Structured Review

Promega dntp
Dntp, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Promega
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2021-05
86/100 stars

Images

Related Articles

Pull Down Assay:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Immunoprecipitation:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Amplification:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Clone Assay:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Protease Inhibitor:

Article Title: Cooperative Role of NF-?B and Poly(ADP-ribose) Polymerase 1 (PARP-1) in the TNF-induced Inhibition of PHEX Expression in Osteoblasts *
Article Snippet: A double-stranded probe corresponding to −133 to +1 bp of the PHEX promoter region was generated by annealing a 5′ biotin-labeled −133/+1 GS oligonucleotide (see “Results”) with an unlabeled complementary oligonucleotide. .. 37 pmol of biotinylated probe were mixed with: 75–100 μg of UMR-106 NP, 50 μl of 5× EMSA buffer (Promega), 1 m m DTT, phosphatase inhibitor (Sigma), protease inhibitor (Pierce), 1 μg of poly(d(I-C)) (Sigma) and incubated 2 h at 4 °C with end to end rotation (final volume 250 μl). ..

Incubation:

Article Title: Cooperative Role of NF-?B and Poly(ADP-ribose) Polymerase 1 (PARP-1) in the TNF-induced Inhibition of PHEX Expression in Osteoblasts *
Article Snippet: A double-stranded probe corresponding to −133 to +1 bp of the PHEX promoter region was generated by annealing a 5′ biotin-labeled −133/+1 GS oligonucleotide (see “Results”) with an unlabeled complementary oligonucleotide. .. 37 pmol of biotinylated probe were mixed with: 75–100 μg of UMR-106 NP, 50 μl of 5× EMSA buffer (Promega), 1 m m DTT, phosphatase inhibitor (Sigma), protease inhibitor (Pierce), 1 μg of poly(d(I-C)) (Sigma) and incubated 2 h at 4 °C with end to end rotation (final volume 250 μl). ..

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Permeabilization was performed with 0.1% v/v Triton X-100/125 mM glycine (Carl Roth)/PBS at RT for 10 min. After incubation in 2x SSC for 10 min at RT, hybridization was carried out by incubation of the sample with hybridization buffer (50% deionized formamide/200 μM dextran sulfate (MW = 500,000 g/mol) in 20x SSPE buffer) containing 1 μg biotinylated oligo-dT25 probe (Promega) in a humidity chamber overnight at 37°C. .. The slides were washed twice with 2x SSC for 30 min and once with 0.5x SSC for 15 min at RT, followed by the addition of Alexa Fluor 594-conjugated streptavidin (dilution 1:500; Thermo Scientific) in 4x SSC for 1 h at RT.

Article Title: Structure of the PCBP2/stem–loop IV complex underlying translation initiation mediated by the poliovirus type I IRES
Article Snippet: Purified PCBP2-FL or PCBP2-ΔKH3 were preincubated with 1 mg/ml tRNA (Roche) in binding buffer (5 mM HEPES-KOH pH 7.5, 25 mM KCl, 2.5 mM MgCl2, 3.8% glycerol, 20 mM DTT) for 10 min at 30°C. .. Biotinylated RNA probe and 8 U of RNAsin (Promega) were then added followed by incubation for 10 min at 30°C. .. The reaction mixture was further incubated with 0.5 mg/ml of bovine serum albumin (Promega) for 10 min at 30°C.

Negative Control:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Mature WF NF54 gametocytes (A, D), 7-Helix-1-HA gametocytes (B, E) or RNF1-HA gametocytes (C) were subjected to mRNA-FISH-IFA. (A) Negative control lacking the poly-dT-oligonucleotides; 7-Helix-1 was labelled with anti-7-Helix-1rp2 (green). (B-E) Labeling of mRNA with a biotinylated oligo-dT25 probe (red); counterlabeling was performed using rabbit anti-HA antibodies (B, C) or mouse anti-Pfs230 antisera (D, E) (green). .. Nuclei (in A-E) were highlighted by Hoechst33342 nuclear stain (blue).

Labeling:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Mature WF NF54 gametocytes (A, D), 7-Helix-1-HA gametocytes (B, E) or RNF1-HA gametocytes (C) were subjected to mRNA-FISH-IFA. (A) Negative control lacking the poly-dT-oligonucleotides; 7-Helix-1 was labelled with anti-7-Helix-1rp2 (green). (B-E) Labeling of mRNA with a biotinylated oligo-dT25 probe (red); counterlabeling was performed using rabbit anti-HA antibodies (B, C) or mouse anti-Pfs230 antisera (D, E) (green). .. Nuclei (in A-E) were highlighted by Hoechst33342 nuclear stain (blue).

Hybridization:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Permeabilization was performed with 0.1% v/v Triton X-100/125 mM glycine (Carl Roth)/PBS at RT for 10 min. After incubation in 2x SSC for 10 min at RT, hybridization was carried out by incubation of the sample with hybridization buffer (50% deionized formamide/200 μM dextran sulfate (MW = 500,000 g/mol) in 20x SSPE buffer) containing 1 μg biotinylated oligo-dT25 probe (Promega) in a humidity chamber overnight at 37°C. .. The slides were washed twice with 2x SSC for 30 min and once with 0.5x SSC for 15 min at RT, followed by the addition of Alexa Fluor 594-conjugated streptavidin (dilution 1:500; Thermo Scientific) in 4x SSC for 1 h at RT.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Promega klenow fragment
    Single-stranded nucleic acid ends are required to inhibit escape commitment. (A) Method used to monitor escape commitment. Nucleic acid inhibitors were added to transcription reaction mixtures at points 1, 2, and 3. (B) Poly(dI-dC) does not inhibit escape commitment. Poly(dI-dC) and <t>ctDNA</t> were added to transcription reactions at the points indicated (see panel A for the method). The 390-nt G-less transcript is shown. (C) The single-stranded ends of ctDNA inhibit escape commitment. ctDNA was treated with <t>Klenow</t> fragment in the presence of dNTPs to remove 5′ and 3′ single-stranded overhangs and was subsequently added to assays at the points indicated. The 390-nt G-less transcript is shown.
    Klenow Fragment, supplied by Promega, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klenow fragment/product/Promega
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    klenow fragment - by Bioz Stars, 2021-05
    97/100 stars
      Buy from Supplier

    86
    Promega αs dntps
    Schematic overview of THIO-ITCHY using α-phosphothioate nucleotide incorporation by PCR amplification. (a) Linearization of the starting plasmid by restriction digestion at the unique site between the two genes or gene fragments. (b) PCR amplification of the entire linearized vector in the presence of a mixture of <t>dNTPs</t> and <t>αS-dNTPs</t> as described in Materials and Methods. (c) Incubation of the plasmid with exonuclease III results in hydrolysis of standard dNMPs while the dNMP analogs will block enzymatic degradation. (d) The single-stranded overhangs of the plasmids are removed enzymatically with mung bean nuclease. (e) The blunt-ended constructs are recircularized by intramolecular ligation.
    αs Dntps, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/αs dntps/product/Promega
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    αs dntps - by Bioz Stars, 2021-05
    86/100 stars
      Buy from Supplier

    86
    Promega dntps
    Single-cell transcriptome analysis uncovers distinct proliferative populations within the murine heart. ( A ) Experimental timeline for tissue collection of hearts from wild-type and Mki67 RFP mice, either neonatal or adults, 14 d after sham, ischemia/reperfusion (I/R), or MI surgery ( n = 2–4 mice per condition). ( B ) Schematic representation of <t>SORT-seq</t> workflow. Hearts were isolated (1) and digested into single-cell suspension (2), and Ki67-RFP + and Ki67-RFP − cells were sorted into 384-well plates containing primers, <t>dNTPs,</t> and spike-ins (3). Retrotranscription mix was distributed using Nanodrop II, and material was pooled and amplified (4) before pair-end sequencing (5). Cells were clustered using RaceID2 (6). ( C ) Clustering of cardiac cells and cell-to-cell distances visualized by t -distributed stochastic neighbor-embedding ( t -SNE) map, highlighting identified major cardiac cell types. ( D ) Numbers of cells assigned to each cardiac cell lineage. ( E ) t -SNE map highlighting identified cell types based on previously described cellular markers (logarithmic scale of transcript expression). Markers expression is shown in Lower panel by immunofluorescent staining. (Scale bars: 50 μm.) ( F ) t -SNE map displaying cell cycle stage of each cell [S (red), G 2 /M (green), G 0 /G 1 (blue)] assigned by the cyclone algorithm. ( G ) t -SNE map showing the Ki67-RFP status from the flow cytometry data; Ki67-RFP + (red), Ki67-RFP − (black), or Mki67 wt/wt cells without TagRFP construct (gray) and radar plot showing Ki67-RFP + cells enriched for the cycling G 2 /M stage according to the cyclone algorithm. Asterisks indicate significance (χ 2 test: *** P
    Dntps, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/Promega
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2021-05
    86/100 stars
      Buy from Supplier

    Image Search Results


    Single-stranded nucleic acid ends are required to inhibit escape commitment. (A) Method used to monitor escape commitment. Nucleic acid inhibitors were added to transcription reaction mixtures at points 1, 2, and 3. (B) Poly(dI-dC) does not inhibit escape commitment. Poly(dI-dC) and ctDNA were added to transcription reactions at the points indicated (see panel A for the method). The 390-nt G-less transcript is shown. (C) The single-stranded ends of ctDNA inhibit escape commitment. ctDNA was treated with Klenow fragment in the presence of dNTPs to remove 5′ and 3′ single-stranded overhangs and was subsequently added to assays at the points indicated. The 390-nt G-less transcript is shown.

    Journal: Molecular and Cellular Biology

    Article Title: Translocation after Synthesis of a Four-Nucleotide RNA Commits RNA Polymerase II to Promoter Escape

    doi: 10.1128/MCB.22.3.762-773.2002

    Figure Lengend Snippet: Single-stranded nucleic acid ends are required to inhibit escape commitment. (A) Method used to monitor escape commitment. Nucleic acid inhibitors were added to transcription reaction mixtures at points 1, 2, and 3. (B) Poly(dI-dC) does not inhibit escape commitment. Poly(dI-dC) and ctDNA were added to transcription reactions at the points indicated (see panel A for the method). The 390-nt G-less transcript is shown. (C) The single-stranded ends of ctDNA inhibit escape commitment. ctDNA was treated with Klenow fragment in the presence of dNTPs to remove 5′ and 3′ single-stranded overhangs and was subsequently added to assays at the points indicated. The 390-nt G-less transcript is shown.

    Article Snippet: To test this, we treated ctDNA with Klenow fragment (in the presence of dNTPs) to eliminate single-stranded 5′ and 3′ overhangs.

    Techniques:

    Schematic overview of THIO-ITCHY using α-phosphothioate nucleotide incorporation by PCR amplification. (a) Linearization of the starting plasmid by restriction digestion at the unique site between the two genes or gene fragments. (b) PCR amplification of the entire linearized vector in the presence of a mixture of dNTPs and αS-dNTPs as described in Materials and Methods. (c) Incubation of the plasmid with exonuclease III results in hydrolysis of standard dNMPs while the dNMP analogs will block enzymatic degradation. (d) The single-stranded overhangs of the plasmids are removed enzymatically with mung bean nuclease. (e) The blunt-ended constructs are recircularized by intramolecular ligation.

    Journal: Nucleic Acids Research

    Article Title: Rapid generation of incremental truncation libraries for protein engineering using ?-phosphothioate nucleotides

    doi:

    Figure Lengend Snippet: Schematic overview of THIO-ITCHY using α-phosphothioate nucleotide incorporation by PCR amplification. (a) Linearization of the starting plasmid by restriction digestion at the unique site between the two genes or gene fragments. (b) PCR amplification of the entire linearized vector in the presence of a mixture of dNTPs and αS-dNTPs as described in Materials and Methods. (c) Incubation of the plasmid with exonuclease III results in hydrolysis of standard dNMPs while the dNMP analogs will block enzymatic degradation. (d) The single-stranded overhangs of the plasmids are removed enzymatically with mung bean nuclease. (e) The blunt-ended constructs are recircularized by intramolecular ligation.

    Article Snippet: Racemic mixtures of αS-dNTPs are also commercially available from Promega (Madison, WI) and Amersham Pharmacia (Piscataway, NJ).

    Techniques: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Incubation, Blocking Assay, Construct, Ligation

    Single-cell transcriptome analysis uncovers distinct proliferative populations within the murine heart. ( A ) Experimental timeline for tissue collection of hearts from wild-type and Mki67 RFP mice, either neonatal or adults, 14 d after sham, ischemia/reperfusion (I/R), or MI surgery ( n = 2–4 mice per condition). ( B ) Schematic representation of SORT-seq workflow. Hearts were isolated (1) and digested into single-cell suspension (2), and Ki67-RFP + and Ki67-RFP − cells were sorted into 384-well plates containing primers, dNTPs, and spike-ins (3). Retrotranscription mix was distributed using Nanodrop II, and material was pooled and amplified (4) before pair-end sequencing (5). Cells were clustered using RaceID2 (6). ( C ) Clustering of cardiac cells and cell-to-cell distances visualized by t -distributed stochastic neighbor-embedding ( t -SNE) map, highlighting identified major cardiac cell types. ( D ) Numbers of cells assigned to each cardiac cell lineage. ( E ) t -SNE map highlighting identified cell types based on previously described cellular markers (logarithmic scale of transcript expression). Markers expression is shown in Lower panel by immunofluorescent staining. (Scale bars: 50 μm.) ( F ) t -SNE map displaying cell cycle stage of each cell [S (red), G 2 /M (green), G 0 /G 1 (blue)] assigned by the cyclone algorithm. ( G ) t -SNE map showing the Ki67-RFP status from the flow cytometry data; Ki67-RFP + (red), Ki67-RFP − (black), or Mki67 wt/wt cells without TagRFP construct (gray) and radar plot showing Ki67-RFP + cells enriched for the cycling G 2 /M stage according to the cyclone algorithm. Asterisks indicate significance (χ 2 test: *** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Profiling proliferative cells and their progeny in damaged murine hearts

    doi: 10.1073/pnas.1805829115

    Figure Lengend Snippet: Single-cell transcriptome analysis uncovers distinct proliferative populations within the murine heart. ( A ) Experimental timeline for tissue collection of hearts from wild-type and Mki67 RFP mice, either neonatal or adults, 14 d after sham, ischemia/reperfusion (I/R), or MI surgery ( n = 2–4 mice per condition). ( B ) Schematic representation of SORT-seq workflow. Hearts were isolated (1) and digested into single-cell suspension (2), and Ki67-RFP + and Ki67-RFP − cells were sorted into 384-well plates containing primers, dNTPs, and spike-ins (3). Retrotranscription mix was distributed using Nanodrop II, and material was pooled and amplified (4) before pair-end sequencing (5). Cells were clustered using RaceID2 (6). ( C ) Clustering of cardiac cells and cell-to-cell distances visualized by t -distributed stochastic neighbor-embedding ( t -SNE) map, highlighting identified major cardiac cell types. ( D ) Numbers of cells assigned to each cardiac cell lineage. ( E ) t -SNE map highlighting identified cell types based on previously described cellular markers (logarithmic scale of transcript expression). Markers expression is shown in Lower panel by immunofluorescent staining. (Scale bars: 50 μm.) ( F ) t -SNE map displaying cell cycle stage of each cell [S (red), G 2 /M (green), G 0 /G 1 (blue)] assigned by the cyclone algorithm. ( G ) t -SNE map showing the Ki67-RFP status from the flow cytometry data; Ki67-RFP + (red), Ki67-RFP − (black), or Mki67 wt/wt cells without TagRFP construct (gray) and radar plot showing Ki67-RFP + cells enriched for the cycling G 2 /M stage according to the cyclone algorithm. Asterisks indicate significance (χ 2 test: *** P

    Article Snippet: DAPI-negative and MitoTracker-positive living cells were either sorted into TRIzol reagent (Thermo Scientific) for bulk mRNA sequencing or into 384-well plates containing 96 or 384 unique molecular identifier barcode primer sets, ERCC92 spike-ins (Agilent) and dNTPs (Promega) for single-cell mRNA-sequencing (SORT-seq) ( ) using a flow sorter (FACSAriaII, FACSFusion, or FACSJazz; all BD).

    Techniques: Mouse Assay, Isolation, Amplification, Sequencing, Expressing, Staining, Flow Cytometry, Cytometry, Construct

    Adenine Mutagenesis and Template-Priming. (A) Covalently-linked RNA-cDNA molecule. The linkage is to Sp A56 of the RNA, and the first nucleotide reverse transcribed is TR G117. The RT-PCR product resulting from primers 1 and 2 (blue arrows) is indicated by the dashed red line. (B) RT-PCR amplicons from 580 nt DGR RNA reacted with no protein (-), bRT, Avd, or bRT-Avd, separated on a 2% agarose gel and ethidium bromide-stained. The specific amplicon produced from reaction with bRT-Avd shown by the red arrowhead. (C) Percentage of substitutions in TR -cDNA determined by sequencing. (D) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity with the 580 nt DGR RNA as template for 2 h (left) or 12 h (right). Either standard dNTPs (dATP, dGTP, dCTP, TTP), as indicated by “+”,were present in the reaction, or standard dNTPs excluding dATP (-A), dGTP (-G), or TTP (-T) were present. Products were treated with RNase, and resolved by denaturing PAGE. (E) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying TTP (top) or dUTP (bottom) concentrations. Products were treated with RNase, and resolved by denaturing PAGE. (F) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying dUTP concentrations. Products were either RNase-treated (top), or both RNase-and UDG-treated (bottom), and resolved by denaturing PAGE

    Journal: bioRxiv

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1101/344556

    Figure Lengend Snippet: Adenine Mutagenesis and Template-Priming. (A) Covalently-linked RNA-cDNA molecule. The linkage is to Sp A56 of the RNA, and the first nucleotide reverse transcribed is TR G117. The RT-PCR product resulting from primers 1 and 2 (blue arrows) is indicated by the dashed red line. (B) RT-PCR amplicons from 580 nt DGR RNA reacted with no protein (-), bRT, Avd, or bRT-Avd, separated on a 2% agarose gel and ethidium bromide-stained. The specific amplicon produced from reaction with bRT-Avd shown by the red arrowhead. (C) Percentage of substitutions in TR -cDNA determined by sequencing. (D) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity with the 580 nt DGR RNA as template for 2 h (left) or 12 h (right). Either standard dNTPs (dATP, dGTP, dCTP, TTP), as indicated by “+”,were present in the reaction, or standard dNTPs excluding dATP (-A), dGTP (-G), or TTP (-T) were present. Products were treated with RNase, and resolved by denaturing PAGE. (E) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying TTP (top) or dUTP (bottom) concentrations. Products were treated with RNase, and resolved by denaturing PAGE. (F) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying dUTP concentrations. Products were either RNase-treated (top), or both RNase-and UDG-treated (bottom), and resolved by denaturing PAGE

    Article Snippet: Reverse Transcription Reactions were carried out in 20 μL containing 1.8 μM bRT-Avd, bRT, or Avd, 100 ng/μL RNA template, 100 μM dNTPs (Promega) (or varying concentrations of certain dNTPs), 0.5 μCi/μL [α-32 P]dCTP, 20 units RNase inhibitor (NEB) in 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 50 mM HEPES, pH 7.5, 10 % glycerol for 2 h at 37 °C.

    Techniques: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Produced, Sequencing, Activity Assay, Polyacrylamide Gel Electrophoresis

    Core DGR RNA. (A) Schematic of core DGR RNA. (B) Radiolabeled products resulting from bRT-Avd activity for 2 h with the core DGR RNA as template. Prior to the reverse transcription reaction, the RNA template was untreated (-Per) or treated with periodate (+Per). Products from the reaction were untreated (U) or treated with RNase (+R), and resolved by 6% denaturing PAGE. Lane T corresponds to internally-labeled core DGR RNA as a marker for the size of the template. Red arrowheads indicate radiolabeled product bands that migrate at the same position or slower than the core DGR RNA, and green arrowheads ones that migrate faster. The positions of the 120 and 90 nt cDNA bands are indicated. The two panels are from the same gel, with the black line indicating that intermediate lanes were removed. (C) Internally-labeled core DGR RNA was not incubated (−), or incubated with bRT-Avd alone or bRT-Avd with 100 μM standard dNTPs (+dNTP), 100 μM dCTP (+CTP), 100 μM dNTPs excluding dCTP (+d(A,T,G)TP), or 100 μM nonhydrolyzeable analog of dCTP (+N-dCTP) for 2 h. Incubation products were resolved by denaturing PAGE. The band corresponding to the 5’ fragment of the cleaved core RNA containing either a deoxycytidine alone (5’+dC) or cDNA (5’+cDNA), and the band corresponding to the 3’ fragment of the RNA are indicated. (D) The core DGR RNA was biotinylated at its 3’ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The core DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. (E) Radiolabeled products resulting from bRT-Avd activity for 12 h with core, hybrid core dA56, or hybrid core A56 DGR RNA as template. Products were untreated (U) or treated with RNase (+R), and resolved by denaturing PAGE. Separate samples of core dA56 and A56 were 5’ 32 P-labeled for visualization of inputs (I). The positions of the 120 and 90 nt cDNAs are indicated

    Journal: bioRxiv

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1101/344556

    Figure Lengend Snippet: Core DGR RNA. (A) Schematic of core DGR RNA. (B) Radiolabeled products resulting from bRT-Avd activity for 2 h with the core DGR RNA as template. Prior to the reverse transcription reaction, the RNA template was untreated (-Per) or treated with periodate (+Per). Products from the reaction were untreated (U) or treated with RNase (+R), and resolved by 6% denaturing PAGE. Lane T corresponds to internally-labeled core DGR RNA as a marker for the size of the template. Red arrowheads indicate radiolabeled product bands that migrate at the same position or slower than the core DGR RNA, and green arrowheads ones that migrate faster. The positions of the 120 and 90 nt cDNA bands are indicated. The two panels are from the same gel, with the black line indicating that intermediate lanes were removed. (C) Internally-labeled core DGR RNA was not incubated (−), or incubated with bRT-Avd alone or bRT-Avd with 100 μM standard dNTPs (+dNTP), 100 μM dCTP (+CTP), 100 μM dNTPs excluding dCTP (+d(A,T,G)TP), or 100 μM nonhydrolyzeable analog of dCTP (+N-dCTP) for 2 h. Incubation products were resolved by denaturing PAGE. The band corresponding to the 5’ fragment of the cleaved core RNA containing either a deoxycytidine alone (5’+dC) or cDNA (5’+cDNA), and the band corresponding to the 3’ fragment of the RNA are indicated. (D) The core DGR RNA was biotinylated at its 3’ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The core DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. (E) Radiolabeled products resulting from bRT-Avd activity for 12 h with core, hybrid core dA56, or hybrid core A56 DGR RNA as template. Products were untreated (U) or treated with RNase (+R), and resolved by denaturing PAGE. Separate samples of core dA56 and A56 were 5’ 32 P-labeled for visualization of inputs (I). The positions of the 120 and 90 nt cDNAs are indicated

    Article Snippet: Reverse Transcription Reactions were carried out in 20 μL containing 1.8 μM bRT-Avd, bRT, or Avd, 100 ng/μL RNA template, 100 μM dNTPs (Promega) (or varying concentrations of certain dNTPs), 0.5 μCi/μL [α-32 P]dCTP, 20 units RNase inhibitor (NEB) in 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 50 mM HEPES, pH 7.5, 10 % glycerol for 2 h at 37 °C.

    Techniques: Activity Assay, Polyacrylamide Gel Electrophoresis, Labeling, Marker, Incubation, Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    In vitro template-primed cDNA synthesis. (A) Bordetella bacteriophage DGR diversification of Mtd. mtd contains a variable region ( VR ), which encodes the receptor-binding site of the Mtd protein. Downstream of VR is the template region ( TR ). Adenines in TR (“A”) are frequently replaced by another base in VR (“N”). TR is transcribed to produce TR -RNA, which is then reverse transcribed to TR -cDNA. During this process, adenines in TR are mutagenized, as depicted by “X” in TR -cDNA. Adenine-mutagenized TR -cDNA homes to and replaces VR , resulting in diversification of Mtd. bRT is the DGR reverse transcriptase, and avd the DGR accessory variability determinant. (B) Sequence elements of the 580 nt DGR RNA template used for reverse transcription reactions. (C) bRT-Avd, bRT, or Avd was incubated with the 580 nt DGR RNA and dNTPs, including [α- 32 P]dCTP, for 2h. Products resulting from the incubation were untreated (U), or treated with RNase (+R), DNase (+D), or both RNase and DNase (+R+D), and resolved by 8% denaturing polyacrylamide gel electrophoresis (PAGE). Lane T corresponds to internally-labeled 580 nt DGR RNA as a marker for the size of the template. The positions of the 580 nt band, and 120 and 90 nt cDNA bands are indicated. Nuclease-treated samples were loaded at twice the amount as untreated samples, here and throughout unless otherwise indicated. Lane M here and throughout corresponds to radiolabeled, single-stranded DNA molecular mass markers (nt units). (D) DGR RNA templates containing internal truncations in TR . (E) Radiolabeled cDNA products resulting from bRT-Avd activity for 2 h with intact (WT) or internally truncated 580 nt DGR RNA as template. Samples were treated with RNase and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs produced from intact template are indicated by red and yellow circles, respectively, as are positions of the correspondingly shorter cDNAs produced from truncated RNA templates. (F) Radiolabeled products resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template. Prior to reverse transcription, the RNA template was mock-treated (−Per) or treated with periodate (+Per). Products of the reaction were untreated (U) or treated with RNase (+R), and resolved by 4% (top) or 8% (bottom) denaturing PAGE. In the top gel, the red arrowhead indicates the ~580 nt species, and the green arrowheads the several ~540 nt species. In the bottom gel, the black arrowheads indicate the 120 and 90 nt cDNA products. The black vertical line within the gel indicates irrelevant lanes that were removed for display purposes. A two-fold higher quantity was loaded for +Per samples than −Per samples.

    Journal: bioRxiv

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1101/344556

    Figure Lengend Snippet: In vitro template-primed cDNA synthesis. (A) Bordetella bacteriophage DGR diversification of Mtd. mtd contains a variable region ( VR ), which encodes the receptor-binding site of the Mtd protein. Downstream of VR is the template region ( TR ). Adenines in TR (“A”) are frequently replaced by another base in VR (“N”). TR is transcribed to produce TR -RNA, which is then reverse transcribed to TR -cDNA. During this process, adenines in TR are mutagenized, as depicted by “X” in TR -cDNA. Adenine-mutagenized TR -cDNA homes to and replaces VR , resulting in diversification of Mtd. bRT is the DGR reverse transcriptase, and avd the DGR accessory variability determinant. (B) Sequence elements of the 580 nt DGR RNA template used for reverse transcription reactions. (C) bRT-Avd, bRT, or Avd was incubated with the 580 nt DGR RNA and dNTPs, including [α- 32 P]dCTP, for 2h. Products resulting from the incubation were untreated (U), or treated with RNase (+R), DNase (+D), or both RNase and DNase (+R+D), and resolved by 8% denaturing polyacrylamide gel electrophoresis (PAGE). Lane T corresponds to internally-labeled 580 nt DGR RNA as a marker for the size of the template. The positions of the 580 nt band, and 120 and 90 nt cDNA bands are indicated. Nuclease-treated samples were loaded at twice the amount as untreated samples, here and throughout unless otherwise indicated. Lane M here and throughout corresponds to radiolabeled, single-stranded DNA molecular mass markers (nt units). (D) DGR RNA templates containing internal truncations in TR . (E) Radiolabeled cDNA products resulting from bRT-Avd activity for 2 h with intact (WT) or internally truncated 580 nt DGR RNA as template. Samples were treated with RNase and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs produced from intact template are indicated by red and yellow circles, respectively, as are positions of the correspondingly shorter cDNAs produced from truncated RNA templates. (F) Radiolabeled products resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template. Prior to reverse transcription, the RNA template was mock-treated (−Per) or treated with periodate (+Per). Products of the reaction were untreated (U) or treated with RNase (+R), and resolved by 4% (top) or 8% (bottom) denaturing PAGE. In the top gel, the red arrowhead indicates the ~580 nt species, and the green arrowheads the several ~540 nt species. In the bottom gel, the black arrowheads indicate the 120 and 90 nt cDNA products. The black vertical line within the gel indicates irrelevant lanes that were removed for display purposes. A two-fold higher quantity was loaded for +Per samples than −Per samples.

    Article Snippet: Reverse Transcription Reactions were carried out in 20 μL containing 1.8 μM bRT-Avd, bRT, or Avd, 100 ng/μL RNA template, 100 μM dNTPs (Promega) (or varying concentrations of certain dNTPs), 0.5 μCi/μL [α-32 P]dCTP, 20 units RNase inhibitor (NEB) in 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 50 mM HEPES, pH 7.5, 10 % glycerol for 2 h at 37 °C.

    Techniques: In Vitro, Binding Assay, Sequencing, Incubation, Polyacrylamide Gel Electrophoresis, Labeling, Marker, Activity Assay, Produced