dntp  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    dNTP Mix 10 mM each
    Description:

    Catalog Number:
    #R0191
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher dntp
    Amplification of local Alexandrium strains ACC01, ACC02 and ACC07 using species - specific primers; A. tamarense (lanes 1, 2 and 3) and A. catenella (lanes 4, 5 and 6). M = 100-bp <t>DNA</t> size marker. Species-specific amplification in the rDNA region using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each <t>dNTP,</t> 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller™ 100-bp DNA ladder was used for size estimation of amplified fragments.

    https://www.bioz.com/result/dntp/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    mgcl2
    kapa taq polymerase
    kapa taq buffer

    Images

    1) Product Images from "Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline"

    Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline

    Journal: AoB Plants

    doi: 10.1093/aobpla/pls033

    Amplification of local Alexandrium strains ACC01, ACC02 and ACC07 using species - specific primers; A. tamarense (lanes 1, 2 and 3) and A. catenella (lanes 4, 5 and 6). M = 100-bp DNA size marker. Species-specific amplification in the rDNA region using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller™ 100-bp DNA ladder was used for size estimation of amplified fragments.
    Figure Legend Snippet: Amplification of local Alexandrium strains ACC01, ACC02 and ACC07 using species - specific primers; A. tamarense (lanes 1, 2 and 3) and A. catenella (lanes 4, 5 and 6). M = 100-bp DNA size marker. Species-specific amplification in the rDNA region using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller™ 100-bp DNA ladder was used for size estimation of amplified fragments.

    Techniques Used: Amplification, Marker, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Alexandrium tamarense microsatellite amplifications of the three local strains with (A) specific primers ATB8 (lanes 1, 2 and 3) and ATD8 (lanes 4, 5 and 6). Lanes 7 and 8 correspond to controls with primers ATB8 without DNA. (B) Specific amplification with primers ATB1 (lanes 1, 2 and 3) and ATF11 (lanes 6, 7 and 8). Lanes 4–5 and 9–10 are controls without DNA for primer sets ATB1 and ATF11, respectively. M = 100-bp DNA size marker. Species-specific microsatellite amplifications using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller TM 100-bp DNA ladder was used for size estimation of amplified fragments.
    Figure Legend Snippet: Alexandrium tamarense microsatellite amplifications of the three local strains with (A) specific primers ATB8 (lanes 1, 2 and 3) and ATD8 (lanes 4, 5 and 6). Lanes 7 and 8 correspond to controls with primers ATB8 without DNA. (B) Specific amplification with primers ATB1 (lanes 1, 2 and 3) and ATF11 (lanes 6, 7 and 8). Lanes 4–5 and 9–10 are controls without DNA for primer sets ATB1 and ATF11, respectively. M = 100-bp DNA size marker. Species-specific microsatellite amplifications using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller TM 100-bp DNA ladder was used for size estimation of amplified fragments.

    Techniques Used: Amplification, Marker, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    2) Product Images from "Oxidative guanine base damage regulates human telomerase activity"

    Article Title: Oxidative guanine base damage regulates human telomerase activity

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.3319

    Telomerase elongation of primers with a terminal 8-oxoG. ( a ) Telomerase reactions were conducted using primers containing three (3R) or four (4R) TTAGGG repeats, with a 3′ terminal G or 8-oxoG ( Supplementary Table 1 , oligos #3, 4, 6 and 7). Reactions contained high (lanes 1 – 4) or cellular (lanes 5 – 8) dNTP concentrations and 0.3 μM 32 P-α-dGTP. Telomerase products were separated on denaturing gels. The LC was 32 P end-labeled 36-mer oligonucleotide. Arrow points to a product from degraded primer. Numbers with plus sign indicate number of added repeats. ( b ) and ( c ) Products were normalized to the LC and used to calculate processivity and relative activity. Bars represent the mean ± sd from three independent reactions. ** p
    Figure Legend Snippet: Telomerase elongation of primers with a terminal 8-oxoG. ( a ) Telomerase reactions were conducted using primers containing three (3R) or four (4R) TTAGGG repeats, with a 3′ terminal G or 8-oxoG ( Supplementary Table 1 , oligos #3, 4, 6 and 7). Reactions contained high (lanes 1 – 4) or cellular (lanes 5 – 8) dNTP concentrations and 0.3 μM 32 P-α-dGTP. Telomerase products were separated on denaturing gels. The LC was 32 P end-labeled 36-mer oligonucleotide. Arrow points to a product from degraded primer. Numbers with plus sign indicate number of added repeats. ( b ) and ( c ) Products were normalized to the LC and used to calculate processivity and relative activity. Bars represent the mean ± sd from three independent reactions. ** p

    Techniques Used: Liquid Chromatography, Labeling, Activity Assay

    8-oxoG restores telomerase activity on quadruplex folded overhangs ( a ) Telomerase reactions were conducted using primers containing three (3R) or four (4R) TTAGGG repeats, with a middle G or 8-oxoG in the terminal repeat ( Supplementary Table 1 , oligos #3, 5, 6 and 8). Reactions contained high (lanes 1–4) or cellular (lanes 5–8) dNTP concentrations and 0.3 μM 32 P-α-dGTP. Products were separated on denaturing gels. The LC was a 32 P end-labeled 36-mer oligonucleotide. Numbers with plus sign indicate number of added repeats. ( b ) and ( c ) Products were normalized to the LC, and used to calculate processivity ( b ) and relative activity ( c ). Bars represent the mean ± sd from three independent reactions. * p
    Figure Legend Snippet: 8-oxoG restores telomerase activity on quadruplex folded overhangs ( a ) Telomerase reactions were conducted using primers containing three (3R) or four (4R) TTAGGG repeats, with a middle G or 8-oxoG in the terminal repeat ( Supplementary Table 1 , oligos #3, 5, 6 and 8). Reactions contained high (lanes 1–4) or cellular (lanes 5–8) dNTP concentrations and 0.3 μM 32 P-α-dGTP. Products were separated on denaturing gels. The LC was a 32 P end-labeled 36-mer oligonucleotide. Numbers with plus sign indicate number of added repeats. ( b ) and ( c ) Products were normalized to the LC, and used to calculate processivity ( b ) and relative activity ( c ). Bars represent the mean ± sd from three independent reactions. * p

    Techniques Used: Activity Assay, Liquid Chromatography, Labeling

    Related Articles

    Centrifugation:

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: Following addition of 50 μl 3 M sodium acetate and 1 ml 100 % ethanol to 500 μl of supernatant, RNA was precipitated at −80 °C for 1 h, recovered by centrifugation at 14,000 rpm for 5 min, dried and dissolved in 200 µl RNAse-free water, and precipitated by addition of 200 µl 4 M LiCl overnight at 4 °C. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively.

    Amplification:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: To facilitate oral microbiome studies in murine models, we have developed protocols for sampling of oral microbial communities, processing of low biomass murine oral microbiome samples, 16S rRNA gene sequencing and analysis of relevant data. .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Additionally, both forward and reverse primers need to include 5′ and 3′ linker sequences, heterogeneity spacers and the desired index identifier sequences that will allow dual indexing for later sample identification.

    Article Title: Persisting PET-CT lesion activity and M. tuberculosis mRNA after pulmonary tuberculosis cure
    Article Snippet: The protocol below consists of three parts: 1) First strand cDNA synthesis and Controlled Multiplex Pre-Amplification of cDNAs; 2) Preparation of Primer and Probe Sets; and 3) Individual qRT-PCR (Taqman) quantification of Amplified cDNAs using LightCycler480. .. To each sample, 0.5 μl Exo-resistant Random Primer (Fermentas S0181), 1 μl 10mM dNTPs (Fermentas R0193) and 3.5 μl Nuclease Free Water (Ambion AM9938) were added for a total of 10 μl.

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Article Title: The effect of the SIRT1 2827 A > G polymorphism, resveratrol, exercise, age and occupation in Turkish population with cardiovascular disease
    Article Snippet: 100 ng genomic DNA in 25 µL reaction mixture containing 2.5 µL 10 X PCR buffer (Thermo Scientific, # B33), 200 µM dNTP (Thermo Scientific, # R0191), 10 pM each of primers, and 5 Unit (U) of Taq DNA polymerase (Thermoscientific, # EP0701) was used. .. Optimal amplification of heat cycles in the PCR reaction were determined as 3 minutes at 98°C for a frontal denaturation, 45 seconds at 95°C for denaturation, 30 seconds at 65°C for an adhesion, 30 seconds at 72°C for synthesis, and 5 minutes for a total of 30 cycles and final synthesis at 72°C.

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: Paragraph title: Amplification of Plasmodium DNA ... This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    Article Title: A simple and efficient method for isolating polymorphic microsatellites from cDNA
    Article Snippet: DNA sequences of the polymophic microsatellites were deposited in GenBank with the accession numbers: EF210110 – EF210125 and FJ535708 – FJ535732 . .. PCR amplification of microsatellites was performed on a PTC-100 thermal cycler in a 25 μl reaction volume containing 100 ng DNA, 1 × PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 and 0.1% Triton-X 100], 200 nM of each primer, 50 μM of each dNTP and one unit DNA polymerase (Finnzymes). .. Cycling conditions were: 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s, with a final extension at 72°C for 5 min. Fluorescence-based genotyping of 24 unrelated Asian seabass individuals originated from Southeast Asia and Australia was conducted using an automated DNA sequencer ABI 3730xl (Applied Biosystems).

    Article Title: Surveillance of pyrazinamide susceptibility among multidrug-resistant Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand
    Article Snippet: Paragraph title: Amplification and sequencing of the amplified pncA gene ... PCR was performed in a total volume of 50 μl, and the PCR reaction mixture consisted of 0.25 mM dNTP (Fermentas, CA, USA), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.0 mM MgCl2 , 20 pmol of each primer, 1 unit of Taq DNA polymerase (Fermentas, CA, USA) and 5 μl of crude DNA.

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Amplification reactions were performed in triplicate and a negative control (without template) was included in all runs. .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Article Title: Cytokine Modulation of AD Filaggrin Skin Expression
    Article Snippet: One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen). .. One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen).

    Whole Genome Amplification:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: Wear gloves and a lab coat when handle it. .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) ! .. CRITICAL It is crucial that anti-islet1 antibody from this supplier is used rather than an alternative.

    Expressing:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: Expression of RET mRNA in DRGs of animals with SNL after receiving vehicle, BT13 and ARTN was analyzed by qPCR. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    Article Title: Persisting PET-CT lesion activity and M. tuberculosis mRNA after pulmonary tuberculosis cure
    Article Snippet: Genome Expression Profiling of MTB was performed using Two-Step Multiplex RT-PCR. .. To each sample, 0.5 μl Exo-resistant Random Primer (Fermentas S0181), 1 μl 10mM dNTPs (Fermentas R0193) and 3.5 μl Nuclease Free Water (Ambion AM9938) were added for a total of 10 μl.

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Paragraph title: Gene Expression Study by RT-PCR ... PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively. .. Quantitative real-time PCR (qPCR) amplification of first strand cDNA templates from a variety of plant organs and the subsequent quantification of SGR and SGRL products was carried out, essentially under conditions described (Hellens et al. ; Chinoy et al. ), and using pea actin as a reference gene (Cooper et al. ).

    Article Title: Loss of Oct4 expression during the development of murine embryoid bodies
    Article Snippet: Genomic DNA was removed from RNA by DNase (Promega) treatment for 1 hour at 37°C. cDNA was generated by reverse transcription from 2 g total RNA using SuperScript III Reverse Transcriptase, oligo(dT)20 and dNTP (10 mM) (Invitrogen). .. Generated cDNA was validated by a 30-cycle PCR beta-actin reaction.

    Article Title: Cytokine Modulation of AD Filaggrin Skin Expression
    Article Snippet: One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen). .. One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen).

    Positive Control:

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. A polymerase chain reaction (PCR) was performed using polymerase Ex Taq (Takara Bio Inc, Shiga, Japan) with Gene Amp PCR system 9700 (Life Technologies, CA).

    Synthesized:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: RNA concentration was measured with NanoDrop (ND 1000, Thermo Scientific, USA). cDNA was synthesized by Maxima H minus reverse transcriptase (Cat# EP0751, Thermo Scientific, USA) as described by the manufacturer in a total volume 20 μl. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Cultures of SK1 were grown or sporulated as described in . .. Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013). .. After the RNA and primers were denatured for 10 min at 70°C, the remaining reagents were added, and the reaction was incubated at 42°C for 60 min. To remove the RNA template 2 units of RNase H were then added and the mix was incubated at 37°C for 20 min and then at 95°C for 5 min. Quality of total RNA and cRNA was monitored using RNA Nano 6000 chips processed using the 2100 BioAnalyzer (Agilent).

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: Total RNA was isolated from surgically resected tissues using AllPrep DNA/RNA/Protein Mini Kit (catalog number 80004, Qiagen, GmbH, Hilden, Germany). .. First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. After 5 minutes at 65 °C, then 2 minutes on ice, this was mixed with a volume of 15 μL reagent of SuperScript III kit (catalog number 18080–044, Life technologies, Carlsbad, CA).

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: Buffer RLT (Qiagen, cat. no. 79216) 2-Mercaptoethanol (Sigma-Aldrich, cat. no. M3148) ▲ CRITICAL It should be dedicated for RNA work only. .. HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility) .. Paraformaldehyde (Electron Microscopy Sciences, cat. no. 15710) Tris (Fischer Scientific, cat. no. BP152) Tween-20 (Acros Organics, cat. no. 23360051) Bovine Serum Albumin (Sigma-Aldrich, cat. no. A2153) Gelatin from Bovine Skin, Type B (Sigma-Aldrich cat. no. G9391) Glycine (American Bioanalytical, cat. no. AB00730) Donkey serum (Sigma-Aldrich, cat. no. D9663) Anti-fade gold (Life Technologies, cat. no. ) H2 O2 (Sigma-Aldrich, cat. no. 1001582615) ImmPRESS Polymer Detection Kit (Vector Laboratories, cat. no. MP-7402 and MP-7401) DAB Peroxidase (HRP) Substrate Kit, 3,3′-diaminobenzidine (Vector Laboratories, cat. no. SK-4100) ImmPACT DAB Peroxidase Substrate kit (Vector Laboratories, cat. no. SK-4105) Amyloid β-Protein Immunohistostain Kit (Wako, cat. No. 299-56701) Chromopure goat IgG (Jackson Immuno Research, cat. No. 005-000-003) Amylo-Glo 100x (Biosensis, cat. no. TR-300-AG) 0.9% saline (B. Braun Medical Inc., cat. no. L8001) 1% Triton X-100 (Fischer Scientific, cat no. 11332481001) A summary of antibodies we used is shown in

    Quantitative RT-PCR:

    Article Title: Persisting PET-CT lesion activity and M. tuberculosis mRNA after pulmonary tuberculosis cure
    Article Snippet: The protocol below consists of three parts: 1) First strand cDNA synthesis and Controlled Multiplex Pre-Amplification of cDNAs; 2) Preparation of Primer and Probe Sets; and 3) Individual qRT-PCR (Taqman) quantification of Amplified cDNAs using LightCycler480. .. To each sample, 0.5 μl Exo-resistant Random Primer (Fermentas S0181), 1 μl 10mM dNTPs (Fermentas R0193) and 3.5 μl Nuclease Free Water (Ambion AM9938) were added for a total of 10 μl.

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: Paragraph title: RNA extraction, RT-PCR and qRT-PCR ... HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility)

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: Paragraph title: cDNA and qRT-PCR analysis ... Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively.

    Article Title: Cytokine Modulation of AD Filaggrin Skin Expression
    Article Snippet: Paragraph title: Quantitative Real-Time RT-PCR ... One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen).

    SYBR Green Assay:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    IA:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: Wear gloves and a lab coat when handle it. .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) ! .. CRITICAL It is crucial that anti-islet1 antibody from this supplier is used rather than an alternative.

    Incubation:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: RNA concentration was measured with NanoDrop (ND 1000, Thermo Scientific, USA). cDNA was synthesized by Maxima H minus reverse transcriptase (Cat# EP0751, Thermo Scientific, USA) as described by the manufacturer in a total volume 20 μl. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions. .. After cooling on ice, reverse transcriptase buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2 , 10 mM DTT, final concentrations), 20 U of RiboLock RNase Inhibitor and 100 U of Maxima H Minus Reverse Transcriptase (all from Thermo Scientific, USA) were added to the reaction mixture.

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013). .. After the RNA and primers were denatured for 10 min at 70°C, the remaining reagents were added, and the reaction was incubated at 42°C for 60 min. To remove the RNA template 2 units of RNase H were then added and the mix was incubated at 37°C for 20 min and then at 95°C for 5 min. Quality of total RNA and cRNA was monitored using RNA Nano 6000 chips processed using the 2100 BioAnalyzer (Agilent).

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: RNA samples were DNase-treated (Qiagen RNeasy Mini Kit) prior to first strand cDNA synthesis, which was carried out using 1–3 µg RNA and 10 pmol primer A236 (poly A adaptor) in 11 µl H2 O which was heated to 70 °C for 10 min, immediately cooled on ice and centrifuged briefly. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively. .. Quantitative real-time PCR (qPCR) amplification of first strand cDNA templates from a variety of plant organs and the subsequent quantification of SGR and SGRL products was carried out, essentially under conditions described (Hellens et al. ; Chinoy et al. ), and using pea actin as a reference gene (Cooper et al. ).

    Mass Spectrometry:

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by .

    Modification:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: Glasgow’s MEM (GMEM) (Gibco, Cat no: 11710035) Dulbecco’s Modified Eagle’s Medium high glucose (DMEM) (Gibco, Cat no: 11965-092) Characterized Fetal Bovine Serum (FBS) 500mL (Invitrogen, Cat no: SH30071.03) Sodium Pyruvate 100mM (Gibco, Cat no: 11360) β-mercaptoethanol (Sigma, Cat no: M6250) ESGRO® (LIF) (Millipore, Cat no: ESG1106) PD0325901 (Selleckchem, Cat no: S1036) CHIR99021 (Selleck chemicals, Cat no: S2924) 0.1% (w/v) Gelatin (EMD Millipore, Cat no: ES-006-B) 1X DPBS w/Calcium and Magnesium (Thermo Fisher Scientific, Cat no: 21-031-CV) 1X PBS w/o Calcium and Magnesium (Thermo Fisher Scientific, Cat no: 21-040-CV) TrypLE (Gibco, Cat no: 12604) IMDM (Gibco, Cat no: 12440053) Ham’s F12 (Gibco, Cat no: 10-080-CV) N2-SUPPLEMENT (Gibco, Cat no: 17502-048) B27® minus vitamin A (50×) (Thermo Fisher Scientific, Cat no: 12587010) B27® minus insulin (50×) (Thermo Fisher Scientific, Cat no: A1895601) Bovine Serum Albumin (BSA) (Sigma, Cat no: A2153) 100X Pen/Strep (Gibco, Cat no: 15070-063) Monothioglycerol (Sigma, Cat no: M-6145) Ascorbic Acid (Sigma, Cat no: A-4544) BMP4 (R & D Systems, Cat no: 314-BP) Geltrex™ LDEV-Free Reduced Growth Factor Basement Membrane Matrix (ThermoFisher Scientific, Cat no: A1413202) Essential 8 Medium (Gibco, Cat no: A1517001) RPMI 1640 Medium (Gibco, Cat no: 11875119) Y-27632 (ROCK inhibitor) (Stem cell technologies, Cat no: 72304) XAV939 (Sigma, Cat no: X3004) Isoflurane (Forane) (Baxter) Penicillin-streptomycin (Gibco, Cat no: 15070) Non-essential amino acid solution (NEAA; Invitrogen, Cat no: 11140-050) Pierce™ 16% (w/v) Formaldehyde (Thermo Fisher Scientific, Cat no: 28906) ! .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) !

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Article Title: Screening of mitochondrial mutations and insertion–deletion polymorphism in gestational diabetes mellitus in the Asian Indian population
    Article Snippet: Genotyping for the A3242G and A8344G mutations was performed by polymerase chain reaction (PCR) in an Applied Biosystems thermal cycler. .. PCR was performed in a 50-μL volume containing 5 μL of 10× Tris buffer (cat105878, Bangalore Genie, Bangalore, India), 4 μL of MgCl2 (25 mM; cat#METB5 Bangalore Gene, Bangalore, India), 1 μL of each dNTP (10 mM; cat# Fermentas, Hannover, MD, USA), 1 μL of each primer (10 pmol; Bioserve Biotechnology, Hyderabad, India) , and 2.5 U Taq polymerase (cat#MME27, Bangalore Gene, Bangalore, India) as described previously ( ). .. Statistical analysis to determine the odds ratios, Yates correction, and p values was performed using Openepi for Windows, version 2.3.1 (Openepi Software, United States).

    Hybridization:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Paragraph title: Total RNA Isolation, cRNA Target Synthesis and GeneChip Hybridization ... Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013).

    High Performance Liquid Chromatography:

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: Buffer RLT (Qiagen, cat. no. 79216) 2-Mercaptoethanol (Sigma-Aldrich, cat. no. M3148) ▲ CRITICAL It should be dedicated for RNA work only. .. HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility) .. Paraformaldehyde (Electron Microscopy Sciences, cat. no. 15710) Tris (Fischer Scientific, cat. no. BP152) Tween-20 (Acros Organics, cat. no. 23360051) Bovine Serum Albumin (Sigma-Aldrich, cat. no. A2153) Gelatin from Bovine Skin, Type B (Sigma-Aldrich cat. no. G9391) Glycine (American Bioanalytical, cat. no. AB00730) Donkey serum (Sigma-Aldrich, cat. no. D9663) Anti-fade gold (Life Technologies, cat. no. ) H2 O2 (Sigma-Aldrich, cat. no. 1001582615) ImmPRESS Polymer Detection Kit (Vector Laboratories, cat. no. MP-7402 and MP-7401) DAB Peroxidase (HRP) Substrate Kit, 3,3′-diaminobenzidine (Vector Laboratories, cat. no. SK-4100) ImmPACT DAB Peroxidase Substrate kit (Vector Laboratories, cat. no. SK-4105) Amyloid β-Protein Immunohistostain Kit (Wako, cat. No. 299-56701) Chromopure goat IgG (Jackson Immuno Research, cat. No. 005-000-003) Amylo-Glo 100x (Biosensis, cat. no. TR-300-AG) 0.9% saline (B. Braun Medical Inc., cat. no. L8001) 1% Triton X-100 (Fischer Scientific, cat no. 11332481001) A summary of antibodies we used is shown in

    Flow Cytometry:

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by .

    Gas Chromatography:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: RNA concentration was measured with NanoDrop (ND 1000, Thermo Scientific, USA). cDNA was synthesized by Maxima H minus reverse transcriptase (Cat# EP0751, Thermo Scientific, USA) as described by the manufacturer in a total volume 20 μl. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions. .. After cooling on ice, reverse transcriptase buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2 , 10 mM DTT, final concentrations), 20 U of RiboLock RNase Inhibitor and 100 U of Maxima H Minus Reverse Transcriptase (all from Thermo Scientific, USA) were added to the reaction mixture.

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Concentration Assay:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: RNA concentration was measured with NanoDrop (ND 1000, Thermo Scientific, USA). cDNA was synthesized by Maxima H minus reverse transcriptase (Cat# EP0751, Thermo Scientific, USA) as described by the manufacturer in a total volume 20 μl. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013). .. After the RNA and primers were denatured for 10 min at 70°C, the remaining reagents were added, and the reaction was incubated at 42°C for 60 min. To remove the RNA template 2 units of RNase H were then added and the mix was incubated at 37°C for 20 min and then at 95°C for 5 min. Quality of total RNA and cRNA was monitored using RNA Nano 6000 chips processed using the 2100 BioAnalyzer (Agilent).

    Infection:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: CAUTION The cell lines used in your research should be regularly checked to ensure they are authentic and are not infected with mycoplasma. .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) !

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: Paragraph title: Transcript analysis by RT-PCR ... PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Article Title: Persisting PET-CT lesion activity and M. tuberculosis mRNA after pulmonary tuberculosis cure
    Article Snippet: Genome Expression Profiling of MTB was performed using Two-Step Multiplex RT-PCR. .. To each sample, 0.5 μl Exo-resistant Random Primer (Fermentas S0181), 1 μl 10mM dNTPs (Fermentas R0193) and 3.5 μl Nuclease Free Water (Ambion AM9938) were added for a total of 10 μl.

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Paragraph title: ISH, RNA extraction and RT-PCR from mouse embryos ... For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction (RT-PCR) ... First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA).

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: Paragraph title: RNA extraction, RT-PCR and qRT-PCR ... HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility)

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Paragraph title: Gene Expression Study by RT-PCR ... PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Generated:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: We used the mouse ESC reporter line (mESCIsl1-Cre; Rosa-RFP; aMHC-GFP ) which we have previously generated and the human iPSC line 2016 which was provided by Takahashi et al. ! .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) !

    Article Title: Loss of Oct4 expression during the development of murine embryoid bodies
    Article Snippet: Total RNA was prepared from 3F10 cells and EBs using the RNeasy Mini Kit (Qiagen). .. Genomic DNA was removed from RNA by DNase (Promega) treatment for 1 hour at 37°C. cDNA was generated by reverse transcription from 2 g total RNA using SuperScript III Reverse Transcriptase, oligo(dT)20 and dNTP (10 mM) (Invitrogen). .. Generated cDNA was validated by a 30-cycle PCR beta-actin reaction.

    Polymerase Chain Reaction:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer. .. PCR cycling conditions were performed 30 s at 94 °C, 1 min at 60 °C and 68 °C for 1 min respectively, including an initial 30 s denaturation step at 94 °C and a final 5 min extension step at 68 °C (35 cycles).

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: To facilitate oral microbiome studies in murine models, we have developed protocols for sampling of oral microbial communities, processing of low biomass murine oral microbiome samples, 16S rRNA gene sequencing and analysis of relevant data. .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Additionally, both forward and reverse primers need to include 5′ and 3′ linker sequences, heterogeneity spacers and the desired index identifier sequences that will allow dual indexing for later sample identification.

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Specific intron-spanning primers listed in were designed based on NCBI database sequences. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer. .. The amplification program started with an activation step at 95°C for 5 minutes followed by 35 cycles of denaturation at 95°C for 30 seconds, hybridization at 57°C for 15 seconds and elongation at 72°C for 45 seconds.

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: Wear gloves and a lab coat when handle it. .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) ! .. CRITICAL It is crucial that anti-islet1 antibody from this supplier is used rather than an alternative.

    Article Title: The effect of the SIRT1 2827 A > G polymorphism, resveratrol, exercise, age and occupation in Turkish population with cardiovascular disease
    Article Snippet: This region multiplied with PCR as 150 base pairs (bp) by using primers designed using a primer design program, i.e., these are forward 5’GCCTTGACTGACTTGGTTTCTT 3’ and reverse 5’CATACCTATCCGTGGCCTTG 3’. .. 100 ng genomic DNA in 25 µL reaction mixture containing 2.5 µL 10 X PCR buffer (Thermo Scientific, # B33), 200 µM dNTP (Thermo Scientific, # R0191), 10 pM each of primers, and 5 Unit (U) of Taq DNA polymerase (Thermoscientific, # EP0701) was used. .. Optimal amplification of heat cycles in the PCR reaction were determined as 3 minutes at 98°C for a frontal denaturation, 45 seconds at 95°C for denaturation, 30 seconds at 65°C for an adhesion, 30 seconds at 72°C for synthesis, and 5 minutes for a total of 30 cycles and final synthesis at 72°C.

    Article Title: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer
    Article Snippet: TheTLR9 Pro99Leu polymorphism was detected using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method as described by Kubarenkoet al . .. Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA. .. The PCR was run on an MJ Mini thermal cycler (BioRad, USA).

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA).

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: The product from the first step was diluted at a ratio of 1:50 in sterile water and used in the second step with the P1 (genus–specific) primer and one of the three reverse species-specific primers (V1—P. vivax , F2—Plasmodium falciparum or M1—P. malariae ). .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step. .. The second amplification was carried out using the same equipment as the first, and the cycling parameters were 92 °C for 2 min, followed by 18 cycles of 92 °C for 30 s and 60 °C for 1 min, and one cycle of 60 °C for 5 min.

    Article Title: A simple and efficient method for isolating polymorphic microsatellites from cDNA
    Article Snippet: DNA sequences of the polymophic microsatellites were deposited in GenBank with the accession numbers: EF210110 – EF210125 and FJ535708 – FJ535732 . .. PCR amplification of microsatellites was performed on a PTC-100 thermal cycler in a 25 μl reaction volume containing 100 ng DNA, 1 × PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 and 0.1% Triton-X 100], 200 nM of each primer, 50 μM of each dNTP and one unit DNA polymerase (Finnzymes). .. Cycling conditions were: 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s, with a final extension at 72°C for 5 min. Fluorescence-based genotyping of 24 unrelated Asian seabass individuals originated from Southeast Asia and Australia was conducted using an automated DNA sequencer ABI 3730xl (Applied Biosystems).

    Article Title: Surveillance of pyrazinamide susceptibility among multidrug-resistant Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand
    Article Snippet: The expected size of the PCR products was 696 bp. .. PCR was performed in a total volume of 50 μl, and the PCR reaction mixture consisted of 0.25 mM dNTP (Fermentas, CA, USA), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.0 mM MgCl2 , 20 pmol of each primer, 1 unit of Taq DNA polymerase (Fermentas, CA, USA) and 5 μl of crude DNA. .. The PCR reactions were performed under the following conditions: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 1 min, annealing at 62°C for 1 min and extension at 72°C for 1 min; and 1 final cycle of extension at 72°C for 10 min. PCR products were analysed by 1% agarose gel electrophoresis, and subsequently they were purified using the Gel Extraction Kit (Qiagen, Germany).

    Article Title: Screening of mitochondrial mutations and insertion–deletion polymorphism in gestational diabetes mellitus in the Asian Indian population
    Article Snippet: Genotyping for the A3242G and A8344G mutations was performed by polymerase chain reaction (PCR) in an Applied Biosystems thermal cycler. .. PCR was performed in a 50-μL volume containing 5 μL of 10× Tris buffer (cat#105878, Bangalore Genie, Bangalore, India), 4 μL of MgCl2 (25 mM; cat#METB5 Bangalore Gene, Bangalore, India), 1 μL of each dNTP (10 mM; cat# Fermentas, Hannover, MD, USA), 1 μL of each primer (10 pmol; Bioserve Biotechnology, Hyderabad, India) , and 2.5 U Taq polymerase (cat#MME27, Bangalore Gene, Bangalore, India) as described previously ( ). .. Statistical analysis to determine the odds ratios, Yates correction, and p values was performed using Openepi for Windows, version 2.3.1 (Openepi Software, United States).

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Amplification reactions were performed in triplicate and a negative control (without template) was included in all runs. .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen). .. The amplification program consisted of an initial heat activation step of 95°C/60 s, 35 cycles of 94°C/60 s, 45°C/60 s, and 72°C/1 min, with a final extension step of 72°C/10 min. PCR products were resolved at 80 V in agarose/Synergel®-TBE 1% gels for 1 h; electrophoresis was developed in a submarine system (BioRad).

    Injection:

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013). .. After the RNA and primers were denatured for 10 min at 70°C, the remaining reagents were added, and the reaction was incubated at 42°C for 60 min. To remove the RNA template 2 units of RNase H were then added and the mix was incubated at 37°C for 20 min and then at 95°C for 5 min. Quality of total RNA and cRNA was monitored using RNA Nano 6000 chips processed using the 2100 BioAnalyzer (Agilent).

    Recombinant:

    Article Title: Critical role for adenosine receptor A2a in β-cell proliferation
    Article Snippet: 4.8 RNA was extracted from snap frozen liver by using PureLink® RNA Mini Kit (12183018A, Ambion, Carlsbad, CA, US), and from islets by using the RNAqueous® -Micro Total RNA Isolation Kit (1931, Ambion), according to the manufacturers' instructions. .. For transcribing RNA to cDNA, a master mix of SuperScript® IV Reverse Transcriptase (18090050, Thermo Fisher), Random Hexamers (N8080127, Thermo Fisher), RNaseOUT™ Recombinant Ribonuclease Inhibitor (10777-019, Thermo Fisher), and dNTPs (R0191, Thermo Fisher) was prepared according to manufacturers' instructions. .. For quantitative analysis of Adora2a expression, a master mix of 12.5 ng cDNA, 10 μM primer and iTaq™ Universal SYBR® Green Supermix (172 5124, BioRad) was prepared and analyzed with ViiA™ real-time PCR (Applied Biosystems).

    Cellular Antioxidant Activity Assay:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step. .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    DNA Extraction:

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: To facilitate oral microbiome studies in murine models, we have developed protocols for sampling of oral microbial communities, processing of low biomass murine oral microbiome samples, 16S rRNA gene sequencing and analysis of relevant data. .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Additionally, both forward and reverse primers need to include 5′ and 3′ linker sequences, heterogeneity spacers and the desired index identifier sequences that will allow dual indexing for later sample identification.

    Article Title: The effect of the SIRT1 2827 A > G polymorphism, resveratrol, exercise, age and occupation in Turkish population with cardiovascular disease
    Article Snippet: DNA isolation of the blood samples collected from both groups was performed by a precipitation method using a saturated commercial DNA isolation Kit (Invitrogen, K182002). .. 100 ng genomic DNA in 25 µL reaction mixture containing 2.5 µL 10 X PCR buffer (Thermo Scientific, # B33), 200 µM dNTP (Thermo Scientific, # R0191), 10 pM each of primers, and 5 Unit (U) of Taq DNA polymerase (Thermoscientific, # EP0701) was used.

    Article Title: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer
    Article Snippet: Paragraph title: DNA isolation and genetic analysis ... Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA.

    Countercurrent Chromatography:

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step. .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    Multiplex Assay:

    Article Title: Persisting PET-CT lesion activity and M. tuberculosis mRNA after pulmonary tuberculosis cure
    Article Snippet: The protocol below consists of three parts: 1) First strand cDNA synthesis and Controlled Multiplex Pre-Amplification of cDNAs; 2) Preparation of Primer and Probe Sets; and 3) Individual qRT-PCR (Taqman) quantification of Amplified cDNAs using LightCycler480. .. To each sample, 0.5 μl Exo-resistant Random Primer (Fermentas S0181), 1 μl 10mM dNTPs (Fermentas R0193) and 3.5 μl Nuclease Free Water (Ambion AM9938) were added for a total of 10 μl.

    Fluorescence:

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen). .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Isolation:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: RNA isolation and DNA digestion in the samples was performed using NucleoSpin® RNA kit (Macherey-Nagel Inc., Germany) according to the manufacturer's instructions. .. Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: Total RNA was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Article Title: Critical role for adenosine receptor A2a in β-cell proliferation
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and real-time PCR ... For transcribing RNA to cDNA, a master mix of SuperScript® IV Reverse Transcriptase (18090050, Thermo Fisher), Random Hexamers (N8080127, Thermo Fisher), RNaseOUT™ Recombinant Ribonuclease Inhibitor (10777-019, Thermo Fisher), and dNTPs (R0191, Thermo Fisher) was prepared according to manufacturers' instructions.

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Total RNA was extracted with the High Pure RNA Isolation Kit (Roche) according to the manufacturer's instructions. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Article Title: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer
    Article Snippet: DNA was isolated from cervical cancer biopsies and cervical smears by standard phenol-chloroform extraction method . .. Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA.

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Paragraph title: Total RNA Isolation, cRNA Target Synthesis and GeneChip Hybridization ... Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013).

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: Total RNA was isolated from surgically resected tissues using AllPrep DNA/RNA/Protein Mini Kit (catalog number 80004, Qiagen, GmbH, Hilden, Germany). .. First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA).

    Article Title: A simple and efficient method for isolating polymorphic microsatellites from cDNA
    Article Snippet: Paragraph title: Characterization of microsatellites isolated from normalized cDNA ... PCR amplification of microsatellites was performed on a PTC-100 thermal cycler in a 25 μl reaction volume containing 100 ng DNA, 1 × PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 and 0.1% Triton-X 100], 200 nM of each primer, 50 μM of each dNTP and one unit DNA polymerase (Finnzymes).

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: Total RNA was isolated from tissues which were frozen in liquid nitrogen, and stored at −80 °C. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively.

    Article Title: Cytokine Modulation of AD Filaggrin Skin Expression
    Article Snippet: Total RNA was isolated from 2-mm skin biopsy samples by chloroform:phenol extraction and isopropanol precipitation according to manufacturer's guidelines (Molecular Research Center, Inc.). .. One microgram of RNA was reverse-transcribed in a 20-μl reaction containing Random Primers (500 μg/ml, Invitrogen, Carlsbad, CA), dNTP (10 mM, Invitrogen), 5X First Strand Buffer (Invitrogen), DTT (0.1M, Invitrogen), Superscript III enzyme (200 U/μl, Invitrogen) and RNase inhibitor (10 U/μl, Invitrogen).

    RNA Extraction:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Paragraph title: ISH, RNA extraction and RT-PCR from mouse embryos ... For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: Paragraph title: RNA extraction, RT-PCR and qRT-PCR ... HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility)

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: Tissues were either powdered directly or after freeze-drying (for high water content tissues) and ground in 700 µl RNA extraction buffer (1 M Tris–HCl pH 9.0, 1 % SDS, 10 mM EDTA), extracted twice with 350 µl phenol and 350 µl chloroform/IAA (24:1) and centrifuged at 14,000 rpm for 5 min. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively.

    Microscopy:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Hybridized sections were analyzed on a Leica DM2500 microscope and pictures were captured with a Leica DFC420C camera. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Purification:

    Article Title: Using a neonatal rat system as a bioincubator to generate adult-like mature cardiomyocytes from human and mouse pluripotent stem cells
    Article Snippet: Wear gloves and a lab coat when handle it. .. GlutaMAX (100 x) (Gibco, Cat no: 35050-061) Saponin (Sigma, Cat no: S4521) Mouse anti-Islet1 (Developmental Studies Hybridoma Bank, Iowa City, IA) Donkey anti-mouse IgG secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, Cat no: A-31571, Lot #1757130) Sodium Chloride (Sigma, Cat no: S9888) Potassium Chloride (Sigma, Cat no: P9333) Magnesium Sulfate (Sigma, Cat no: M7506) Sodium Phosphate Monobasic (Sigma, Cat no: S3139) Sodium Bicarbonate (Sigma, Cat no: S5761) Glucose (Sigma, Cat no: D9434) HEPES (Sigma, Cat no: H3375) Magnesium Chloride (Sigma, Cat no: M8266) Calcium Chloride (Sigma, Cat no: C1016) Collagenase type II (Worthington Biochemical Corporation, Cat no: ) Protease type XIV (Sigma, Cat no: P5147) Fura-2AM (Thermo Fisher Scientific, Cat no: F1221) Fluor 594-conjugated WGA antibody (Thermo Fisher Scientific, Cat no: ) ProLong® Diamond Antifade mount. (Thermo Fisher Scientific, Cat no: ) RNase inhibitor (Thermo Fisher Scientific, Cat no: N8080119) DNase I (RNase free) (New England Biolabs, Cat no: M0303S) RNase free water (Qiagen, Cat no: 129112) SMARTscribe reverse transcriptase (Clontech, Cat no: 639536) dNTP Mix (10mM each) (Thermo Fisher Scientific, Cat no: R0191) DTT, 1M (Thermo Fisher Scientific, Cat no: P2325) Advantage® 2 Polymerase mix (Clontech, Cat no: 639201) Custom-designed PCR primers (Integrated DNA Technologies) AMPure XP PCR purification kit (Beckman Coulter, Cat no: ) RPMI 1640 without Glucose (Thermo Fisher Scientific, Cat no 11879020) Sodium L-Lactate (Sigma, Cat no: 71718) Mouse anti-Isl1 antibody, clone 39.4D5-c (Developmental Studies Hybridoma Bank) ! .. CRITICAL It is crucial that anti-islet1 antibody from this supplier is used rather than an alternative.

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: Genomic DNA was extracted from the samples with a NucleoSpin Tissue purification kit (Macherey–Nagel) following the manufacturer’s instructions, and amplified following Win et al. [ ]. .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    Article Title: Surveillance of pyrazinamide susceptibility among multidrug-resistant Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand
    Article Snippet: PCR was performed in a total volume of 50 μl, and the PCR reaction mixture consisted of 0.25 mM dNTP (Fermentas, CA, USA), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.0 mM MgCl2 , 20 pmol of each primer, 1 unit of Taq DNA polymerase (Fermentas, CA, USA) and 5 μl of crude DNA. .. The PCR reactions were performed under the following conditions: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 1 min, annealing at 62°C for 1 min and extension at 72°C for 1 min; and 1 final cycle of extension at 72°C for 10 min. PCR products were analysed by 1% agarose gel electrophoresis, and subsequently they were purified using the Gel Extraction Kit (Qiagen, Germany).

    Sequencing:

    Article Title: Oral Microbiome Characterization in Murine Models
    Article Snippet: Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by . .. Oral and gingival sample collection Ultra-Fine polystyrene swab (Puritan Medical Products, catalog number: 25-800 1PD 50) Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) KIMWIPES delicate task wipers (KCWW, Kimberly-Clark Professional, catalog number: 34120) Sterile scalpel handle #3 (Fine Science Tools, catalog number: 10003-12) Scalpel blades #10 (Fine Science Tools, catalog number: 10010-00) 70% ethanol TE buffer (Epicentre, catalog number: MTE0970) RNase AWAY decontamination reagent (Thermo Fisher Scientific, Invitrogen™, catalog number: 10328011) Ketamine 100 mg/ml (Zetamine CIII, VetOne) Xylazine 20 mg/ml (AnaSed, Lloyd laboratories) DNA isolation Safe-lock Biopur 1.5 ml Individually wrapped tubes (Eppendorf, catalog number: 022600028) DNA IQ spin baskets (Promega, catalog number: V1225) DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504) Ready-Lyse lysozyme solution (Epicentre, catalog number: R1810M) Ethanol for molecular biology (Sigma-Aldrich, catalog number: E7023) RNase AWAY decontamination reagent (Thermo Fisher Scientific, catalog number: 10328011) 16S rRNA gene library amplification and visualization DNA low-bind tube 1.5 ml (Eppendorf, catalog number: 0030108051) DNA low-bind tube 2.0 ml (Eppendorf, catalog number: 0030108078) PCR tubes 0.2 ml without caps (Bio-Rad Laboratories, catalog number: TLS0801) PCR tube 8-Cap strips (Bio-Rad Laboratories, catalog number: TCS0803) Platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific, catalog number: 11304011) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0191) PCR water (QIAGEN, catalog number: 17000-10) Forward primer 8F 5′-AGAGTTTGATCMTGGCTCAG-3′ (Custom order–IDT)* Reverse primer 361R 5′-CYIACTGCTGCCTCCCGTAG-3′ (Custom order–IDT)* * Note: These universal primers were first described in the article by .

    Article Title: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer
    Article Snippet: Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA. .. Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA.

    Article Title: Surveillance of pyrazinamide susceptibility among multidrug-resistant Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand
    Article Snippet: Paragraph title: Amplification and sequencing of the amplified pncA gene ... PCR was performed in a total volume of 50 μl, and the PCR reaction mixture consisted of 0.25 mM dNTP (Fermentas, CA, USA), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.0 mM MgCl2 , 20 pmol of each primer, 1 unit of Taq DNA polymerase (Fermentas, CA, USA) and 5 μl of crude DNA.

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Previously, amplicons for each primer set (gene, ) were evaluated by electrophoresis gel (pattern and size) as well as by direct sequencing (Macrogen) to ensure target identity (data not shown). .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: RNA samples were DNase-treated (Qiagen RNeasy Mini Kit) prior to first strand cDNA synthesis, which was carried out using 1–3 µg RNA and 10 pmol primer A236 (poly A adaptor) in 11 µl H2 O which was heated to 70 °C for 10 min, immediately cooled on ice and centrifuged briefly. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively. .. Quantitative real-time PCR (qPCR) amplification of first strand cDNA templates from a variety of plant organs and the subsequent quantification of SGR and SGRL products was carried out, essentially under conditions described (Hellens et al. ; Chinoy et al. ), and using pea actin as a reference gene (Cooper et al. ).

    Nested PCR:

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: Briefly, nested-PCR, which consists of two rounds of amplification, was carried out with primers that target the Plasmodium 18S RNA gene subunit. .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    Article Title: SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.
    Article Snippet: RNA samples were DNase-treated (Qiagen RNeasy Mini Kit) prior to first strand cDNA synthesis, which was carried out using 1–3 µg RNA and 10 pmol primer A236 (poly A adaptor) in 11 µl H2 O which was heated to 70 °C for 10 min, immediately cooled on ice and centrifuged briefly. .. Following addition of 4 µl enzyme reaction buffer, 2 µl 0.1 M DTT, 1 µl RNase inhibitor cocktail (Invitrogen), 1 µl dNTP (10 mM) and 1 µl Superscript II reverse transcriptase (Invitrogen), reactions were incubated at 37 °C for 2 h. To obtain the 5′ untranslated SGRL sequence, a 5′ RACE system (Invitrogen) was used, according to the manufacturer’s instructions, with A236 primer as GSP1, and using SGRL R4 and R7 primers (Supplementary Table 1) in the nested PCR step with the AAP and AUAP kit primers, respectively. .. Quantitative real-time PCR (qPCR) amplification of first strand cDNA templates from a variety of plant organs and the subsequent quantification of SGR and SGRL products was carried out, essentially under conditions described (Hellens et al. ; Chinoy et al. ), and using pea actin as a reference gene (Cooper et al. ).

    Activated Clotting Time Assay:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    In Situ Hybridization:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: Paragraph title: ISH, RNA extraction and RT-PCR from mouse embryos ... For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Software:

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen). .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: A Novel Small Molecule GDNF Receptor RET Agonist, BT13, Promotes Neurite Growth from Sensory Neurons in Vitro and Attenuates Experimental Neuropathy in the Rat
    Article Snippet: Paragraph title: qPCR ... Fifteen microliters of the mixture containing 100 ng of RNA, 100 pmol of oligo(dT)15–18 (Promega, USA; Oligomer, Finland), 0.5 mM dNTP (ThermoScientific, Cat# R0191) were incubated at 65°C for 5 min to remove possible secondary structure and melt GC-rich regions.

    Article Title: Critical role for adenosine receptor A2a in β-cell proliferation
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and real-time PCR ... For transcribing RNA to cDNA, a master mix of SuperScript® IV Reverse Transcriptase (18090050, Thermo Fisher), Random Hexamers (N8080127, Thermo Fisher), RNaseOUT™ Recombinant Ribonuclease Inhibitor (10777-019, Thermo Fisher), and dNTPs (R0191, Thermo Fisher) was prepared according to manufacturers' instructions.

    Article Title: Loss of Oct4 expression during the development of murine embryoid bodies
    Article Snippet: Paragraph title: Quantitative Real Time PCR ... Genomic DNA was removed from RNA by DNase (Promega) treatment for 1 hour at 37°C. cDNA was generated by reverse transcription from 2 g total RNA using SuperScript III Reverse Transcriptase, oligo(dT)20 and dNTP (10 mM) (Invitrogen).

    Negative Control:

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. The PCR product was analyzed by 2% agarose gel electrophoresis, and β-actin served as an internal control ( ). cDNA isolated from a TUHR14TKB cell line (RIKEN, Tsukuba, Ibaraki, Japan) was used as a positive control for FABP7, and HEK 293 (RIKEN, Tsukuba, Ibaraki, Japan) was used as a positive control for BRN2.

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Amplification reactions were performed in triplicate and a negative control (without template) was included in all runs. .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Binding Assay:

    Article Title: Critical role for adenosine receptor A2a in β-cell proliferation
    Article Snippet: For transcribing RNA to cDNA, a master mix of SuperScript® IV Reverse Transcriptase (18090050, Thermo Fisher), Random Hexamers (N8080127, Thermo Fisher), RNaseOUT™ Recombinant Ribonuclease Inhibitor (10777-019, Thermo Fisher), and dNTPs (R0191, Thermo Fisher) was prepared according to manufacturers' instructions. .. For quantitative analysis of Adora2a expression, a master mix of 12.5 ng cDNA, 10 μM primer and iTaq™ Universal SYBR® Green Supermix (172 5124, BioRad) was prepared and analyzed with ViiA™ real-time PCR (Applied Biosystems).

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Amplification reactions were performed in triplicate and a negative control (without template) was included in all runs. .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen). .. The amplification program consisted of an initial heat activation step of 95°C/60 s, 35 cycles of 94°C/60 s, 45°C/60 s, and 72°C/1 min, with a final extension step of 72°C/10 min. PCR products were resolved at 80 V in agarose/Synergel®-TBE 1% gels for 1 h; electrophoresis was developed in a submarine system (BioRad).

    Agarose Gel Electrophoresis:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer. .. PCR cycling conditions were performed 30 s at 94 °C, 1 min at 60 °C and 68 °C for 1 min respectively, including an initial 30 s denaturation step at 94 °C and a final 5 min extension step at 68 °C (35 cycles).

    Article Title: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer
    Article Snippet: The quality and quantity of DNA was determined using ethidium bromide-stained 1% agarose gel on GelDoc system (BioRad, USA) as well as a NanoDrop 2000 (Thermofisher, USA). .. Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA.

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. A polymerase chain reaction (PCR) was performed using polymerase Ex Taq (Takara Bio Inc, Shiga, Japan) with Gene Amp PCR system 9700 (Life Technologies, CA).

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step. .. This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step.

    Electrophoresis:

    Article Title: Impact of Gender in Renal Cell Carcinoma: The Relationship of FABP7 and BRN2 Expression with Overall Survival
    Article Snippet: First-strand cDNA was synthesized in a volume of 35 μL containing 1 μg total RNA, 0.7 μL oligo(dT)12–18 primer (catalog number 18418012, Life Technologies, Carlsbad, CA), 1.8 μL ramdom primers (catalog number 48190011, Life Technologies, Carlsbad, CA), and 2.5 μL 10 mM dNTP MIX (catalog number 18427088, Life Technologies, Carlsbad, CA). .. A polymerase chain reaction (PCR) was performed using polymerase Ex Taq (Takara Bio Inc, Shiga, Japan) with Gene Amp PCR system 9700 (Life Technologies, CA).

    Article Title: Effects of In Vitro Exposure to Diarrheic Toxin Producer Prorocentrum lima on Gene Expressions Related to Cell Cycle Regulation and Immune Response in Crassostrea gigas
    Article Snippet: Previously, amplicons for each primer set (gene, ) were evaluated by electrophoresis gel (pattern and size) as well as by direct sequencing (Macrogen) to ensure target identity (data not shown). .. PCR reactions of genes encoding the cycle regulator p21 protein (Cg-p21 ), chromatin assembly factor 1 P55 subunit (Cg-CAFp55 ), elongation factor 2 (Cg-EF2 ), and lipopolysaccharide/β-1, 3 glucan binding protein (Cg-LGBP ) were performed in a Corvette Palm thermal cycler in a final volume of 50 µL, containing: 1 µL of cDNA (160 ng), 5 µL of 10×PCR-buffer (Qiagen), 1.5 µL of MgSO4 (2.5 mM), 1 µL of each primer (10 pmol), 1 µL of each dNTP (200 mM), and 1.0 U DNA Polymerase (Invitrogen).

    Random Hexamer Labeling:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: RNA was reverse transcribed using a reaction mix containing 200 ng random hexamer primers (#SO142, Life technologies), 1 mM dNTP (#R0191, Life technologies), 10 U riboLock RNase inhibitor (#EO0381, Life technologies), 100 U RevertAid Reverse transcriptase and the provided buffer (#EP0441, Life technologies). .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    Activation Assay:

    Article Title: Molecular Analysis of the HOXA2-Dependent Degradation of RCHY1
    Article Snippet: For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer. .. For Rchy1 and Actin amplifications, PCR reaction mix contained 1.25 U Taq DNA Polymerase (#EP0402, Life technologies) with the provided buffer supplemented with 1.9 mM MgCl2 , 250 μM dNTP (#R0191, Life technologies) and 1.25 mM of each primer.

    CTG Assay:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: The cDNA reactions were performed for 10 min/25 °C, 1 h/37 °C and stopped at 72 °C for 10 min. As a template 2.5 μl of cDNA was used with primers specific for - mcherry (sense: 5`-TTC ATG TAC GGC TCC AAG GC-3′; antisense: 5`-CTG CTT GAT CTC GCC CTT CA-3′; amplification product 297 bp) - eGFP (sense: 5`-CTA TAT CAT GGC CGA CAA GCA GA-3′; antisense: 5`-GGA CTG GGT GCT CAG GTA GTG G-3′; amplification product 165 bp) - CD73 (sense: 5’-CGC AAC AAT GGC ACA ATT AC-3′; antisense: 5’-CTC GAC ACT TGG TGC AAA GA-3′; amplification product 241 bp) [ ]; - CD90 (sense: 5′-GGA CTG AGA TCC CAG AAC CA-3′; antisense: 5’-ACG AAG GCT CTG GTC CAC TA-3′; amplification product 124 bp) [ ]; - CD105 (sense: 5′-TGT CTC ACT TCA TGC CTC CAG CT-3′; antisense: 5′-AGG CTG TCC ATG TTG AGG CAG T-3′; amplification product 378 bp) [ ] - MFSD-2A (sense: 5`-CTC CTG GCC ATC ATG CTC TC-3′; antisense: 5`-GGC CAC CAA GAT GAG AAA-3′; amplification product 129 bp) - syncytin-2 (sense: 5`-AGC AGC CGT AGT CCT TCA AA-3′; antisense: 5`-AGG GGA AGA ACC CAA GAG AA-3′; amplification product 231 bp) [ ] - Ki67 (sense: 5`-TAT CAA AAG GAG CGG GGT CG-3′; antisense: 5`-TTG AGC TTT TCT CAT CAG GGT CA-3′; amplification product 389 bp) [ ] - GAPDH as a control (sense: 5’-ACC ACA GTC CAT GCC ATC AC-3′; antisense: 5’-TCC ACC ACC CTG TTG CTG TA-3′; amplification product 452 bp) [ ] (all primers customized by Eurofins, MWG GmbH, Ebersberg, Germany). .. PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer.

    Staining:

    Article Title: Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC)
    Article Snippet: PCR reactions included 0.2 μM of each primer, 200 μM of dNTP (R0193, Thermo Scientific) and 0.03 U One Taq Hot Start DNA polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany) in the supplied reaction buffer. .. PCR cycling conditions were performed 30 s at 94 °C, 1 min at 60 °C and 68 °C for 1 min respectively, including an initial 30 s denaturation step at 94 °C and a final 5 min extension step at 68 °C (35 cycles).

    Article Title: Cationic Amphiphilic Drugs Are Potent Inhibitors of Yeast Sporulation
    Article Snippet: Samples of 10 ml were then harvested and total RNA was extracted using the RiboPure-Yeast kit (Ambion, catalog no. AM1926). cDNA was synthesized in 10 µl reactions containing 1 µg/µl total RNA, 12.5 ng/µl Oligo(dT)12-18 primer (Invitrogen, catalog no. 18418-012), 15 units/µl SuperScript II (Invitrogen, catalog no. 18064–014), 1× First Strand Buffer, 10 mM DTT, and 10 mM dNTPs (Invitrogen, catalog no. 18427013). .. 220 µl hybridization cocktail containing heat-fragmented and biotin-labeled cRNA at a concentration of 0.05 µg/µl were injected into GeneChips and incubated at 45°C on a rotator in a Hybridization Oven 640 (Affymetrix) overnight at 60 rpm.

    Article Title: Assessment of asymptomatic Plasmodium spp. infection by detection of parasite DNA in residents of an extra-Amazonian region of Brazil
    Article Snippet: This step was carried out in a final volume of 20 μL, containing 2 μL of each primer (10 μM), 0.5 μL of dNTP (10 mM each, Thermo Fisher Scientific), 2 μL of 10 × PCR buffer, 0.16 μL of Taq DNA polymerase (5 U/μL), and 2 μL of the diluted final product from the first step. .. The primers used were: P1UP (F): 5′ TCC ATT AAT CAA GAA CGA AAG TTA AG 3′ P2 (R): 5′ GAA CCC AAA GAC TTT GAT TTC TCA T 3′ P1 (F): 5′ ACG ATC AGA TAC CGT CGT AAT CTT 3′ V1 (R): 5′ CAA TCT AAG AAT AAA CTC CGA AGA GAA A 3′ F2 (R): 5′ CAA TCT AAA AGT CAC CTC GAA AGA TG 3′ M1 (R): 5′ GGA AGC TAT CTA AAA GAA ACA CTC ATA T 3′ The amplified product was run on 2% agarose gel at 80 V for 40 min.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher dntp set 100 mm
    Dntp Set 100 Mm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp set 100 mm/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntp set 100 mm - by Bioz Stars, 2019-12
    90/100 stars
      Buy from Supplier

    92
    Thermo Fisher dntp solution
    ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the <t>Bsm</t> DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M <t>dNTP,</t> FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.
    Dntp Solution, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp solution/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntp solution - by Bioz Stars, 2019-12
    92/100 stars
      Buy from Supplier

    Image Search Results


    ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the Bsm DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M dNTP, FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: ( a ) Dependence of response (with background subtraction) of modified with Van_74/DP ISFETs to the Bsm DNA polymerase reaction with the addition of different vanillin concentrations. Conditions: mix1 —low molarity selection buffer, 0.2 M ;M dNTP, FP 0.05 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL; mix2 —low molarity selection buffer, 0.2 M M dNTP, FP 1.0 pmol/μL, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL, T = 22 °C; ( b ) Real time signal of the ISFET (in ∆ϕ) of modified with Van_74/DP ISFETs to the addition of vanillin (final concentration 1 × 10 −8 ) concentration. Conditions: low molarity selection buffer, 0.2 M M dNTP, PR 1.6 pmol/μL, Bsm DNA polymerase 0.1 U/μL.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: Modification, Selection, Concentration Assay

    ( a ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( b ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase; ( c ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( d ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 1.0 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: ( a ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( b ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase; ( c ) Real time signal of the ISFET (in ∆ϕ, with background subtraction) during the Bsm DNA polymerase reaction in homogenous solution in low molarity selection buffer initiated (30–40 s) by the addition of DP at different concentrations (final concentration is marked on the picture); ( d ) Slope (∆ϕ/∆t) dependence on DP concentration calculated from real time signal curves. Reaction conditions: 0.2 mM dNTP, 1.0 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: Selection, Concentration Assay

    Kinetics of Bsm DNA polymerase reaction (after subtraction of the background) monitored by spectrofluorimeter in different buffers and probes. Conditions: buffer, 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase, 0.1 pmol/μL DP/B1.

    Journal: Sensors (Basel, Switzerland)

    Article Title: Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    doi: 10.3390/s18010049

    Figure Lengend Snippet: Kinetics of Bsm DNA polymerase reaction (after subtraction of the background) monitored by spectrofluorimeter in different buffers and probes. Conditions: buffer, 0.2 mM dNTP, 0.05 pmol/μL FP, 1.6 pmol/μL PR, 0.1 U/μL BSM DNA polymerase, 0.1 pmol/μL DP/B1.

    Article Snippet: Bsm DNA polymerase, large fragment, Bsm buffer, dNTP solution, TBE electrophoresis buffer, and SYBR Gold dye were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Techniques: