Structured Review

Roche dntp
PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions <t>(dNTP</t> Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U <t>Taq</t> polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.
Dntp, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 725 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Roche
Average 96 stars, based on 725 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-02
96/100 stars

Images

1) Product Images from "Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition"

Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

Journal: PLoS ONE

doi: 10.1371/journal.pone.0077771

PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.
Figure Legend Snippet: PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

Techniques Used: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Concentration Assay, Real-time Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Biotin or digoxigenin labeled probes were generated by nick translation using the following clones: A95504 and RP23-157D7 ( Zac1 ), RP24-465F5 ( Myc ), RP23-208N9 ( c-Met ), RP23-81B3 ( Igf2R ) and RP24-169I21 ( Asb4 ). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Amplification:

Article Title: Improved strategy for phylogenetic analysis of classical swine fever virus based on full-length E2 encoding sequences
Article Snippet: Reverse transcriptase-polymerase chain reaction (RT-PCR) Prepared RNA (6 μL) was added to 26 μL of the reaction mix containing 8 μL 5× RT buffer (MLV-RT kit, Invitrogen, Karlsruhe, Germany) and 2.5 mM of each dNTP (Roche, Mannheim, Germany) for pre-incubation (70°C, 5 min; 4°C). .. The obtained cDNA (1 μL) was used as PCR template for amplification with a high fidelity Phusion polymerase (FinnEnzymes, Fisher Scientific, Schwerte, Germany).

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: .. DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy). .. By adding the Taq antibody, the Taq polymerase activity was blocked up to 94°C, thus avoiding the generation of nonspecific amplification products at room and ramping temperatures.

Article Title: Expression of Toll-like Receptor 2 in Cultured Human Keratinocytes: The Effect of Bacterial Antigens, Cytokines and Calcium Concentration
Article Snippet: The polymerase chain reaction (PCR) was performed with 2 µl of cDNA in a 50 µl reaction mixture of 1× PCR buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2 ), 200 µM of each dNTP, 20 pmol of sense and antisense primer, and 1 unit of Ampli-Taq Gold DNA polymerase (Roche, Applied Biosystems, Foster City, CA, USA). .. The amplification conditions were as follows: first denaturation at 95℃ for 14 min, then denaturation at 95℃ for 1 min, annealing at 53℃ to 64℃ for 1 min, and extension at 72℃ for 1 min for 21 to 30 cycles, and final extension at 72℃ for 5 min.

Article Title: A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves
Article Snippet: Paragraph title: PCR amplification and purification ... All PCR reactions were mixed in a total volume of 25 μL containing 10× PCR Buffer (5 mM Tris-HCl, 0.75 mM MgCl2 , 25 mM KCl, pH 8.3) (Roche Diagnostics, South Africa), 2.5 mM of each dNTP (dATP, dTTP, dCTP, dGTP) (Roche Diagnostics, South Africa), 0.2 μM of forward and reverse primers (Inqaba Biotech, South Africa) and 1.25 U Taq DNA Polymerase (Roche Diagnostics, South Africa) and DNA (20 ng/μL).

Article Title: Evolution of a subtilisin-like protease gene family in the grass endophytic fungus Epichloë festucae
Article Snippet: .. Polymerase chain reaction and amplification conditions Standard PCR amplifications of genomic DNA templates were carried out in 25 μL reactions containing 10 mM Tris-HCl, 1.5 mM MgCl2 and 50 mM KCl (pH 8.3), 50 μM of each dNTP, 200 nM of each primer, 0.5 U of Taq DNA polymerase (Roche) and 5 ng of genomic DNA. ..

Article Title: Indication for selfing in geographically separated populations and evidence for Pleistocene survival within the Alps: the case of Cylindrus obtusus (Pulmonata: Helicidae)
Article Snippet: A section of the mt COI was amplified with the primers CO1alb_fw (5′-CCA CTA ACC ACA AAG ATA TTG GGA C-’) and CO1Cyobt1_rv (5′-ATT AGA ATA TAC ACT TCC GGA TGG Cc-3′). .. PCRs were performed on a Master Gradient thermocycler (Eppendorf) in 25 μl with 1–3 μl template DNA, 0.5 unit Taq DNA polymerase (Roche), 0.5 μM of each primer and 0.2 mM of each dNTP (Roche).

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions. .. The amplification protocol comprised an initial 5 min denaturation at 95 °C, followed by 40 cycles of denaturation for 10 s at 95 °C and annealing/extension for 30 s at 60 °C on a LightCycler 480 (Roche, Sweden).

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. Nucleosome core DNA captured by linker oligos was purified using 6 % polyacrylamide (acrylamide:bis-acrylamide = 19:1) gels containing 8 M urea, followed by PCR amplification with primers AF-SG-135 (5’ OHAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATCT-OH 3’) and AF-SG-137 (5’ OH-CAAGCAGAAGACGGCATACGAGCT-OH 3’).

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: Characterization of the TCR β-chains To facilitate a further amplification of the TCR β-chains by PCR, a universal primer (UP)-sequence was added as an anchor sequence to the 5′-end of each Vp1 to Vp9 primer (Vp1-UP to Vp9-UP). .. 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche).

Positive Control:

Article Title: Unfertilized ovary pushes wheat flower open for cross-pollination
Article Snippet: Nick-end labelling was carried out by incubating slides with 10 U of terminal transferase (TdT; New England Biolab), 2 nmol of dNTP, and 0.25 nmol of digoxigenin-labelled 11-dUTP (Roche) in 200 μl of 1×TdT reaction buffer (New England Biolab) including 0.25 mM CoCl2 and 50 μg ml–1 BSA for 1 h at 37 °C. .. For the positive control sample, slides were treated with DNase I (2 U in 200 μl of 1×TURBO DNase buffer, Ambion) for 20 min at 37 °C prior to nick-end labelling.

Article Title: Multicenter Validation of the Analytical Accuracy of Salmonella PCR: towards an International Standard
Article Snippet: Each laboratory received 28 coded (“blind”) DNA samples, including samples from 12 Salmonella and 16 non- Salmonella strains (see Table ), one negative (TE buffer) and one positive control DNA, an IAC template (498-bp PCR product, produced as described above), and reagents for use in PCR, including Platinum Taq ). .. The 25-μl PCR mixture contained 0.4 μM concentrations of primers 139 and 141, 200 μM concentrations of each dNTP (Roche Diagnostics), 1× PCR buffer, 1.5 mM MgCl2 , 0.75 U of Platinum Taq polymerase (Invitrogen), 300 copies of the IAC, and 5 μl of sample DNA (approximately 106 CFU per reaction tube).

Synthesized:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: First strand cDNA was synthesized using the Superscript RNase H- reverse transcriptase kit (Invitrogen, CA, USA). .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

Quantitative RT-PCR:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Total RNA was measured in a spectrophotometer at 260-nm absorbance. mRNA expression was determined by reverse transcription-quantitative PCR (RT-qPCR). .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

SYBR Green Assay:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions. .. Each PCR (20 μl) contained 2 μl cDNA diluted 1:10, 10 μl Quanti Fast SYBR Green PCR Master Mix (Qiagen, Sweden) and 2 μl PCR primer.

Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition
Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 . .. 20-µL reactions were conducted in triplicates, containing 0.4 µM of each primer (0.15 µM ACTB bisulfite primer, ), 0.3 µM locus-specific hydrolysis probe , 0.25 mM dNTPs, 1 x PCR buffer [35 mM Tris (pH8.4), 50 mM KCl, 6 mM MgCl2 ], 0.125 x SYBR Green® I (Lonza, Rockland, ME, USA) and varying amounts of FastStart Taq DNA polymerase.

Random Hexamer Labeling:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions. .. Each PCR (20 μl) contained 2 μl cDNA diluted 1:10, 10 μl Quanti Fast SYBR Green PCR Master Mix (Qiagen, Sweden) and 2 μl PCR primer.

Activity Assay:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy). .. By adding the Taq antibody, the Taq polymerase activity was blocked up to 94°C, thus avoiding the generation of nonspecific amplification products at room and ramping temperatures.

Expressing:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Total RNA was measured in a spectrophotometer at 260-nm absorbance. mRNA expression was determined by reverse transcription-quantitative PCR (RT-qPCR). .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

Modification:

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: The nucleotide sequences of Vp2-UP and Vp9-UP were slightly modified to avoid primer interactions ( ). .. 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche).

Magnetic Resonance Imaging:

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: Brain MRI discloses a typical eye-of-the-tiger sign , and a genetic study detected a pathogenic variation in the PANK2 gene (GAA deletion, p.E236 Del). .. Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany).

Hybridization:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: Paragraph title: Oligonucleotides, PCR, RT-PCR, and Filter Hybridization ... DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy).

TUNEL Assay:

Article Title: Unfertilized ovary pushes wheat flower open for cross-pollination
Article Snippet: Paragraph title: TUNEL assay ... Nick-end labelling was carried out by incubating slides with 10 U of terminal transferase (TdT; New England Biolab), 2 nmol of dNTP, and 0.25 nmol of digoxigenin-labelled 11-dUTP (Roche) in 200 μl of 1×TdT reaction buffer (New England Biolab) including 0.25 mM CoCl2 and 50 μg ml–1 BSA for 1 h at 37 °C.

Flow Cytometry:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. Whole chromosome painting probes were prepared by DOP-PCR from flow sorted mouse chromosomes ( ).

Degenerate Oligonucleotide–primed Polymerase Chain Reaction:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. Whole chromosome painting probes were prepared by DOP-PCR from flow sorted mouse chromosomes ( ).

Ligation:

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: .. Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. Nucleosome core DNA captured by linker oligos was purified using 6 % polyacrylamide (acrylamide:bis-acrylamide = 19:1) gels containing 8 M urea, followed by PCR amplification with primers AF-SG-135 (5’ OHAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATCT-OH 3’) and AF-SG-137 (5’ OH-CAAGCAGAAGACGGCATACGAGCT-OH 3’).

Nick Translation:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Biotin or digoxigenin labeled probes were generated by nick translation using the following clones: A95504 and RP23-157D7 ( Zac1 ), RP24-465F5 ( Myc ), RP23-208N9 ( c-Met ), RP23-81B3 ( Igf2R ) and RP24-169I21 ( Asb4 ). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Generated:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Biotin or digoxigenin labeled probes were generated by nick translation using the following clones: A95504 and RP23-157D7 ( Zac1 ), RP24-465F5 ( Myc ), RP23-208N9 ( c-Met ), RP23-81B3 ( Igf2R ) and RP24-169I21 ( Asb4 ). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Polymerase Chain Reaction:

Article Title: Improved strategy for phylogenetic analysis of classical swine fever virus based on full-length E2 encoding sequences
Article Snippet: Reverse transcriptase-polymerase chain reaction (RT-PCR) Prepared RNA (6 μL) was added to 26 μL of the reaction mix containing 8 μL 5× RT buffer (MLV-RT kit, Invitrogen, Karlsruhe, Germany) and 2.5 mM of each dNTP (Roche, Mannheim, Germany) for pre-incubation (70°C, 5 min; 4°C). .. The obtained cDNA (1 μL) was used as PCR template for amplification with a high fidelity Phusion polymerase (FinnEnzymes, Fisher Scientific, Schwerte, Germany).

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: .. DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy). .. By adding the Taq antibody, the Taq polymerase activity was blocked up to 94°C, thus avoiding the generation of nonspecific amplification products at room and ramping temperatures.

Article Title: Expression of Toll-like Receptor 2 in Cultured Human Keratinocytes: The Effect of Bacterial Antigens, Cytokines and Calcium Concentration
Article Snippet: .. The polymerase chain reaction (PCR) was performed with 2 µl of cDNA in a 50 µl reaction mixture of 1× PCR buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2 ), 200 µM of each dNTP, 20 pmol of sense and antisense primer, and 1 unit of Ampli-Taq Gold DNA polymerase (Roche, Applied Biosystems, Foster City, CA, USA). ..

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: .. Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany). .. The reaction mixture was cycled 35 times at 95◦C for 1 min, annealing temperature (°C) for 1 min (refer to ) and 72◦C for 1 min. Electrophoresis of the PCR products was performed on 2% agarose gels (Figure 2).

Article Title: A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves
Article Snippet: .. All PCR reactions were mixed in a total volume of 25 μL containing 10× PCR Buffer (5 mM Tris-HCl, 0.75 mM MgCl2 , 25 mM KCl, pH 8.3) (Roche Diagnostics, South Africa), 2.5 mM of each dNTP (dATP, dTTP, dCTP, dGTP) (Roche Diagnostics, South Africa), 0.2 μM of forward and reverse primers (Inqaba Biotech, South Africa) and 1.25 U Taq DNA Polymerase (Roche Diagnostics, South Africa) and DNA (20 ng/μL). ..

Article Title: Evolution of a subtilisin-like protease gene family in the grass endophytic fungus Epichloë festucae
Article Snippet: .. Polymerase chain reaction and amplification conditions Standard PCR amplifications of genomic DNA templates were carried out in 25 μL reactions containing 10 mM Tris-HCl, 1.5 mM MgCl2 and 50 mM KCl (pH 8.3), 50 μM of each dNTP, 200 nM of each primer, 0.5 U of Taq DNA polymerase (Roche) and 5 ng of genomic DNA. ..

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Paragraph title: Reverse transcription-quantitative PCR ... Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. Nucleosome core DNA captured by linker oligos was purified using 6 % polyacrylamide (acrylamide:bis-acrylamide = 19:1) gels containing 8 M urea, followed by PCR amplification with primers AF-SG-135 (5’ OHAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATCT-OH 3’) and AF-SG-137 (5’ OH-CAAGCAGAAGACGGCATACGAGCT-OH 3’).

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: .. 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche). .. The TCR β-chain transcripts were then amplified by semi-nested PCR.

Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition
Article Snippet: .. Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 . .. Cycling conditions were at 95°C for 15 min and 40 cycles at 95°C/30 s, 54°C/30 s, 72°C/30 s. qPCR was performed using 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Multicenter Validation of the Analytical Accuracy of Salmonella PCR: towards an International Standard
Article Snippet: .. The 25-μl PCR mixture contained 0.4 μM concentrations of primers 139 and 141, 200 μM concentrations of each dNTP (Roche Diagnostics), 1× PCR buffer, 1.5 mM MgCl2 , 0.75 U of Platinum Taq polymerase (Invitrogen), 300 copies of the IAC, and 5 μl of sample DNA (approximately 106 CFU per reaction tube). ..

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. Whole chromosome painting probes were prepared by DOP-PCR from flow sorted mouse chromosomes ( ).

DNA Sequencing:

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. After separating PCR products on 2 % agarose gels, DNA bands of the expected size (~210–240 bp) were extracted (QIAchange® Gel Extraction Kit (Invitrogen); omitting the 50°C heating step), followed by massive parallel DNA sequencing (Illumina GAII).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Improved strategy for phylogenetic analysis of classical swine fever virus based on full-length E2 encoding sequences
Article Snippet: .. Reverse transcriptase-polymerase chain reaction (RT-PCR) Prepared RNA (6 μL) was added to 26 μL of the reaction mix containing 8 μL 5× RT buffer (MLV-RT kit, Invitrogen, Karlsruhe, Germany) and 2.5 mM of each dNTP (Roche, Mannheim, Germany) for pre-incubation (70°C, 5 min; 4°C). .. Meanwhile, 8 μL RT mastermix (MLV-RT kit, Invitrogen) containing 0.35 pmol DTT, 400 ng random hexamers, 5 U RNase inhibitor and 400 U M-MLV reverse transcriptase were prepared and added to the pre-incubated reaction mix.

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: Paragraph title: Oligonucleotides, PCR, RT-PCR, and Filter Hybridization ... DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy).

Article Title: Expression of Toll-like Receptor 2 in Cultured Human Keratinocytes: The Effect of Bacterial Antigens, Cytokines and Calcium Concentration
Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction (RT-PCR) ... The polymerase chain reaction (PCR) was performed with 2 µl of cDNA in a 50 µl reaction mixture of 1× PCR buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2 ), 200 µM of each dNTP, 20 pmol of sense and antisense primer, and 1 unit of Ampli-Taq Gold DNA polymerase (Roche, Applied Biosystems, Foster City, CA, USA).

Binding Assay:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: These primers allow amplification of an N-terminal Tag coding sequence, which contains the pRb pocket binding domain and the Tag intron. .. DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy).

Imaging:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Spectral karyotyping was performed according to the protocol provided by the probe-manufacturer (Applied Spectral Imaging Ltd). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

DNA Extraction:

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: For DNA extraction from type of blood cells, Q1AAMP DNA MICROKIT (Cat number: 56304) was used. .. Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany).

Real-time Polymerase Chain Reaction:

Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition
Article Snippet: .. Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 . .. Cycling conditions were at 95°C for 15 min and 40 cycles at 95°C/30 s, 54°C/30 s, 72°C/30 s. qPCR was performed using 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Adipose-Depleted Mammary Epithelial Cells and Organoids
Article Snippet: .. A master mix contains 4 μL of 5× 1st strand buffer (Invitrogen), 2 μL of 0.1 M DTT, 1 μL of 10 mM dNTP blend (Roche), 1 μL RNase inhibitor (40 units/μL, Promega), and 1 μL MuLV reverse transcriptase (50 units/μL, Roche) per reaction. cDNA is diluted 1:10 and 5 μL are input into the qPCR reactions (representing 50 ng total RNA/reaction). .. All primer/probe sets have been ordered from Integrated DNA Technologies ( ).

Irradiation:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy). .. DNA was cross-linked to filters by UV irradiation for 2 minutes.

Mutagenesis:

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany). .. All transcribed exons of the PANK2 gene were investigated in patients. delGAA homozygous mutation in the exon2 was detected in both siblings and their parent were heterozygous in this location.

Isolation:

Article Title: A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves
Article Snippet: 20 ng) isolated from the Mycosphaerella spp. used in this study was used as a template for amplification using the Polymerase Chain Reaction (PCR). .. All PCR reactions were mixed in a total volume of 25 μL containing 10× PCR Buffer (5 mM Tris-HCl, 0.75 mM MgCl2 , 25 mM KCl, pH 8.3) (Roche Diagnostics, South Africa), 2.5 mM of each dNTP (dATP, dTTP, dCTP, dGTP) (Roche Diagnostics, South Africa), 0.2 μM of forward and reverse primers (Inqaba Biotech, South Africa) and 1.25 U Taq DNA Polymerase (Roche Diagnostics, South Africa) and DNA (20 ng/μL).

Avidin-Biotin Assay:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: The detection was performed according to standard procedures with FITC conjugated avidin (Pierce) or anti-digoxigenin antibodies (Roche) ( ). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Labeling:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Biotin or digoxigenin labeled probes were generated by nick translation using the following clones: A95504 and RP23-157D7 ( Zac1 ), RP24-465F5 ( Myc ), RP23-208N9 ( c-Met ), RP23-81B3 ( Igf2R ) and RP24-169I21 ( Asb4 ). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Size-exclusion Chromatography:

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche). .. After pre-incubation at 94°C for 2 min, PCR was run for 50 cycles at 94°C for 30 sec, 58°C for 1 min, 68°C for 1 min. After a final elongation step at 68°C for 15 min, PCR products were analyzed by agarose gel electrophoresis and sequenced.

Sequencing:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: These primers allow amplification of an N-terminal Tag coding sequence, which contains the pRb pocket binding domain and the Tag intron. .. DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy).

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany). .. The PCR products were sequenced with the forward or reversed primers on an ABI 3730XL sequencer (Macrogen Company, Korea) and compared with control samples using the FinchTV program and analyzed on the NCBI website ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).Wit h these methods, the target sequence for each patient was compared with the normal reference sequence, and mutations in the exons and the splicing sites of the introns in the PANK2 gene.

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. A series of PCR reactions with increasing cycle numbers were then carried out; we carefully choose cycle numbers for which product levels have not saturated ( i.e. product levels still able to increase substantially with additional cycles); this ensures that the majority of amplified segments are still annealed to a true complement and avoids reannealing-distortion in the resulting sequence libraries ( ).

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: Characterization of the TCR β-chains To facilitate a further amplification of the TCR β-chains by PCR, a universal primer (UP)-sequence was added as an anchor sequence to the 5′-end of each Vp1 to Vp9 primer (Vp1-UP to Vp9-UP). .. 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche).

Immunostaining:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Nucleolus immunostaining was done during the FISH detection step with a mouse monoclonal antibody against the C-terminus of Nucleophosmin (NPM) (B23) and using goat anti mouse IgG conjugated with Texas red or FITC (Southern Biotech). .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Lysis:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Samples were homogenized with Qiasol lysis reagent homogenizer (Qiagen, Solna, Sweden) according to manufacturer’s instructions. .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

Activated Clotting Time Assay:

Article Title: Indication for selfing in geographically separated populations and evidence for Pleistocene survival within the Alps: the case of Cylindrus obtusus (Pulmonata: Helicidae)
Article Snippet: A section of the mt COI was amplified with the primers CO1alb_fw (5′-CCA CTA ACC ACA AAG ATA TTG GGA C-’) and CO1Cyobt1_rv (5′-ATT AGA ATA TAC ACT TCC GGA TGG Cc-3′). .. PCRs were performed on a Master Gradient thermocycler (Eppendorf) in 25 μl with 1–3 μl template DNA, 0.5 unit Taq DNA polymerase (Roche), 0.5 μM of each primer and 0.2 mM of each dNTP (Roche).

Purification:

Article Title: A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves
Article Snippet: Paragraph title: PCR amplification and purification ... All PCR reactions were mixed in a total volume of 25 μL containing 10× PCR Buffer (5 mM Tris-HCl, 0.75 mM MgCl2 , 25 mM KCl, pH 8.3) (Roche Diagnostics, South Africa), 2.5 mM of each dNTP (dATP, dTTP, dCTP, dGTP) (Roche Diagnostics, South Africa), 0.2 μM of forward and reverse primers (Inqaba Biotech, South Africa) and 1.25 U Taq DNA Polymerase (Roche Diagnostics, South Africa) and DNA (20 ng/μL).

Article Title: Indication for selfing in geographically separated populations and evidence for Pleistocene survival within the Alps: the case of Cylindrus obtusus (Pulmonata: Helicidae)
Article Snippet: PCRs were performed on a Master Gradient thermocycler (Eppendorf) in 25 μl with 1–3 μl template DNA, 0.5 unit Taq DNA polymerase (Roche), 0.5 μM of each primer and 0.2 mM of each dNTP (Roche). .. PCR products were purified using the QIAquick PCR Purification kit (Qiagen) and analyzed by direct sequencing (both directions).

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. Nucleosome core DNA captured by linker oligos was purified using 6 % polyacrylamide (acrylamide:bis-acrylamide = 19:1) gels containing 8 M urea, followed by PCR amplification with primers AF-SG-135 (5’ OHAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATCT-OH 3’) and AF-SG-137 (5’ OH-CAAGCAGAAGACGGCATACGAGCT-OH 3’).

Plasmid Preparation:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. For detecting NORs we used a mix of pA and pB rDNAprobes, prepared from a pA and pB plasmid constructs , kindly donated by Miroslav Dundr (Rosalind Franklin University of Medicine and Science, North Chicago, USA).

Software:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: .. For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. Whole chromosome painting probes were prepared by DOP-PCR from flow sorted mouse chromosomes ( ).

Electrophoresis:

Article Title: Expression of Toll-like Receptor 2 in Cultured Human Keratinocytes: The Effect of Bacterial Antigens, Cytokines and Calcium Concentration
Article Snippet: The polymerase chain reaction (PCR) was performed with 2 µl of cDNA in a 50 µl reaction mixture of 1× PCR buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2 ), 200 µM of each dNTP, 20 pmol of sense and antisense primer, and 1 unit of Ampli-Taq Gold DNA polymerase (Roche, Applied Biosystems, Foster City, CA, USA). .. Ten microliters of the PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and visualized by image analysis (Gel Doc 1000 gel documentation system, Bio-Rad, Hercules, CA, USA).

Article Title: A novel homozygous variation in the PANK2 gene in two Persian siblings with atypical pantothenate kinase associated neurodegeneration
Article Snippet: Briefly, PCR reaction was performed in a final volume of 25 µL containing 100-200 ng of total DNA, 10 pmol of each primer, 2.5 mM MgCl2, 200 mM each of dNTP and 1 U Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany). .. The reaction mixture was cycled 35 times at 95◦C for 1 min, annealing temperature (°C) for 1 min (refer to ) and 72◦C for 1 min. Electrophoresis of the PCR products was performed on 2% agarose gels (Figure 2).

Article Title: Multicenter Validation of the Analytical Accuracy of Salmonella PCR: towards an International Standard
Article Snippet: The 25-μl PCR mixture contained 0.4 μM concentrations of primers 139 and 141, 200 μM concentrations of each dNTP (Roche Diagnostics), 1× PCR buffer, 1.5 mM MgCl2 , 0.75 U of Platinum Taq polymerase (Invitrogen), 300 copies of the IAC, and 5 μl of sample DNA (approximately 106 CFU per reaction tube). .. Amplicons were detected after electrophoresis by using a 1.8% agarose gel.

Multiplex Assay:

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: .. 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche). .. The TCR β-chain transcripts were then amplified by semi-nested PCR.

Agarose Gel Electrophoresis:

Article Title: Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands
Article Snippet: DNA (0.5 μg) was PCR amplified in a total volume of 50 μl containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2 , 0.01% gelatin, 150 μmol/L of each dNTP and 25 μmol/L of each primer, 1 unit of Taq -DNA polymerase (Roche, Milan, Italy), together with 1 unit of platinum Taq antibody as indicated by the manufacturer (Invitrogen, Milan, Italy). .. PCR products were migrated in a 1% agarose gel and transferred to a nylon membrane (Amersham Pharmacia Biotech).

Article Title: Expression of Toll-like Receptor 2 in Cultured Human Keratinocytes: The Effect of Bacterial Antigens, Cytokines and Calcium Concentration
Article Snippet: The polymerase chain reaction (PCR) was performed with 2 µl of cDNA in a 50 µl reaction mixture of 1× PCR buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2 ), 200 µM of each dNTP, 20 pmol of sense and antisense primer, and 1 unit of Ampli-Taq Gold DNA polymerase (Roche, Applied Biosystems, Foster City, CA, USA). .. Ten microliters of the PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and visualized by image analysis (Gel Doc 1000 gel documentation system, Bio-Rad, Hercules, CA, USA).

Article Title: Analysis of the Paired TCR ?- and ?-chains of Single Human T Cells
Article Snippet: 1 µl of the multiplex PCR product was subjected to a run-off reaction in a PCR mix composed of 1 µl 10x PCR buffer (Roche), 0.2 µl dNTP (10 mM each), 7.65 µl H2 O, 0.1 µl Vp1-UP to Vp9-UP primers (11.1 µM each), 0.05 µl Taq DNA Polymerase (5 U/µl, Roche). .. After pre-incubation at 94°C for 2 min, PCR was run for 50 cycles at 94°C for 30 sec, 58°C for 1 min, 68°C for 1 min. After a final elongation step at 68°C for 15 min, PCR products were analyzed by agarose gel electrophoresis and sequenced.

Article Title: Multicenter Validation of the Analytical Accuracy of Salmonella PCR: towards an International Standard
Article Snippet: The 25-μl PCR mixture contained 0.4 μM concentrations of primers 139 and 141, 200 μM concentrations of each dNTP (Roche Diagnostics), 1× PCR buffer, 1.5 mM MgCl2 , 0.75 U of Platinum Taq polymerase (Invitrogen), 300 copies of the IAC, and 5 μl of sample DNA (approximately 106 CFU per reaction tube). .. Amplicons were detected after electrophoresis by using a 1.8% agarose gel.

Incubation:

Article Title: Adipose-Depleted Mammary Epithelial Cells and Organoids
Article Snippet: Each cDNA reaction consists of 2.0 μg total RNA in 10 μL of nuclease free water plus 1.0 μL of random hexamers (50 μM) and 1.0 μL oligo dT (0.5 μg/μL) incubated at 70°C for 5 min. .. A master mix contains 4 μL of 5× 1st strand buffer (Invitrogen), 2 μL of 0.1 M DTT, 1 μL of 10 mM dNTP blend (Roche), 1 μL RNase inhibitor (40 units/μL, Promega), and 1 μL MuLV reverse transcriptase (50 units/μL, Roche) per reaction. cDNA is diluted 1:10 and 5 μL are input into the qPCR reactions (representing 50 ng total RNA/reaction).

Spectrophotometry:

Article Title: Expression of the Nrf2-system at the blood-CSF barrier is modulated by neonatal inflammation and hypoxia-ischemia
Article Snippet: Total RNA was measured in a spectrophotometer at 260-nm absorbance. mRNA expression was determined by reverse transcription-quantitative PCR (RT-qPCR). .. Briefly, 200 ng RNA from choroid plexus were mixed with random hexamer primers and dNTP (Roche Molecular Biochemicals, IN, USA) and subjected to the reverse transcription process according to the manufacturer’s instructions.

Produced:

Article Title: Multicenter Validation of the Analytical Accuracy of Salmonella PCR: towards an International Standard
Article Snippet: Each laboratory received 28 coded (“blind”) DNA samples, including samples from 12 Salmonella and 16 non- Salmonella strains (see Table ), one negative (TE buffer) and one positive control DNA, an IAC template (498-bp PCR product, produced as described above), and reagents for use in PCR, including Platinum Taq ). .. The 25-μl PCR mixture contained 0.4 μM concentrations of primers 139 and 141, 200 μM concentrations of each dNTP (Roche Diagnostics), 1× PCR buffer, 1.5 mM MgCl2 , 0.75 U of Platinum Taq polymerase (Invitrogen), 300 copies of the IAC, and 5 μl of sample DNA (approximately 106 CFU per reaction tube).

Construct:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ). .. For detecting NORs we used a mix of pA and pB rDNAprobes, prepared from a pA and pB plasmid constructs , kindly donated by Miroslav Dundr (Rosalind Franklin University of Medicine and Science, North Chicago, USA).

Gel Extraction:

Article Title: Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning
Article Snippet: Ends were then blunted in a reaction containing 0.75 U/µl of T4 DNA polymerase (NEB), dNTP (100 µM each, Roche), and 1× NEB buffer 1 at 12°C for 15 min. Nucleosome core DNA was then ligated to previously annealed DNA oligos AF-SG-133 (5’ Pi-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG-OH 3’) and AF-SG-134 (5’ OH-CCCTACACGACGCTCTTCCGATCT-OH 3’) (NEB Quick Ligation Kit). .. After separating PCR products on 2 % agarose gels, DNA bands of the expected size (~210–240 bp) were extracted (QIAchange® Gel Extraction Kit (Invitrogen); omitting the 50°C heating step), followed by massive parallel DNA sequencing (Illumina GAII).

Fluorescence In Situ Hybridization:

Article Title: Spatial link between nucleoli and expression of the Zac1 gene
Article Snippet: Paragraph title: RNA & DNA FISH ... For Zac1 and Sf3b5 specific probes, we performed PCR on G7 genomic DNA using a mix of dNTP and Biotin-16-dUTP or Digoxigenin-12-dUTP (Roche) and primers designed with Primer3 software ( ) for different regions of Zac1 and Sf3b5 sequences (See primer sequences in ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Roche fitc dntp
    Inhibition of F4/80 + cell apoptosis reduces CD8 + T cell response and increases fungal burden. Wild-type mice were treated daily with Boc-D-FMK apoptosis inhibitor or Z-FA-FMK control peptide or left untreated starting at the day of intratracheal inoculation of 2 × 10 5 live Histoplasma . (A) Lung cells isolated from infected mice at day 4 after infection were stained with TUNEL reagents containing <t>FITC-dNTP</t> and PE-anti-F4/80 antibodies. Apoptotic F4/80 + cells in the lungs were analyzed by flow cytometry. Data shown represent the means ± SD of the total numbers of F4/80 + cells determined for 3 mice used in 3 independent experiments (*, P
    Fitc Dntp, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fitc dntp/product/Roche
    Average 80 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    fitc dntp - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    dntps  (Roche)
    96
    Roche dntps
    Primase activity of human PrimPol. ( A ) Human PrimPol has primase activity and can produce de novo primers using <t>rNTPs</t> and <t>dNTPs</t> opposite a poly(dT) template. ( B ) PrimPol ZF-KO lacks de novo primer synthesis activity, suggesting that an intact zinc finger is required for primase activity. ( C ) PrimPol 1–487 also has primase activity similar to the wild-type PrimPol. The unstructured region that is downstream of the zinc finger is therefore not required for primase activity. ( D ) PrimPol 1–354 has no primase activity, which indicates that PrimPol requires a functional zinc finger for primer synthesis.
    Dntps, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 821 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/Roche
    Average 96 stars, based on 821 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    Image Search Results


    Inhibition of F4/80 + cell apoptosis reduces CD8 + T cell response and increases fungal burden. Wild-type mice were treated daily with Boc-D-FMK apoptosis inhibitor or Z-FA-FMK control peptide or left untreated starting at the day of intratracheal inoculation of 2 × 10 5 live Histoplasma . (A) Lung cells isolated from infected mice at day 4 after infection were stained with TUNEL reagents containing FITC-dNTP and PE-anti-F4/80 antibodies. Apoptotic F4/80 + cells in the lungs were analyzed by flow cytometry. Data shown represent the means ± SD of the total numbers of F4/80 + cells determined for 3 mice used in 3 independent experiments (*, P

    Journal: Infection and Immunity

    Article Title: Immunization with Apoptotic Phagocytes Containing Histoplasma capsulatum Activates Functional CD8+ T Cells To Protect against Histoplasmosis ▿

    doi: 10.1128/IAI.05350-11

    Figure Lengend Snippet: Inhibition of F4/80 + cell apoptosis reduces CD8 + T cell response and increases fungal burden. Wild-type mice were treated daily with Boc-D-FMK apoptosis inhibitor or Z-FA-FMK control peptide or left untreated starting at the day of intratracheal inoculation of 2 × 10 5 live Histoplasma . (A) Lung cells isolated from infected mice at day 4 after infection were stained with TUNEL reagents containing FITC-dNTP and PE-anti-F4/80 antibodies. Apoptotic F4/80 + cells in the lungs were analyzed by flow cytometry. Data shown represent the means ± SD of the total numbers of F4/80 + cells determined for 3 mice used in 3 independent experiments (*, P

    Article Snippet: The sections were then treated with 0.1% Triton X-100 (Sigma-Aldrich) at 4°C for 5 min and incubated with a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) reaction mixture containing FITC-dNTP (Roche, Basel, Switzerland) at 37°C in the dark for 1 h. After being washed with PBS, the slides were stained with PE-anti-F4/80 or PE-anti-Gr-1.

    Techniques: Inhibition, Mouse Assay, Isolation, Infection, Staining, TUNEL Assay, Flow Cytometry, Cytometry

    iNOS deficiency reduces F4/80 + cell apoptosis and weakens CD8 + T cell response in pulmonary histoplasmosis. Wild-type and iNOS −/− mice were infected intratracheally with 2 × 10 5 live Histoplasma. (A) At day 5 after infection, lung cells were isolated and stained with PE-anti-F4/80 antibody and TUNEL reagents containing FITC-dNTP. F4/80 + TUNEL + apoptotic cells were analyzed by flow cytometry. Data shown represent the means ± SD of the total numbers of apoptotic F4/80 + cells determined for 3 mice used in 3 independent experiments. (B) At day 10 after infection, the mediastinal lymph nodes were harvested and cells were stained with PE-anti-IFN-γ and FITC-anti-CD4 or APC-anti-CD8 antibodies. Data shown represent the means ± SD of the percentages of IFN-γ-producing CD8 + or CD4 + T cells in the total CD8 + or CD4 + T cell population determined for 6 mice used in 3 independent experiments. Cells harvested from uninfected wild-type mice served as controls. The P values were obtained by comparing the results determined for pairs of groups (linked by a bracket) using Student's t test (*, P

    Journal: Infection and Immunity

    Article Title: Immunization with Apoptotic Phagocytes Containing Histoplasma capsulatum Activates Functional CD8+ T Cells To Protect against Histoplasmosis ▿

    doi: 10.1128/IAI.05350-11

    Figure Lengend Snippet: iNOS deficiency reduces F4/80 + cell apoptosis and weakens CD8 + T cell response in pulmonary histoplasmosis. Wild-type and iNOS −/− mice were infected intratracheally with 2 × 10 5 live Histoplasma. (A) At day 5 after infection, lung cells were isolated and stained with PE-anti-F4/80 antibody and TUNEL reagents containing FITC-dNTP. F4/80 + TUNEL + apoptotic cells were analyzed by flow cytometry. Data shown represent the means ± SD of the total numbers of apoptotic F4/80 + cells determined for 3 mice used in 3 independent experiments. (B) At day 10 after infection, the mediastinal lymph nodes were harvested and cells were stained with PE-anti-IFN-γ and FITC-anti-CD4 or APC-anti-CD8 antibodies. Data shown represent the means ± SD of the percentages of IFN-γ-producing CD8 + or CD4 + T cells in the total CD8 + or CD4 + T cell population determined for 6 mice used in 3 independent experiments. Cells harvested from uninfected wild-type mice served as controls. The P values were obtained by comparing the results determined for pairs of groups (linked by a bracket) using Student's t test (*, P

    Article Snippet: The sections were then treated with 0.1% Triton X-100 (Sigma-Aldrich) at 4°C for 5 min and incubated with a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) reaction mixture containing FITC-dNTP (Roche, Basel, Switzerland) at 37°C in the dark for 1 h. After being washed with PBS, the slides were stained with PE-anti-F4/80 or PE-anti-Gr-1.

    Techniques: Mouse Assay, Infection, Isolation, Staining, TUNEL Assay, Flow Cytometry, Cytometry

    Primase activity of human PrimPol. ( A ) Human PrimPol has primase activity and can produce de novo primers using rNTPs and dNTPs opposite a poly(dT) template. ( B ) PrimPol ZF-KO lacks de novo primer synthesis activity, suggesting that an intact zinc finger is required for primase activity. ( C ) PrimPol 1–487 also has primase activity similar to the wild-type PrimPol. The unstructured region that is downstream of the zinc finger is therefore not required for primase activity. ( D ) PrimPol 1–354 has no primase activity, which indicates that PrimPol requires a functional zinc finger for primer synthesis.

    Journal: Nucleic Acids Research

    Article Title: Molecular dissection of the domain architecture and catalytic activities of human PrimPol

    doi: 10.1093/nar/gku214

    Figure Lengend Snippet: Primase activity of human PrimPol. ( A ) Human PrimPol has primase activity and can produce de novo primers using rNTPs and dNTPs opposite a poly(dT) template. ( B ) PrimPol ZF-KO lacks de novo primer synthesis activity, suggesting that an intact zinc finger is required for primase activity. ( C ) PrimPol 1–487 also has primase activity similar to the wild-type PrimPol. The unstructured region that is downstream of the zinc finger is therefore not required for primase activity. ( D ) PrimPol 1–354 has no primase activity, which indicates that PrimPol requires a functional zinc finger for primer synthesis.

    Article Snippet: Typically detection of primase activity was started from incubation of 1μM of the enzyme to be tested in 20 μl reaction volume containing 500 nM homopolymeric ss DNA templates with a biotin modification at the 5′ end (see sequences 1–4 in Supplementary Table S2), 500 μM rNTPs (Invitrogen) or 500 μM dNTPs (Roche), 10 mM Bis-Tris-Propane-HCl (pH 7.0), 10 mM MgCl2 , 50 mM NaCl.

    Techniques: Activity Assay, Functional Assay

    Template-independent extension in the presence of manganese. Human PrimPol was incubated for 30 min with DNA substrate and each of the dNTPs in the presence of manganese. ( A ) Wild-type PrimPol was unable to extend from a ds DNA template with a blunt end, but could extend from a primer annealed to an overhanging template, even synthesising long tracts of homopolymers. ( B ) PrimPol ZF-KO could extend from an overhanging DNA template in the presence of manganese and, consistent with the wild-type, did not extend from a ds DNA substrate. The incorporation of 1 or 2 nucleotides of guanine or adenine opposite an overhanging template suggests that PrimPol ZF-KO incorporates in a low-fidelity template-dependent manner when incubated with overhanging DNA. ( C ) PrimPol 1–487 exhibited a highly similar terminal transferase activity spectrum to the PrimPol ZF-KO . In the presence of manganese, it incorporated bases opposite an overhang in a low fidelity, template-dependent manner. ( D ) PrimPol 1–354 also exhibited low fidelity extension of a primer annealed to an overhanging template in the presence of manganese.

    Journal: Nucleic Acids Research

    Article Title: Molecular dissection of the domain architecture and catalytic activities of human PrimPol

    doi: 10.1093/nar/gku214

    Figure Lengend Snippet: Template-independent extension in the presence of manganese. Human PrimPol was incubated for 30 min with DNA substrate and each of the dNTPs in the presence of manganese. ( A ) Wild-type PrimPol was unable to extend from a ds DNA template with a blunt end, but could extend from a primer annealed to an overhanging template, even synthesising long tracts of homopolymers. ( B ) PrimPol ZF-KO could extend from an overhanging DNA template in the presence of manganese and, consistent with the wild-type, did not extend from a ds DNA substrate. The incorporation of 1 or 2 nucleotides of guanine or adenine opposite an overhanging template suggests that PrimPol ZF-KO incorporates in a low-fidelity template-dependent manner when incubated with overhanging DNA. ( C ) PrimPol 1–487 exhibited a highly similar terminal transferase activity spectrum to the PrimPol ZF-KO . In the presence of manganese, it incorporated bases opposite an overhang in a low fidelity, template-dependent manner. ( D ) PrimPol 1–354 also exhibited low fidelity extension of a primer annealed to an overhanging template in the presence of manganese.

    Article Snippet: Typical reactions were performed in 20 μl volume containing 10 mM Bis-Tris-Propane-HCl (pH 7.0), 10 mM NaCl, 10 mM MgCl2 , 1 mM MnCl2 , 1 mM DTT, 20 nM DNA substrate, 200 μM dNTPs (Roche), with 100 nM recombinant human PrimPol or its variants.

    Techniques: Incubation, Activity Assay

    Polymerase activity and fidelity of human PrimPol. ( A ) Human PrimPol was incubated with dNTPs and substrate at 1, 3, 5 and 30 min time points. PrimPol was proficient at extending an undamaged oligonucleotide template using dNTPs. Human PrimPol did not require an intact zinc finger in order to carry out primer extension, as evidenced by the extension of primers by PrimPol ZF-KO and PrimPol 1–354 . PrimPol 1–487 that lacked the unstructured C-terminus of the protein was also polymerase proficient. PrimPol 1–354 exhibited a higher rate of polymerase activity compared to the other constructs. ( B ) Incorporation of nucleotides opposite two templating cytosine bases. PrimPol was incubated for 5 min with the DNA substrate and each of the dNTPs. All four of these PrimPol constructs inserted two guanine nucleotides opposite two cytosines in Watson–Crick base-pairing manner. PrimPol 1–354 could additionally incorporate a single adenine opposite the first cytosine.

    Journal: Nucleic Acids Research

    Article Title: Molecular dissection of the domain architecture and catalytic activities of human PrimPol

    doi: 10.1093/nar/gku214

    Figure Lengend Snippet: Polymerase activity and fidelity of human PrimPol. ( A ) Human PrimPol was incubated with dNTPs and substrate at 1, 3, 5 and 30 min time points. PrimPol was proficient at extending an undamaged oligonucleotide template using dNTPs. Human PrimPol did not require an intact zinc finger in order to carry out primer extension, as evidenced by the extension of primers by PrimPol ZF-KO and PrimPol 1–354 . PrimPol 1–487 that lacked the unstructured C-terminus of the protein was also polymerase proficient. PrimPol 1–354 exhibited a higher rate of polymerase activity compared to the other constructs. ( B ) Incorporation of nucleotides opposite two templating cytosine bases. PrimPol was incubated for 5 min with the DNA substrate and each of the dNTPs. All four of these PrimPol constructs inserted two guanine nucleotides opposite two cytosines in Watson–Crick base-pairing manner. PrimPol 1–354 could additionally incorporate a single adenine opposite the first cytosine.

    Article Snippet: Typical reactions were performed in 20 μl volume containing 10 mM Bis-Tris-Propane-HCl (pH 7.0), 10 mM NaCl, 10 mM MgCl2 , 1 mM MnCl2 , 1 mM DTT, 20 nM DNA substrate, 200 μM dNTPs (Roche), with 100 nM recombinant human PrimPol or its variants.

    Techniques: Activity Assay, Incubation, Construct

    Processivity of the polymerase activity of PrimPol. PrimPol was pre-incubated for 30 min at 37°C with an undamaged DNA primer-template substrate to allow PrimPol to bind to the DNA. The reaction was initiated by the addition of dNTPs and an excess of sonicated herring sperm DNA (trap) and time points taken at 15, 30, 60, 120 and 360 s. ( A ) After 360 s, wild-type PrimPol incorporated up to 4 nucleotides opposite the template but a significant fraction of enzyme incorporated only 1, 2 or 3 nucleotides (left panel). To confirm that the trap prevents polymerase extending from a second template, the trap was also added into the pre-incubation mix with PrimPol and the DNA substrate. This reaction was supplemented with dNTPs and there is no extension (right panel), thus successfully exhibiting the effectiveness of the trap. ( B ) PrimPol 1–354 also predominantly incorporates up to 4 nucleotides but there were fewer polymerases incorporating only 1, 2 or 3 nucleotides (left panel). The effectiveness of the trap was also successfully confirmed (right panel). ( C ) Percentage of PrimPol molecules incorporating at least n dNTPs for either full-length PrimPol or PrimPol 1–354 , calculated using Equation (1) .

    Journal: Nucleic Acids Research

    Article Title: Molecular dissection of the domain architecture and catalytic activities of human PrimPol

    doi: 10.1093/nar/gku214

    Figure Lengend Snippet: Processivity of the polymerase activity of PrimPol. PrimPol was pre-incubated for 30 min at 37°C with an undamaged DNA primer-template substrate to allow PrimPol to bind to the DNA. The reaction was initiated by the addition of dNTPs and an excess of sonicated herring sperm DNA (trap) and time points taken at 15, 30, 60, 120 and 360 s. ( A ) After 360 s, wild-type PrimPol incorporated up to 4 nucleotides opposite the template but a significant fraction of enzyme incorporated only 1, 2 or 3 nucleotides (left panel). To confirm that the trap prevents polymerase extending from a second template, the trap was also added into the pre-incubation mix with PrimPol and the DNA substrate. This reaction was supplemented with dNTPs and there is no extension (right panel), thus successfully exhibiting the effectiveness of the trap. ( B ) PrimPol 1–354 also predominantly incorporates up to 4 nucleotides but there were fewer polymerases incorporating only 1, 2 or 3 nucleotides (left panel). The effectiveness of the trap was also successfully confirmed (right panel). ( C ) Percentage of PrimPol molecules incorporating at least n dNTPs for either full-length PrimPol or PrimPol 1–354 , calculated using Equation (1) .

    Article Snippet: Typical reactions were performed in 20 μl volume containing 10 mM Bis-Tris-Propane-HCl (pH 7.0), 10 mM NaCl, 10 mM MgCl2 , 1 mM MnCl2 , 1 mM DTT, 20 nM DNA substrate, 200 μM dNTPs (Roche), with 100 nM recombinant human PrimPol or its variants.

    Techniques: Activity Assay, Incubation, Sonication

    PrimPol 1–354 can replicate through CPD and (6–4(PP)) lesions. ( A ) PrimPol 1–354 was incubated with a primer-template substrate in which the template contained a CPD lesion downstream of the primer-template junction in the presence of dNTPs. Time points were taken between 0.5 and 60 min. PrimPol 1–354 extends from the primer up to the CPD, before stalling, it will then added a base opposite the first thymine of the CPD and continue to extend until the end of the template (left panel). PrimPol 1–354 was then incubated with each dNTP to test which nucleotide it incorporates opposite a CPD (right panels). PrimPol 1–354 incorporated adenine opposite the first and second thymine of the CPD. ( B ) The polymerase domain of PrimPol can also perform TLS bypass of a 6–4(PP) lesion immediately downstream of the primer-template junction (left panel). PrimPol 1–354 incorporates either an adenine or cytosine nucleotide opposite the first thymine of the 6–4(PP) (right panels). If an adenine is incorporated opposite the first thymine, a cytosine or thymine is then incorporated opposite the second. If a cytosine is incorporated opposite the first thymine, an adenine, cytosine or thymine will be incorporated opposite the second thymine of the 6–4(PP).

    Journal: Nucleic Acids Research

    Article Title: Molecular dissection of the domain architecture and catalytic activities of human PrimPol

    doi: 10.1093/nar/gku214

    Figure Lengend Snippet: PrimPol 1–354 can replicate through CPD and (6–4(PP)) lesions. ( A ) PrimPol 1–354 was incubated with a primer-template substrate in which the template contained a CPD lesion downstream of the primer-template junction in the presence of dNTPs. Time points were taken between 0.5 and 60 min. PrimPol 1–354 extends from the primer up to the CPD, before stalling, it will then added a base opposite the first thymine of the CPD and continue to extend until the end of the template (left panel). PrimPol 1–354 was then incubated with each dNTP to test which nucleotide it incorporates opposite a CPD (right panels). PrimPol 1–354 incorporated adenine opposite the first and second thymine of the CPD. ( B ) The polymerase domain of PrimPol can also perform TLS bypass of a 6–4(PP) lesion immediately downstream of the primer-template junction (left panel). PrimPol 1–354 incorporates either an adenine or cytosine nucleotide opposite the first thymine of the 6–4(PP) (right panels). If an adenine is incorporated opposite the first thymine, a cytosine or thymine is then incorporated opposite the second. If a cytosine is incorporated opposite the first thymine, an adenine, cytosine or thymine will be incorporated opposite the second thymine of the 6–4(PP).

    Article Snippet: Typical reactions were performed in 20 μl volume containing 10 mM Bis-Tris-Propane-HCl (pH 7.0), 10 mM NaCl, 10 mM MgCl2 , 1 mM MnCl2 , 1 mM DTT, 20 nM DNA substrate, 200 μM dNTPs (Roche), with 100 nM recombinant human PrimPol or its variants.

    Techniques: Incubation