primers tagged at the 5′ end.

    Purification:

    Article Title: Expanding the Host Range of Hepatitis C Virus through Viral Adaptation
    Article Snippet: HCV genome sequencing. .. Serum samples from mice inoculated with Jc1/mCD81 were subjected to RNA purification (high pure viral RNA kit; Roche, Basel, Switzerland) and cDNA amplification (Transcriptor high-fidelity cDNA synthesis kit; Roche, Basel, Switzerland) with an antisense primer situated on the NS2 gene. cDNA content was determined by qRT-PCR. .. For amplicon library preparation, six contigs which covered the signal peptide genes of E1, E2, and p7 (amino acids 131 to 813, corresponding to the polyprotein sequence of the reference strain Jc1) were generated with the Expand Long Range dNTPack kit (Roche, Basel, Switzerland) by nested PCR utilizing 12 primers tagged at the 5′ end.

    Quantitative RT-PCR:

    Article Title: Expanding the Host Range of Hepatitis C Virus through Viral Adaptation
    Article Snippet: HCV genome sequencing. .. Serum samples from mice inoculated with Jc1/mCD81 were subjected to RNA purification (high pure viral RNA kit; Roche, Basel, Switzerland) and cDNA amplification (Transcriptor high-fidelity cDNA synthesis kit; Roche, Basel, Switzerland) with an antisense primer situated on the NS2 gene. cDNA content was determined by qRT-PCR. .. For amplicon library preparation, six contigs which covered the signal peptide genes of E1, E2, and p7 (amino acids 131 to 813, corresponding to the polyprotein sequence of the reference strain Jc1) were generated with the Expand Long Range dNTPack kit (Roche, Basel, Switzerland) by nested PCR utilizing 12 primers tagged at the 5′ end.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche expand long template pcr system kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Template Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr system kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr system kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    86
    Roche expand long range dntpack kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Range Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    86
    Roche dntpack kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntpack kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Journal: BioMed Research International

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    doi: 10.1155/2014/256245

    Figure Lengend Snippet: Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Article Snippet: PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche).

    Techniques: Polymerase Chain Reaction, Marker