dntp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Deoxynucleotide Solution Mix
    Description:
    Deoxynucleotide Solution Mix 40 umol of each
    Catalog Number:
    n0447l
    Price:
    245
    Size:
    40 umol of each
    Category:
    Deoxynucleotides
    Buy from Supplier


    Structured Review

    New England Biolabs dntp
    Deoxynucleotide Solution Mix
    Deoxynucleotide Solution Mix 40 umol of each
    https://www.bioz.com/result/dntp/product/New England Biolabs
    Average 90 stars, based on 602 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Motif programming: a microgene-based method for creating synthetic proteins containing multiple functional motifs"

    Article Title: Motif programming: a microgene-based method for creating synthetic proteins containing multiple functional motifs

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm017

    Schematic diagram of a motif-mixing protocol used in this study. Initially, we designed DNA sequences for microgenes core that each encode a peptide motif to be mixed in their first reading frames, after which sense and antisense MPR primers were synthesized based on these microgenes core . These primers share 3′ sequences that enable base-pair formation between the sense and antisense primers, but contain mismatched bases at their 3′-OH ends (shown by red letters with dots). In the polymerization step, motifs can be embedded either in the sense or antisense primer. In the figure, motifs A and B are embedded in the sense primers, producing primers A S and B S , while motifs C and D are in the antisense primers, producing primers C AS and D AS . The thermal cycle reaction is carried out in the presence of these MPR primers, a thermostable, a DNA polymerase and dNTP. The resultant high molecular weight DNAs are combinatorial polymers of multiple microgenes created by stochastic base paring of the MPR primers. In some clones, nucleotide insertions or deletions allow frame shift mutations (denoted by FS), so that peptide sequences encoded by the second and third reading frames appear in the translated products.
    Figure Legend Snippet: Schematic diagram of a motif-mixing protocol used in this study. Initially, we designed DNA sequences for microgenes core that each encode a peptide motif to be mixed in their first reading frames, after which sense and antisense MPR primers were synthesized based on these microgenes core . These primers share 3′ sequences that enable base-pair formation between the sense and antisense primers, but contain mismatched bases at their 3′-OH ends (shown by red letters with dots). In the polymerization step, motifs can be embedded either in the sense or antisense primer. In the figure, motifs A and B are embedded in the sense primers, producing primers A S and B S , while motifs C and D are in the antisense primers, producing primers C AS and D AS . The thermal cycle reaction is carried out in the presence of these MPR primers, a thermostable, a DNA polymerase and dNTP. The resultant high molecular weight DNAs are combinatorial polymers of multiple microgenes created by stochastic base paring of the MPR primers. In some clones, nucleotide insertions or deletions allow frame shift mutations (denoted by FS), so that peptide sequences encoded by the second and third reading frames appear in the translated products.

    Techniques Used: Synthesized, Molecular Weight, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: Giantin-knockout models reveal a feedback loop between Golgi function and glycosyltransferase expression
    Article Snippet: After 48 h, GFP-positive cells were sorted into 96-well plates, seeding one cell per well to generate clones. .. To identify mutations, genomic DNA was prepared using a Purelink genomic DNA mini kit (Invitrogen) and the region targeted by the gRNAs amplified by PCR [primers: forward, 5′-CTGGGTCTGGTTGTTGTTGGT-3′; reverse, 5′-GGTGTCATGTTGGTGCTCAG-3′; reaction mix: Taq DNA polymerase with Thermopol buffer, 10 mM dNTP mix, 10 μM each primer and 2 μl genomic DNA; reagents from NEB (M0267L, N0447L)].

    Amplification:

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. Across PPN species, 18S rRNA was used as an internal control as other regions tested were too variable. qRT-PCR products were amplified using 0.5 μM of each appropriate primer pair, 10 μl iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA), and 1 μl cDNA.

    Article Title: Giantin-knockout models reveal a feedback loop between Golgi function and glycosyltransferase expression
    Article Snippet: .. To identify mutations, genomic DNA was prepared using a Purelink genomic DNA mini kit (Invitrogen) and the region targeted by the gRNAs amplified by PCR [primers: forward, 5′-CTGGGTCTGGTTGTTGTTGGT-3′; reverse, 5′-GGTGTCATGTTGGTGCTCAG-3′; reaction mix: Taq DNA polymerase with Thermopol buffer, 10 mM dNTP mix, 10 μM each primer and 2 μl genomic DNA; reagents from NEB (M0267L, N0447L)]. .. PCR products were cloned into the pGEM T Easy vector according to the manufacturer's instructions (Promega) and sequenced using predesigned primers against the T7 promoter (MWG Eurofins).

    Article Title: A Population-Based Assessment of the Impact of 7- and 13-Valent Pneumococcal Conjugate Vaccines on Macrolide-Resistant Invasive Pneumococcal Disease: Emergence and Decline of Streptococcus pneumoniae Serotype 19A (CC320) With Dual Macrolide Resistance Mechanisms
    Article Snippet: OneTaq DNA polymerase and deoxynucleotide solution mix (New England Biolabs) were used. .. PCR amplification of erm (B) of a 551 bp product was performed using primers KG1F (5ʹ-TTGGAACAGGTAAAGGGCATT) and KG1R2 (5ʹ-TTTGGCGTGTTTCATTGCTTG) [ ].

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: Then, genomic DNA from the lysed single viruses was amplified by MDA in a 10 μl final volume reaction. .. The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water.

    Whole Genome Amplification:

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: Paragraph title: Whole-genome amplification of single viruses ... The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water.

    Positive Control:

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water. .. Finally, 0.6 ng of genomic lambda DNA (ref. N3011S, New England Biolab) was added to wells A1, A24, P1 and P24 of the plate as positive control.

    Synthesized:

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Article Title: Fetal exposure to bisphenol A as a risk factor for the development of childhood asthma: an animal model study
    Article Snippet: RT-Real-time PCR We quantified mRNA expression for two isotypes of glucuronyl transferases in these livers using real-time PCR as we described [ ]. cDNA was synthesized from total RNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. .. Real-time reactions composed of cDNA, gene-specific 20X TaqMan probes with Deoxynucleotide Solution Mix (New England BioLabs) and Taq DNA Polymerase (New England BioLabs) were performed in duplicate.

    Article Title: Matrix stiffening promotes a tumor vasculature phenotype
    Article Snippet: To generate cDNA, 1 μg of total RNA per sample was mixed with 80-μM random primers (Invitrogen), 10 mM deoxynucleotide solution mix (New England Biolabs), and nuclease-free water and was heated for 5 min at 75 °C. .. After the addition of 40 U/μL RNase inhibitor and 200 U/μL M-MuLV Reverse Transcriptase in M-MuLV reaction buffer (New England Biolabs), cDNA was synthesized in an iCycler thermal cycler (Bio-Rad).

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Lambda DNA Preparation:

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water. .. Finally, 0.6 ng of genomic lambda DNA (ref. N3011S, New England Biolab) was added to wells A1, A24, P1 and P24 of the plate as positive control.

    Quantitative RT-PCR:

    Article Title: Matrix stiffening promotes a tumor vasculature phenotype
    Article Snippet: To generate cDNA, 1 μg of total RNA per sample was mixed with 80-μM random primers (Invitrogen), 10 mM deoxynucleotide solution mix (New England Biolabs), and nuclease-free water and was heated for 5 min at 75 °C. .. Quantitative RT-PCR was performed with 1 μg of cDNA and 0.4 μM of specific primers against MMP14 (forward: 5′-TGTGACGGGAACTTTGACACCG-3′; reverse: 5′-ACGCTGCCCTTGAAACTGTGGC-3′) and GAPDH (forward: 5′-CATGAGAAGTATGACAACAGCCT-3′; reverse: 5′-AGTCCTTCCACGATACCAAAGT-3′) (Integrated DNA Technologies) using 1× iQ SYBR Green Supermix (Bio-Rad) on a MyiQ Single-Color Real-Time PCR Detection System (Bio-Rad).

    Real-time Polymerase Chain Reaction:

    Article Title: Fetal exposure to bisphenol A as a risk factor for the development of childhood asthma: an animal model study
    Article Snippet: RT-Real-time PCR We quantified mRNA expression for two isotypes of glucuronyl transferases in these livers using real-time PCR as we described [ ]. cDNA was synthesized from total RNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. .. Real-time reactions composed of cDNA, gene-specific 20X TaqMan probes with Deoxynucleotide Solution Mix (New England BioLabs) and Taq DNA Polymerase (New England BioLabs) were performed in duplicate.

    Article Title: Matrix stiffening promotes a tumor vasculature phenotype
    Article Snippet: Paragraph title: Quantitative Real-Time PCR. ... To generate cDNA, 1 μg of total RNA per sample was mixed with 80-μM random primers (Invitrogen), 10 mM deoxynucleotide solution mix (New England Biolabs), and nuclease-free water and was heated for 5 min at 75 °C.

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: For real-time PCR assays, total RNA was isolated using the PureLink RNA minikit (Life Technologies). .. RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs).

    Incubation:

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: .. Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Reverse transcribed samples were volume up to 26 μl with H2 O and 2 μl was set aside and serial-diluted to test PCR conditions as described in ( ).

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Volumes were adjusted to 11.5 μl per sample with nuclease-free water, followed by the addition of 0.5 μl of 250 mM Random Primer 6 (S1230S, NEB) and 1 μl Deoxynucleotide Solution Mix (N0447, NEB). .. Samples were mixed by tapping, briefly spun by microfuge, incubated at 65° C for 5 min and immediately cooled on ice.

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: Next, to each well, 0.7 μl of lysis buffer D2 (see details for preparation and composition in ref. ) was added and incubated for 5 min at 4 °C. .. The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water.

    Gel Extraction:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: Non-migrating DNA gel loading buffer dye (15% (wt/vol) Ficoll 400, blue dextran, 5 mM EDTA) QIAquick Gel Extraction Kit (Qiagen, cat. no. 28704) supplied with Elution Buffer (EB) (10 mM Tris-Cl, pH 8.5, Qiagen, cat. no. 19086) NotI restriction enzyme (10 U μL-1 , NEB, cat. no. R0189S) supplied with 10x NEBuffer 3(10x, NEB, cat. no. B7003S). .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484).

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Expressing:

    Article Title: Fetal exposure to bisphenol A as a risk factor for the development of childhood asthma: an animal model study
    Article Snippet: FAM dye-labeled TaqMan Gene Expression Assays, including gene-specific polymerase chain reaction (PCR) primers and dye-labeled probes, specific for mouse Ugt1a1 (Mm02603337_m1), Ugt2b1 (Mm00514184_m1), and mouse glyceraldehydes-3-phosphate dehydrogenase (Mm99999915_g1) were purchased from Applied Biosystems. .. Real-time reactions composed of cDNA, gene-specific 20X TaqMan probes with Deoxynucleotide Solution Mix (New England BioLabs) and Taq DNA Polymerase (New England BioLabs) were performed in duplicate.

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Modification:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: When extracting total RNA from plant tissue, a different modification was made as it was flash frozen in liquid nitrogen immediately before bead beating. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Derivative Assay:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484). .. T3 RNA polymerase (Promega, 10 U μL-1 , cat. no. P2083) including DTT (100 mM, cat. no. P117B) and Transcription Optimized 5x buffer (cat. no. P118B) Vaccinia Capping System (NEB, 10 U μL-1 , cat. no. M2080S) supplied with 10x Capping Buffer, S-adenosylmethionine (SAM, 32 mM) and GTP (10 mM) Agilent High Sensitivity DNA Kit (Agilent, cat. no. 5067-4626) CRITICAL: It should be taken out of the fridge in advance to reach room temperature (20-25°C) before its use.

    High Performance Liquid Chromatography:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: Blunt needles (SAI Infusion cat. no. B27–50) can be used as an alternative. pU6-SAG1 (Addgene cat. no. 80322) Lourido Toxoplasma CRISPR Library V1 (Addgene cat. no. 80636) pU6-DHFR (Addgene cat. no. 80329) pCas9-CAT (Addgene cat. no. 80323) pU6-Decoy (Addgene cat. no. 80324) Ampicillin (Sigma-Aldrich-Aldrich cat. no. A0166–25G) Glycerol (EMD cat. no. GX0185–6) Methanol-Free Formaldehyde (Thermo Scientific cat. no. 28908) Prolong Gold (Invitrogen cat. no. P1044) Molecular biology-grade water (e.g., from an EMD Millipore Milii-Q Integral System, Fisher Scientific cat. no. ZRXQ003US) Gentamicin (Gibco cat. no. 15710–064) EGTA (Sigma-Aldrich cat. no. E4378–500G) HEPES (Sigma-Aldrich cat. no. 3375–1KG) KH2 PO4 (Sigma-Aldrich cat. no. P5655) K2 HPO4 (Sigma-Aldrich cat. no. 1551128) KCl (Fisher Scientific cat. no. SP138–500) MgCl2 (Mallinckrodt cat. no. 5958) Methanol for HPLC gradient analysis (Millipore, cat. No. 67–56-1) EDTA (Amresco cat. no. 0322–500G) Tris base (Sigma-Aldrich cat. no. TRIS-RO) Glacial acetic acid (Spectrum cat. no. A1010) CAUTION Glacial acetic acid is corrosive; avoid contact with eyes, skin, and clothing; wear protective gloves while handling. .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol.

    Transfection:

    Article Title: Giantin-knockout models reveal a feedback loop between Golgi function and glycosyltransferase expression
    Article Snippet: Genome engineering RPE-1 cells were transfected as above with 1 μg each of paired gRNAs HSL0001186601 (ACCTGAGCACGGCCCACCAAGG) and HSR0001186603 (GTCGTTGACTTGCTGCAACAGG) (obtained from Sigma) targeting the GOLGB1 gene plus 0.1 μg pSpCas9n(BB)-2A-GFP (Addgene plasmid, 48140 PX461; ). .. To identify mutations, genomic DNA was prepared using a Purelink genomic DNA mini kit (Invitrogen) and the region targeted by the gRNAs amplified by PCR [primers: forward, 5′-CTGGGTCTGGTTGTTGTTGGT-3′; reverse, 5′-GGTGTCATGTTGGTGCTCAG-3′; reaction mix: Taq DNA polymerase with Thermopol buffer, 10 mM dNTP mix, 10 μM each primer and 2 μl genomic DNA; reagents from NEB (M0267L, N0447L)].

    Ligation:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484). .. T3 RNA polymerase (Promega, 10 U μL-1 , cat. no. P2083) including DTT (100 mM, cat. no. P117B) and Transcription Optimized 5x buffer (cat. no. P118B) Vaccinia Capping System (NEB, 10 U μL-1 , cat. no. M2080S) supplied with 10x Capping Buffer, S-adenosylmethionine (SAM, 32 mM) and GTP (10 mM) Agilent High Sensitivity DNA Kit (Agilent, cat. no. 5067-4626) CRITICAL: It should be taken out of the fridge in advance to reach room temperature (20-25°C) before its use.

    Sequencing:

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Paragraph title: cDNA Generation for Oxford Nanopore Technologies Sequencing ... Volumes were adjusted to 11.5 μl per sample with nuclease-free water, followed by the addition of 0.5 μl of 250 mM Random Primer 6 (S1230S, NEB) and 1 μl Deoxynucleotide Solution Mix (N0447, NEB).

    Binding Assay:

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. The SCN-specific internal control genes GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) [ ] and HgFAR1 (H . glycines fatty acid and retinol binding protein-1) [ ] were used to determine the relative quantification of viral titers.

    DNA Extraction:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Countercurrent Chromatography:

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs). .. Primers used to amplify GAPDH were as follows: forward, 5′ ATG ATT CTA CCC ACG GCA AG 3′ and reverse, 5′ CTG GAA GAT GGT GAT GGG TT 3′.

    RNA HS Assay:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484). .. Agilent RNA 6000 Nano Kit (Agilent, cat. no. 5067-1511) CRITICAL: It should be taken out of the fridge in advance to reach room temperature (20-25°C) before its use. dsDNA HS Assay kit for Qubit 2.0 (Life technologies, cat. no. ) RNA HS Assay kit for Qubit 2.0 (Life technologies, cat. no. )

    Multiple Displacement Amplification:

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: .. The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water. .. The MDA master mix, except SYTO 9, was ultraviolet decontaminated for 15 min at 4 °C in a UVP Ultraviolet CL-1000 Crosslinker as described in detail .

    Isolation:

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Beads were washed three times with 500 μl M-280 high salt wash and twice with 500 μl M-280 low salt wash. Beads were then resuspended with Trizol LS and RNA was isolated. .. Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C.

    Article Title: A Population-Based Assessment of the Impact of 7- and 13-Valent Pneumococcal Conjugate Vaccines on Macrolide-Resistant Invasive Pneumococcal Disease: Emergence and Decline of Streptococcus pneumoniae Serotype 19A (CC320) With Dual Macrolide Resistance Mechanisms
    Article Snippet: Genomic DNA was isolated from erythromycin nonsusceptible strains using crude lysis [ ] or InstaGene Matrix (BioRad). .. OneTaq DNA polymerase and deoxynucleotide solution mix (New England Biolabs) were used.

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: For real-time PCR assays, total RNA was isolated using the PureLink RNA minikit (Life Technologies). .. RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs).

    Size-exclusion Chromatography:

    Article Title: Fetal exposure to bisphenol A as a risk factor for the development of childhood asthma: an animal model study
    Article Snippet: Real-time reactions composed of cDNA, gene-specific 20X TaqMan probes with Deoxynucleotide Solution Mix (New England BioLabs) and Taq DNA Polymerase (New England BioLabs) were performed in duplicate. .. Reaction conditions were as follows: initial setup at 50°C for 2 min and at 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec, and 60°C for 1 min. Real-time reactions were performed on iQ5 Multicolor Real-time PCR Detection system (BIO-RAD) and data were obtained as Ct values.

    Labeling:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Purification:

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Libraries were purified using a MinElute PCR Purification Kit (QIAGEN 28004), verified to be free of radiation, and size-selected for 140–400 bp using a BluePippin 2% Agarose Gel Cassette (Sage Science BDF2010).

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: Dimethyl sulfoxide (DMSO) (BioLabs, cat. no. B0515A) Agencourt AMPure XP - PCR Purification (Beckman Coulter, cat. no. ) SuperScript III Reverse Transcriptase (200 U μL-1 , Invitrogen, cat. no. 18080-044) supplied with 0.1 M DTT and 5x first-strand buffer Trehalose 1.57 M dissolved in water from solid (Sigma, cat. no. T3663) RNase H (10 U μL-1 , Epicenter, cat. no. R0601K) RNase Cocktail (0.5U μL-1 RNase A and 20 U μL-1 RNase T1, Invitrogen, cat. no. AM2286) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB, cat. no. M0531S) Agarose (Sigma, cat. no. A9539) TBE (for 1 L 10x solution mix 108 g Tris base (Trizma, Sigma, cat. no. T1503), 55 g boric acid (Merck, cat. no.100162), 960 ml water and 40 ml 0.5 M EDTA, pH 8.0. .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484).

    Article Title: Matrix stiffening promotes a tumor vasculature phenotype
    Article Snippet: Total RNA was collected and purified with an RNeasy Plus Mini Kit (Qiagen). .. To generate cDNA, 1 μg of total RNA per sample was mixed with 80-μM random primers (Invitrogen), 10 mM deoxynucleotide solution mix (New England Biolabs), and nuclease-free water and was heated for 5 min at 75 °C.

    Polymerase Chain Reaction:

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. ..

    Article Title: Fetal exposure to bisphenol A as a risk factor for the development of childhood asthma: an animal model study
    Article Snippet: Paragraph title: RT-Real-time PCR ... Real-time reactions composed of cDNA, gene-specific 20X TaqMan probes with Deoxynucleotide Solution Mix (New England BioLabs) and Taq DNA Polymerase (New England BioLabs) were performed in duplicate.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Reverse transcribed samples were volume up to 26 μl with H2 O and 2 μl was set aside and serial-diluted to test PCR conditions as described in ( ).

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: Dimethyl sulfoxide (DMSO) (BioLabs, cat. no. B0515A) Agencourt AMPure XP - PCR Purification (Beckman Coulter, cat. no. ) SuperScript III Reverse Transcriptase (200 U μL-1 , Invitrogen, cat. no. 18080-044) supplied with 0.1 M DTT and 5x first-strand buffer Trehalose 1.57 M dissolved in water from solid (Sigma, cat. no. T3663) RNase H (10 U μL-1 , Epicenter, cat. no. R0601K) RNase Cocktail (0.5U μL-1 RNase A and 20 U μL-1 RNase T1, Invitrogen, cat. no. AM2286) Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB, cat. no. M0531S) Agarose (Sigma, cat. no. A9539) TBE (for 1 L 10x solution mix 108 g Tris base (Trizma, Sigma, cat. no. T1503), 55 g boric acid (Merck, cat. no.100162), 960 ml water and 40 ml 0.5 M EDTA, pH 8.0. .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484).

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. Virus detection via qRT-PCR NCBI GenBank accession numbers for SCN viral sequences are HM849038 (ScNV), HM849039 (ScRV), HM849040 (ScPV), HM849041 (ScTV) and KF726084 (SbCNV-5).

    Article Title: Giantin-knockout models reveal a feedback loop between Golgi function and glycosyltransferase expression
    Article Snippet: .. To identify mutations, genomic DNA was prepared using a Purelink genomic DNA mini kit (Invitrogen) and the region targeted by the gRNAs amplified by PCR [primers: forward, 5′-CTGGGTCTGGTTGTTGTTGGT-3′; reverse, 5′-GGTGTCATGTTGGTGCTCAG-3′; reaction mix: Taq DNA polymerase with Thermopol buffer, 10 mM dNTP mix, 10 μM each primer and 2 μl genomic DNA; reagents from NEB (M0267L, N0447L)]. .. PCR products were cloned into the pGEM T Easy vector according to the manufacturer's instructions (Promega) and sequenced using predesigned primers against the T7 promoter (MWG Eurofins).

    Article Title: A Population-Based Assessment of the Impact of 7- and 13-Valent Pneumococcal Conjugate Vaccines on Macrolide-Resistant Invasive Pneumococcal Disease: Emergence and Decline of Streptococcus pneumoniae Serotype 19A (CC320) With Dual Macrolide Resistance Mechanisms
    Article Snippet: OneTaq DNA polymerase and deoxynucleotide solution mix (New England Biolabs) were used. .. PCR amplification of erm (B) of a 551 bp product was performed using primers KG1F (5ʹ-TTGGAACAGGTAAAGGGCATT) and KG1R2 (5ʹ-TTTGGCGTGTTTCATTGCTTG) [ ].

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: Petri dishes (Falcon cat. no. 351029) Culture tubes (Corning cat. no. 352051) 24-well tissue culture dishes (Costar cat. no. 3524) Parafilm (VWR cat. no. 291–1214) T12.5 tissue culture flasks (Falcon cat. no. 353018) 15 cm tissue culture dishes (Falcon cat. no. 353025) Cell scrapers (Costar cat. no. 3010) PCR tubes (BioRad cat. no. TF102010) Cryotubes (Thermo Scientific cat. no. 5000–0012) 27½ -gauge needles (BD cat. no. 305109) CAUTION Exercise extreme care when handling live T. gondii with sharps. .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol.

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: .. RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs). .. Real-time PCR was performed on the resulting cDNAs using iTaq Universal SYBR Green Supermix (Bio-Rad).

    Article Title: Mechanical Disruption of Lysis-Resistant Bacterial Cells by Use of a Miniature, Low-Power, Disposable Device ▿Mechanical Disruption of Lysis-Resistant Bacterial Cells by Use of a Miniature, Low-Power, Disposable Device ▿ †
    Article Snippet: Standard Taq buffer (B9014S), Taq DNA polymerase (M0273L), and deoxynucleotide triphosphate (dNTP; N0447S) were purchased from New England Biolabs. .. Uracil DNA glycosylase (catalog no. 78310) and PCR nucleotide mix with dUTP (catalog no. 77330) were acquired from USB (Cleveland, OH).

    CRISPR:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: Blunt needles (SAI Infusion cat. no. B27–50) can be used as an alternative. pU6-SAG1 (Addgene cat. no. 80322) Lourido Toxoplasma CRISPR Library V1 (Addgene cat. no. 80636) pU6-DHFR (Addgene cat. no. 80329) pCas9-CAT (Addgene cat. no. 80323) pU6-Decoy (Addgene cat. no. 80324) Ampicillin (Sigma-Aldrich-Aldrich cat. no. A0166–25G) Glycerol (EMD cat. no. GX0185–6) Methanol-Free Formaldehyde (Thermo Scientific cat. no. 28908) Prolong Gold (Invitrogen cat. no. P1044) Molecular biology-grade water (e.g., from an EMD Millipore Milii-Q Integral System, Fisher Scientific cat. no. ZRXQ003US) Gentamicin (Gibco cat. no. 15710–064) EGTA (Sigma-Aldrich cat. no. E4378–500G) HEPES (Sigma-Aldrich cat. no. 3375–1KG) KH2 PO4 (Sigma-Aldrich cat. no. P5655) K2 HPO4 (Sigma-Aldrich cat. no. 1551128) KCl (Fisher Scientific cat. no. SP138–500) MgCl2 (Mallinckrodt cat. no. 5958) Methanol for HPLC gradient analysis (Millipore, cat. No. 67–56-1) EDTA (Amresco cat. no. 0322–500G) Tris base (Sigma-Aldrich cat. no. TRIS-RO) Glacial acetic acid (Spectrum cat. no. A1010) CAUTION Glacial acetic acid is corrosive; avoid contact with eyes, skin, and clothing; wear protective gloves while handling. .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol.

    IA:

    Article Title: Mechanical Disruption of Lysis-Resistant Bacterial Cells by Use of a Miniature, Low-Power, Disposable Device ▿Mechanical Disruption of Lysis-Resistant Bacterial Cells by Use of a Miniature, Low-Power, Disposable Device ▿ †
    Article Snippet: Standard Taq buffer (B9014S), Taq DNA polymerase (M0273L), and deoxynucleotide triphosphate (dNTP; N0447S) were purchased from New England Biolabs. .. Oligonucleotide primers were ordered from Integrated DNA Technologies (Coralville, IA) and Sigma-Aldrich (St. Louis, MO).

    Agarose Gel Electrophoresis:

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Libraries were purified using a MinElute PCR Purification Kit (QIAGEN 28004), verified to be free of radiation, and size-selected for 140–400 bp using a BluePippin 2% Agarose Gel Cassette (Sage Science BDF2010).

    Plasmid Preparation:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484). .. T3 RNA polymerase (Promega, 10 U μL-1 , cat. no. P2083) including DTT (100 mM, cat. no. P117B) and Transcription Optimized 5x buffer (cat. no. P118B) Vaccinia Capping System (NEB, 10 U μL-1 , cat. no. M2080S) supplied with 10x Capping Buffer, S-adenosylmethionine (SAM, 32 mM) and GTP (10 mM) Agilent High Sensitivity DNA Kit (Agilent, cat. no. 5067-4626) CRITICAL: It should be taken out of the fridge in advance to reach room temperature (20-25°C) before its use.

    Article Title: Giantin-knockout models reveal a feedback loop between Golgi function and glycosyltransferase expression
    Article Snippet: Genome engineering RPE-1 cells were transfected as above with 1 μg each of paired gRNAs HSL0001186601 (ACCTGAGCACGGCCCACCAAGG) and HSR0001186603 (GTCGTTGACTTGCTGCAACAGG) (obtained from Sigma) targeting the GOLGB1 gene plus 0.1 μg pSpCas9n(BB)-2A-GFP (Addgene plasmid, 48140 PX461; ). .. To identify mutations, genomic DNA was prepared using a Purelink genomic DNA mini kit (Invitrogen) and the region targeted by the gRNAs amplified by PCR [primers: forward, 5′-CTGGGTCTGGTTGTTGTTGGT-3′; reverse, 5′-GGTGTCATGTTGGTGCTCAG-3′; reaction mix: Taq DNA polymerase with Thermopol buffer, 10 mM dNTP mix, 10 μM each primer and 2 μl genomic DNA; reagents from NEB (M0267L, N0447L)].

    SYBR Green Assay:

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. Across PPN species, 18S rRNA was used as an internal control as other regions tested were too variable. qRT-PCR products were amplified using 0.5 μM of each appropriate primer pair, 10 μl iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA), and 1 μl cDNA.

    Article Title: Matrix stiffening promotes a tumor vasculature phenotype
    Article Snippet: To generate cDNA, 1 μg of total RNA per sample was mixed with 80-μM random primers (Invitrogen), 10 mM deoxynucleotide solution mix (New England Biolabs), and nuclease-free water and was heated for 5 min at 75 °C. .. Quantitative RT-PCR was performed with 1 μg of cDNA and 0.4 μM of specific primers against MMP14 (forward: 5′-TGTGACGGGAACTTTGACACCG-3′; reverse: 5′-ACGCTGCCCTTGAAACTGTGGC-3′) and GAPDH (forward: 5′-CATGAGAAGTATGACAACAGCCT-3′; reverse: 5′-AGTCCTTCCACGATACCAAAGT-3′) (Integrated DNA Technologies) using 1× iQ SYBR Green Supermix (Bio-Rad) on a MyiQ Single-Color Real-Time PCR Detection System (Bio-Rad).

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs). .. Real-time PCR was performed on the resulting cDNAs using iTaq Universal SYBR Green Supermix (Bio-Rad).

    RNA Extraction:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Sample Prep:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Alterations in sample preparation were made for cysts in which a motorized pestle was first used to improve sample destruction. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Homogenization:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Samples were prepared for total RNA extraction by homogenization with three 3-mm glass beads in a 1.5 ml tube on a Silamat S6 (Ivoclar Vivadent, Amherst, NY). .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Next-Generation Sequencing:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol. .. RH (American Type Culture Collection cat. no. 50174) Hanks’ Balanced Salts (Sigma-Aldrich cat. no. H2387–10X1L) Dulbecco’s Modified Eagle Medium (DMEM) (Sigma cat. no. D7777–10L) LB Agar (BD cat. no. 244510) LB (Bio Basic Inc. cat. no. SD7002)

    Concentration Assay:

    Article Title: Genome-wide identification of transcript start and end sites by Transcript Isoform Sequencing, TIF-Seq
    Article Snippet: .. T4 DNA ligase (NEB, 2000 U μL-1 , cat. no. M0202T) supplied with 10x T4 DNA Ligase Reaction Buffer BSA, Molecular Biology Grade (20 mg mL-1 , NEB, cat. no. B9000S) Plasmid-Safe ATP-Dependent DNase (10 U μL-1 , Epicentre, cat. no. E3101K) microTUBE AFA Fiber Pre-Slit Snap-Cap 6×16mm (Covaris, cat. no. 520045) Dynabeads M-280 streptavidin (Invitrogen, cat. no. 11205D) Bind and Wash buffer (B & W) (for a 2x concentration: 10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0 and 2 M NaCl in water) NEBNext End Repair Module (NEB, cat. no. E6050S) including NEBNext End Repair Enzyme Mix and 10x NEBNext End Repair Reaction Buffer Klenow Fragment (3′→5′ exo-) (NEB, 5 U μL-1 , cat. no. M0212S) supplied with 10x NEBuffer 2 (10x, NEB, cat. no. B7002S) dA tailing buffer (NEBuffer 2 (NEB, cat. no. B7002S) supplemented with 2 mM dATP) dATP 100 mM (BioLabs, cat. no. N0440S) dNTP mix 10 mM (BioLabs, cat no. N0447L) Quick Ligation Kit (NEB, cat. no. M2200S) including 2x Quick Ligation Buffer and Quick T4 DNA Ligase IVT spike-ins derived from B. subtilis (ATCC cat. no. 87482, 87483 and 87484). .. T3 RNA polymerase (Promega, 10 U μL-1 , cat. no. P2083) including DTT (100 mM, cat. no. P117B) and Transcription Optimized 5x buffer (cat. no. P118B) Vaccinia Capping System (NEB, 10 U μL-1 , cat. no. M2080S) supplied with 10x Capping Buffer, S-adenosylmethionine (SAM, 32 mM) and GTP (10 mM) Agilent High Sensitivity DNA Kit (Agilent, cat. no. 5067-4626) CRITICAL: It should be taken out of the fridge in advance to reach room temperature (20-25°C) before its use.

    CTG Assay:

    Article Title: SLC30A10 Is a Cell Surface-Localized Manganese Efflux Transporter, and Parkinsonism-Causing Mutations Block Its Intracellular Trafficking and Efflux Activity
    Article Snippet: RNA was reverse transcribed to cDNA using multiscribe reverse transcriptase, GeneAmp PCR Buffer II, MgCl2 , RNase inhibitor, random hexamers (Life Technologies), and deoxynucleotide solution mix (New England Biolabs). .. Primers used to amplify GAPDH were as follows: forward, 5′ ATG ATT CTA CCC ACG GCA AG 3′ and reverse, 5′ CTG GAA GAT GGT GAT GGG TT 3′.

    Lysis:

    Article Title: A Population-Based Assessment of the Impact of 7- and 13-Valent Pneumococcal Conjugate Vaccines on Macrolide-Resistant Invasive Pneumococcal Disease: Emergence and Decline of Streptococcus pneumoniae Serotype 19A (CC320) With Dual Macrolide Resistance Mechanisms
    Article Snippet: Genomic DNA was isolated from erythromycin nonsusceptible strains using crude lysis [ ] or InstaGene Matrix (BioRad). .. OneTaq DNA polymerase and deoxynucleotide solution mix (New England Biolabs) were used.

    Article Title: Single-virus genomics reveals hidden cosmopolitan and abundant viruses
    Article Snippet: KOH lysis reaction was stopped either with 0.7 μl of Tris-HCl pH 4 or 0.7 μl of Stop solution (Qiagen, ref. 1032393) per well. .. The master mix MDA reaction contained 0.26 μl of phi29 DNA polymerase (ref. M0269L; 10 U μl−1 ; New England Biolab), 1 μl of Phi29 10 × reaction buffer (ref. M0269L; New England Biolab), 1 μl of hexamers (0.5 mM; IDT), 0.1 μl of DTT (1 M; Sigma), 0.4 μl of dNTPs (10 mM each; ref. N0447L, New England Biolab), 0.002 μl of SYTO 9 (Invitrogen) and 5.2 μl of sterile ultraviolet 16 h-treated mQ water.

    Hood:

    Article Title: CRISPR/Cas9-based genome-wide screening of Toxoplasma gondii
    Article Snippet: 16% Formaldehyde (w/v), Methanol-free (Life Technologies cat. no. 28908) CAUTION Formaldehyde is toxic; use in a fume hood. .. Heat-inactivated Fetal Bovine Serum (FBS, Sigma-Aldrich cat. no. F4135–500ML) Normal Goat Serum (NGS, Sigma-Aldrich cat. no. G6767–500ML) Triton X-100 (Sigma-Aldrich cat. no. T8787–100ML) Hoechst (Santa Cruz cat. no. 33258) Oligonucleotide pool (CustomArray) Primers (Sigma-Aldrich) dNTPs (New England Biolabs cat. no. N0447S) Agarose (Invitrogen cat. no. 16500–500) Sybr Safe (Invitrogen cat. no. S33102) Alexa488-conjugated goat anti-mouse (Life Sciences cat. no. ) Alexa594-conjugated goat anti-rabbit (Life Sciences cat. no. ) Mouse anti-FLAG (Sigma-Aldrich cat. no. F1804–50UG) Counterstain antibody not made in a mouse DG-52 mouse anti-SAG1 Alexa-488 labeling kit (Life Technology ) Midiprep kit (Macherey-Nagel cat. no. 740412.50) Miniprep kit (Zymo cat. no. D4054) DNeasy DNA extraction kit (Qiagen cat. no. 69504) QIAquick gel extraction kit (Qiagen cat. no. 28706) Gibson Assembly (New England Biolabs cat. no. E2611L) E. cloni 10G Supreme electrocompetent cells (VWR cat. no. 95024–012) AseI and associated NEBuffer 3.1 (New England Biolabs cat. no. R0526L) DNaseI (Sigma-Aldrich cat. no. DN25–100MG) Trypsin (Worthington cat. no. ) iProof and HF buffer (BioRad cat. no. 422840) Q5 DNA Polymerase (NEB cat. no. M0491L) BsaI and associated Buffer G (Thermo Scientific cat. no. ER0291) Calf Intestinal Phosphatase (CIP, New England Biolabs cat. no. M0290S) HFF cells (American Type Culture Collection cat. no. SCRC-1041) RH/Cas9 (American Type Culture Collection or by request) CAUTION Check for Cas9 expression and function before starting a screen by following steps 1–25 in the protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs dntp mix
    Dntp Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 958 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mix/product/New England Biolabs
    Average 90 stars, based on 958 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs n0440s dntp mix
    N0440s Dntp Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n0440s dntp mix/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    n0440s dntp mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results