Structured Review

Genecraft dntp
Dntp, supplied by Genecraft, used in various techniques. Bioz Stars score: 97/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Genecraft
Average 97 stars, based on 29 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-03
97/100 stars

Images

Related Articles

Amplification:

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: Polymerase chain reactions (PCR) were performed in a 20-μl volume containing 100 ng of genomic DNA, 1× PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 0.2 μM of each primer, and 0.5 U of Taq DNA polymerase (GeneCraft, Münster, Germany). .. The PCR products were checked for specific amplification on 1.5% agarose gels and purified with Agencourt AMPure XP (Beckman Coulter, Krefeld, Germany) and sequenced in either forward or reverse direction using an ABI3130 DNA Analyzer.

Article Title: Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae) 1
Article Snippet: Twenty-one candidate microsatellite primers, which amplified putative single loci, were selected to screen polymorphic markers and labeled with fluorescent dye (FAM). .. PCR was performed in 11-μL reactions containing 9 ng of template DNA, 1.5 or 2.5 mM MgCl2 , 200 μM of each dNTP, 0.2 μM of 6-FAM fluorescent dye–labeled forward primer and reverse primer, 0.75 units of NeoTherm Taq DNA polymerase (GeneCraft, Hulme, United Kingdom), and 1× reaction buffer (GeneCraft).

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: .. This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA. .. PCRs were performed in 96-well microtiter plates (Thermowell Costar Corning, NY).

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above. ..

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: Each primer pair was tested for specificity, polymorphism, and cross-species amplification on high-resolution agarose gels before continuing to fluorescent-labeled genotyping. .. PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany).

Article Title: Genetic population structure and relatedness in the narrow‐striped mongoose (Mungotictis decemlineata), a social Malagasy carnivore with sexual segregation
Article Snippet: We amplified a fragment of the mtDNA control region (d‐loop) via PCR, using the mammalian primers ProL‐He (5′‐ATACTCCTACCATCAACACCCAAAG‐3′) and DLH‐He (5′‐GTCCTGAAGAAAGAACCAGATGTC‐3′; Seddon et al. ). .. In a 30 μ L reaction, 2 μ L DNA extract (50 ng), 18.4 μ L H2 O, 3 μ L 10× buffer (containing MgCl2 15 mmol/L), 0.1 μ L of each primer (100 pmol/μ L), 0.2 μ L dNTP (25 mmol/L), 4.0 μ L BT (10 mg bovine serum albumin [BSA] + 0.5% Triton), and 0.2 μ L BioTherm™ Taq DNA polymerase (5 units/μ L, GeneCraft® , Ares Bioscience GmbH, Köln, Germany) were used.

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. Samples were amplified using an initial denaturation step at 94 °C (for 3 min), followed by 35 cycles of denaturation at 94 °C (1 min), annealing at 55 °C (for 1 min), and an extension at 72 °C (for 1 min).

Article Title: Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta). Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta)
Article Snippet: Each forward primer was extended at the 5′ end with an adapter (5′‐CACGACGTTGTAAAACGAC‐3′) for annealing during amplification to a fluorescent label with the same extension. .. Microsatellite PCR's consisting of 1 μl of DNA template (1:10 diluted), 0.2 mmol/L dNTP, 1× Taq buffer, 0.5 μmol/L of each primer, 1 μmol/L fluorescent label, 0.4 μl BSA (20 mg/ml), and 0.5 unit Taq polymerase (BiothermPlus, GeneCraft, Germany) in a total volume of 20 μl were run on a BioRad T100 thermocycler (BioRad, USA) with initial denaturation at 94°C for 4 min, 41 cycles at 94°C for 30 s, 52°C annealing for 30 s, extension at 72°C for 40 s and final extension at 72°C for 10 min. Electrophoresis was carried out on ABI capillary sequencers at Baseclear B.V. (Leiden, the Netherlands; Table ) and the raw data processed using GeneMapper (Applied Biosystems, v4.0).

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: .. The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The tubes were then subjected to thermal cycling (Gene Amp PCR System 2400; Perkin Elmer, Germany): 1 × 94℃ for 180 sec; 30 × (94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 70 sec); and 1 × 72℃ for 300 sec.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above. .. To detect PCR products from conventional PCR, 3 μL of each PCR product was subjected to electrophoresis on a 2% agarose gel.

Synthesized:

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: Both oligonucleotide primers were synthesized by Operon (Germany). .. The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O.

Neutralization:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: After cell lysis and neutralization, 1.5 mM/L MgCl2 , 200 µM/L of each dNTP (Roche Diagnostics GmbH, Mannheim, Germany), 1 IU Supertherm DNA polymerase (JMR HOLDINGS, London, U.K.) and 0.5 µM/L of each outer primers, were added to each tube for a total volume of 30 µL. .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: After cell lysis and neutralization, 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP (Roche Diagnostics GmbH, Mannheim, Germany), 1 IU Neotherm DNA Polymerase (GeneCraft Co., Munster, Germany) and 2 pmol of each outer primer were added to each tube in a total volume of 30 μL. .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

Autoradiography:

Article Title: AZT resistance of simian foamy virus reverse transcriptase is based on the excision of AZTMP in the presence of ATP
Article Snippet: Reaction mixtures contained 6 nM of primer/template substrate (P/T), 85 nM of PR–RT, 150 μM of each dNTP and increasing concentrations of AZTTP (GeneCraft GmbH, Lüdinghausen, Germany) in a total volume of 10 μl. .. The reaction products were visualized by autoradiography or phosphoimaging and quantitated by densitometry using a phosphoimaging device (FLA 3000, raytest, Straubenhardt, Germany).

Terminal Restriction Fragment Length Polymorphism:

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Paragraph title: T-RFLP ... Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma).

Electrophoresis:

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany). .. The markers were then thoroughly screened by amplification with fluorescent-labeled primers and separation of PCR products by capillary electrophoresis.

Article Title: Genetic population structure and relatedness in the narrow‐striped mongoose (Mungotictis decemlineata), a social Malagasy carnivore with sexual segregation
Article Snippet: In a 30 μ L reaction, 2 μ L DNA extract (50 ng), 18.4 μ L H2 O, 3 μ L 10× buffer (containing MgCl2 15 mmol/L), 0.1 μ L of each primer (100 pmol/μ L), 0.2 μ L dNTP (25 mmol/L), 4.0 μ L BT (10 mg bovine serum albumin [BSA] + 0.5% Triton), and 0.2 μ L BioTherm™ Taq DNA polymerase (5 units/μ L, GeneCraft® , Ares Bioscience GmbH, Köln, Germany) were used. .. Amplification success was validated by visualization of PCR products under UV light (312 nm) after electrophoresis on a 1% agarose gel (Gelred™; Biotium Inc., Hayward, CA).

Article Title: Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta). Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta)
Article Snippet: .. Microsatellite PCR's consisting of 1 μl of DNA template (1:10 diluted), 0.2 mmol/L dNTP, 1× Taq buffer, 0.5 μmol/L of each primer, 1 μmol/L fluorescent label, 0.4 μl BSA (20 mg/ml), and 0.5 unit Taq polymerase (BiothermPlus, GeneCraft, Germany) in a total volume of 20 μl were run on a BioRad T100 thermocycler (BioRad, USA) with initial denaturation at 94°C for 4 min, 41 cycles at 94°C for 30 s, 52°C annealing for 30 s, extension at 72°C for 40 s and final extension at 72°C for 10 min. Electrophoresis was carried out on ABI capillary sequencers at Baseclear B.V. (Leiden, the Netherlands; Table ) and the raw data processed using GeneMapper (Applied Biosystems, v4.0). ..

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The presence of PCR products was determined by electrophoresis of 10 µl of reaction product on a 1.5% agarose gel (Gibco BRL, Germany) with Tris-acetate electrophoresis buffer (TAE, 4.0 mmol/l Tris-HCl, 1 mmol/l EDTA, pH 8.0) and visualized under UV light (Image Master VDS; Pharmacia Biotech, Germany).

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above. .. To detect PCR products from conventional PCR, 3 μL of each PCR product was subjected to electrophoresis on a 2% agarose gel.

Incubation:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: Cell lysis and PCR procedure The lymphocytes and blastomeres were prepared with alkaline lysis buffer at 65℃ for 10 min incubation. .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: Cell lysis and multiplex nested PCR procedure The cells were lysed by incubation with alkaline lysis buffer at 65℃ for 10 minutes. .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

In Silico:

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: For the in silico detection of DNA polymorphisms, sequence data of candidate genes were retrieved from the Ensembl genome browser, based on Sus scrofa genome build 10.2 (Ensembl 89; accessed on July 2017). .. Polymerase chain reactions (PCR) were performed in a 20-μl volume containing 100 ng of genomic DNA, 1× PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 0.2 μM of each primer, and 0.5 U of Taq DNA polymerase (GeneCraft, Münster, Germany).

Touchdown PCR:

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA. .. A "touchdown" PCR procedure was applied in a thermocycler (Biometra, Göttingen, Germany): initial denaturation (5 min at 95 °C), two initial cycles 6 °C and 3 °C above the annealing temperature, 40 cycles of 95 °C (30 s), annealing temperature of 53 °C (30 s), elongation at 72 °C (30 s) and a final elongation step at 72 °C (3 min).

Polymerase Chain Reaction:

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: .. Polymerase chain reactions (PCR) were performed in a 20-μl volume containing 100 ng of genomic DNA, 1× PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 0.2 μM of each primer, and 0.5 U of Taq DNA polymerase (GeneCraft, Münster, Germany). .. The PCR procedures were performed via initial denaturing at 94 °C for 4 min followed by 40 cycles of 30 s at 94 °C, 30 s at 60 °C, 1 min at 72 °C, and final elongation of 5 min at 72 °C.

Article Title: Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae) 1
Article Snippet: .. PCR was performed in 11-μL reactions containing 9 ng of template DNA, 1.5 or 2.5 mM MgCl2 , 200 μM of each dNTP, 0.2 μM of 6-FAM fluorescent dye–labeled forward primer and reverse primer, 0.75 units of NeoTherm Taq DNA polymerase (GeneCraft, Hulme, United Kingdom), and 1× reaction buffer (GeneCraft). .. The PCR cycling was conducted as follows: 5 min at 94°C for predenaturation; 34 cycles of 30 s at 94°C, 1 min at 54–62°C for each primer, and 1 min at 72°C; and a final extension for 10 min at 72°C.

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: .. This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA. .. PCRs were performed in 96-well microtiter plates (Thermowell Costar Corning, NY).

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above. ..

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: .. PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany). ..

Article Title: Association of variation in the LAMA3 gene, encoding the alpha-chain of laminin 5, with atopic dermatitis in a German case–control cohort
Article Snippet: .. PCR was done in a total volume of 10 μl, containing 40 ng DNA, 200 mmol of each dNTP, 1.5-3 mmol MgCl2 , 5 pmol of each primer, and 0.5 U Taq-DNA-polymerase (Genecraft, Münster, Germany) on the RoboCycler or Biometra T cycler (Stratagene, Heidelberg, Germany and Biometra GmbH, Göttingen, Germany, respectively). .. PCR products were subsequently digested with the respective restriction enzyme, the fragments separated on 2.5%-3.5% agarose gels in 1xTBE buffer (30–60 min, 200 V) and visualized with ethidium bromide (0.5% [w/v]).

Article Title: Identification of the Novel Candidate Genes and Variants in Boar Liver Tissues with Divergent Skatole Levels Using RNA Deep Sequencing
Article Snippet: .. Polymerase chain reactions (PCR) were performed in a 20 µl volume containing 2 µl of genomic DNA, 1 × PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 5 pM of each primer and 0.1 U of Taq DNA polymerase (GeneCraft). .. The PCR product was checked on 1.5% agarose gel (Fischer Scientific Ltd) and digested by using the appropriate restriction enzyme ( ).

Article Title: Genetic population structure and relatedness in the narrow‐striped mongoose (Mungotictis decemlineata), a social Malagasy carnivore with sexual segregation
Article Snippet: We amplified a fragment of the mtDNA control region (d‐loop) via PCR, using the mammalian primers ProL‐He (5′‐ATACTCCTACCATCAACACCCAAAG‐3′) and DLH‐He (5′‐GTCCTGAAGAAAGAACCAGATGTC‐3′; Seddon et al. ). .. In a 30 μ L reaction, 2 μ L DNA extract (50 ng), 18.4 μ L H2 O, 3 μ L 10× buffer (containing MgCl2 15 mmol/L), 0.1 μ L of each primer (100 pmol/μ L), 0.2 μ L dNTP (25 mmol/L), 4.0 μ L BT (10 mg bovine serum albumin [BSA] + 0.5% Triton), and 0.2 μ L BioTherm™ Taq DNA polymerase (5 units/μ L, GeneCraft® , Ares Bioscience GmbH, Köln, Germany) were used.

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: .. Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. Samples were amplified using an initial denaturation step at 94 °C (for 3 min), followed by 35 cycles of denaturation at 94 °C (1 min), annealing at 55 °C (for 1 min), and an extension at 72 °C (for 1 min).

Article Title: Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta). Strong population structure but no equilibrium yet: Genetic connectivity and phylogeography in the kelp Saccharina latissima (Laminariales, Phaeophyta)
Article Snippet: .. Microsatellite PCR's consisting of 1 μl of DNA template (1:10 diluted), 0.2 mmol/L dNTP, 1× Taq buffer, 0.5 μmol/L of each primer, 1 μmol/L fluorescent label, 0.4 μl BSA (20 mg/ml), and 0.5 unit Taq polymerase (BiothermPlus, GeneCraft, Germany) in a total volume of 20 μl were run on a BioRad T100 thermocycler (BioRad, USA) with initial denaturation at 94°C for 4 min, 41 cycles at 94°C for 30 s, 52°C annealing for 30 s, extension at 72°C for 40 s and final extension at 72°C for 10 min. Electrophoresis was carried out on ABI capillary sequencers at Baseclear B.V. (Leiden, the Netherlands; Table ) and the raw data processed using GeneMapper (Applied Biosystems, v4.0). ..

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The tubes were then subjected to thermal cycling (Gene Amp PCR System 2400; Perkin Elmer, Germany): 1 × 94℃ for 180 sec; 30 × (94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 70 sec); and 1 × 72℃ for 300 sec.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above. .. To detect PCR products from conventional PCR, 3 μL of each PCR product was subjected to electrophoresis on a 2% agarose gel.

Staining:

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. The PCR products were purified on a 1.0% agarose gel after staining with SybrGold (Molecular Probes, Invitrogen, Carlsbad, CA).

Nucleic Acid Electrophoresis:

Article Title: AZT resistance of simian foamy virus reverse transcriptase is based on the excision of AZTMP in the presence of ATP
Article Snippet: Reaction mixtures contained 6 nM of primer/template substrate (P/T), 85 nM of PR–RT, 150 μM of each dNTP and increasing concentrations of AZTTP (GeneCraft GmbH, Lüdinghausen, Germany) in a total volume of 10 μl. .. Reactions were stopped by adding 10 μl of urea loading buffer [1 mM EDTA, 0.1% xylene cyanole, 0.1% bromophenol blue, 8 M urea in 1 × TBE (Tris/Borate/EDTA)] and analyzed by denaturing gel electrophoresis (10% polyacrylamide, 7 M urea).

Mutagenesis:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: The PCR strategy consisted of the first PCR followed by the hemi-nested PCR for the mutation of the HADHA gene. .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Size-exclusion Chromatography:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: The first round of PCR involved a 96℃ denaturation temperature for 10 min as a means to reduce ADO, followed by 25 cycles consisting of 95℃ for 40 sec, 62℃ for 1 min and 72℃ for 1 min, and followed by a final extension step of 10 min at 72℃ on a GeneAmp PCR System 2700 (Applied Biosystems, Foster City, CA, U.S.A.). .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The tubes were then subjected to thermal cycling (Gene Amp PCR System 2400; Perkin Elmer, Germany): 1 × 94℃ for 180 sec; 30 × (94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 70 sec); and 1 × 72℃ for 300 sec.

Labeling:

Article Title: Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae) 1
Article Snippet: Twenty-one candidate microsatellite primers, which amplified putative single loci, were selected to screen polymorphic markers and labeled with fluorescent dye (FAM). .. PCR was performed in 11-μL reactions containing 9 ng of template DNA, 1.5 or 2.5 mM MgCl2 , 200 μM of each dNTP, 0.2 μM of 6-FAM fluorescent dye–labeled forward primer and reverse primer, 0.75 units of NeoTherm Taq DNA polymerase (GeneCraft, Hulme, United Kingdom), and 1× reaction buffer (GeneCraft).

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: .. This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA. .. PCRs were performed in 96-well microtiter plates (Thermowell Costar Corning, NY).

Purification:

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: Polymerase chain reactions (PCR) were performed in a 20-μl volume containing 100 ng of genomic DNA, 1× PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 0.2 μM of each primer, and 0.5 U of Taq DNA polymerase (GeneCraft, Münster, Germany). .. The PCR products were checked for specific amplification on 1.5% agarose gels and purified with Agencourt AMPure XP (Beckman Coulter, Krefeld, Germany) and sequenced in either forward or reverse direction using an ABI3130 DNA Analyzer.

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. The PCR products were purified on a 1.0% agarose gel after staining with SybrGold (Molecular Probes, Invitrogen, Carlsbad, CA).

Sequencing:

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: Selected SNPs (Table ) were screened for segregation by comparative sequencing of PCR fragments in pooled samples of animals with either low or high serum P levels. .. Polymerase chain reactions (PCR) were performed in a 20-μl volume containing 100 ng of genomic DNA, 1× PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 0.2 μM of each primer, and 0.5 U of Taq DNA polymerase (GeneCraft, Münster, Germany).

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: .. This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA. .. PCRs were performed in 96-well microtiter plates (Thermowell Costar Corning, NY).

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: Eighteen positive library colonies were selected for sequencing, from which 11 microsatellites were designed and tested. .. PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany).

Article Title: Genetic population structure and relatedness in the narrow‐striped mongoose (Mungotictis decemlineata), a social Malagasy carnivore with sexual segregation
Article Snippet: In a 30 μ L reaction, 2 μ L DNA extract (50 ng), 18.4 μ L H2 O, 3 μ L 10× buffer (containing MgCl2 15 mmol/L), 0.1 μ L of each primer (100 pmol/μ L), 0.2 μ L dNTP (25 mmol/L), 4.0 μ L BT (10 mg bovine serum albumin [BSA] + 0.5% Triton), and 0.2 μ L BioTherm™ Taq DNA polymerase (5 units/μ L, GeneCraft® , Ares Bioscience GmbH, Köln, Germany) were used. .. To reduce the chance of sequencing mitochondrial pseudogenes in the nuclear genome (numts), we also amplified 31 (37%) of the sequences by long‐template PCR.

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: The oligonucleotide primers used had the sequence 5'-GAACACGTTTTTCAGCCATATCTCC-3' and 5'-CGATTACAGTTGCCAATACCGTTTC-3' for sheta and 5'-GAGGCTTTACAGCCAAAATTATATGCTAG-3' and 5'-CAAATCGCTTCCTAGAGTATCTATTTTTTG-3' for shetb . .. The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: The PCR strategy consisted of initial multiplex PCR followed by multiplex nested fluorescent PCR specific for linked markers, or nested PCR followed by direct sequencing for mutated loci of the causative gene. .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

Blocking Assay:

Article Title: Association of variation in the LAMA3 gene, encoding the alpha-chain of laminin 5, with atopic dermatitis in a German case–control cohort
Article Snippet: We selected 29 SNPs in the three genes (17 in the LAMA3 gene, 8 in LAMB3, and 4 in LAMC2) that represented the haplotype block structures according to HapMap [ ]. .. PCR was done in a total volume of 10 μl, containing 40 ng DNA, 200 mmol of each dNTP, 1.5-3 mmol MgCl2 , 5 pmol of each primer, and 0.5 U Taq-DNA-polymerase (Genecraft, Münster, Germany) on the RoboCycler or Biometra T cycler (Stratagene, Heidelberg, Germany and Biometra GmbH, Göttingen, Germany, respectively).

Article Title: AZT resistance of simian foamy virus reverse transcriptase is based on the excision of AZTMP in the presence of ATP
Article Snippet: The 5′ 32 P-labeled M13 primer was hybridized to a 1.2-fold molar excess of the M13 DNA in a buffer containing 50 mM Tris/HCl, pH 8.0 and 80 mM KCl by heating to 95°C for 2 min, followed by a transfer to a heating block at 70°C and slow cooling to room temperature. .. Reaction mixtures contained 6 nM of primer/template substrate (P/T), 85 nM of PR–RT, 150 μM of each dNTP and increasing concentrations of AZTTP (GeneCraft GmbH, Lüdinghausen, Germany) in a total volume of 10 μl.

Lysis:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: Paragraph title: Cell lysis and PCR procedure ... For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: Paragraph title: 4. Cell lysis and multiplex nested PCR procedure ... For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

Nested PCR:

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: Paragraph title: 4. Cell lysis and multiplex nested PCR procedure ... For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

Software:

Article Title: Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae) 1
Article Snippet: PCR was performed in 11-μL reactions containing 9 ng of template DNA, 1.5 or 2.5 mM MgCl2 , 200 μM of each dNTP, 0.2 μM of 6-FAM fluorescent dye–labeled forward primer and reverse primer, 0.75 units of NeoTherm Taq DNA polymerase (GeneCraft, Hulme, United Kingdom), and 1× reaction buffer (GeneCraft). .. Those were visualized and scored using an ABI 3730 Genetic Analyzer (Applied Biosystems) and GeneMapper 4.1 software (Applied Biosystems).

Article Title: Haplotype-defined linkage region for gPRA in Schapendoes dogs
Article Snippet: PCR primers were designed using Primer Express software (PE Biosystems). .. This method requires three oligonucleotides for amplification: 1. tailed forward primer (tailed F), 2. reverse primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1-PCR buffer (Genecraft, Lüdinghausen, Germany), 0.2 mM each dNTP, 1.5 to 3 mM MgCl2 , 0.2 pmol tailed F, 2.5 pmol labeled F, 2.5 pmol reverse primer, 0.5 U BioTherm DNA Polymerase (Genecraft) and 50 ng DNA.

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: The primer sets were designed using the primer design software Primer3 , and were developed to amplify products ranging from 100 to 300 bp to help minimize later overlap ambiguities during multiloading genotyping projects. .. PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany).

Multiplex Assay:

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: Paragraph title: 4. Cell lysis and multiplex nested PCR procedure ... For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

Agarose Gel Electrophoresis:

Article Title: Identification of the Novel Candidate Genes and Variants in Boar Liver Tissues with Divergent Skatole Levels Using RNA Deep Sequencing
Article Snippet: Polymerase chain reactions (PCR) were performed in a 20 µl volume containing 2 µl of genomic DNA, 1 × PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 5 pM of each primer and 0.1 U of Taq DNA polymerase (GeneCraft). .. Polymerase chain reactions (PCR) were performed in a 20 µl volume containing 2 µl of genomic DNA, 1 × PCR buffer (with 1.5 mM MgCl2 ), 0.25 mM of dNTP, 5 pM of each primer and 0.1 U of Taq DNA polymerase (GeneCraft).

Article Title: Genetic population structure and relatedness in the narrow‐striped mongoose (Mungotictis decemlineata), a social Malagasy carnivore with sexual segregation
Article Snippet: In a 30 μ L reaction, 2 μ L DNA extract (50 ng), 18.4 μ L H2 O, 3 μ L 10× buffer (containing MgCl2 15 mmol/L), 0.1 μ L of each primer (100 pmol/μ L), 0.2 μ L dNTP (25 mmol/L), 4.0 μ L BT (10 mg bovine serum albumin [BSA] + 0.5% Triton), and 0.2 μ L BioTherm™ Taq DNA polymerase (5 units/μ L, GeneCraft® , Ares Bioscience GmbH, Köln, Germany) were used. .. Amplification success was validated by visualization of PCR products under UV light (312 nm) after electrophoresis on a 1% agarose gel (Gelred™; Biotium Inc., Hayward, CA).

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. The PCR products were purified on a 1.0% agarose gel after staining with SybrGold (Molecular Probes, Invitrogen, Carlsbad, CA).

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The presence of PCR products was determined by electrophoresis of 10 µl of reaction product on a 1.5% agarose gel (Gibco BRL, Germany) with Tris-acetate electrophoresis buffer (TAE, 4.0 mmol/l Tris-HCl, 1 mmol/l EDTA, pH 8.0) and visualized under UV light (Image Master VDS; Pharmacia Biotech, Germany).

Concentration Assay:

Article Title: Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins
Article Snippet: .. The reaction mixture for sheta and shetb amplification contained 0.7 µl of each primer (10 pmol/µl), 0.8 µl of dNTP (10 mmol; Genecraft, Germany), 2.0 µl of 10 × Biotherm buffer with a final concentration of 1.5 mM MgCl2 (Genecraft, Germany), 0.2 µl of Biotherm polymerase (Genecraft, Germany) and 13 µl of H2 O. .. The tubes were then subjected to thermal cycling (Gene Amp PCR System 2400; Perkin Elmer, Germany): 1 × 94℃ for 180 sec; 30 × (94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 70 sec); and 1 × 72℃ for 300 sec.

Alkaline Lysis:

Article Title: Identification of a Novel Single Nucleotide Polymorphism of HADHA Gene at a Referred Primer-binding Site During Pre-diagnostic Tests for Preimplantation Genetic Diagnosis
Article Snippet: Cell lysis and PCR procedure The lymphocytes and blastomeres were prepared with alkaline lysis buffer at 65℃ for 10 min incubation. .. For the second round of DNA amplification, 1 µL of the first PCR reaction products was added to another tube containing 2 µL of PCR buffer (50 mM/L KCl, 10 mM/L Tris-HCl, pH 8.3), 1.5 mM/L MgCl2 , 200 µM/L of each dNTP, 2 IU SynergyN DNA polymerase (GeneCraft Co, Munster, Germany) and 0.5 µM/L of each inner primer, and the amplification was performed with 40 cycles as described above.

Article Title: Preimplantation genetic diagnosis for Charcot-Marie-Tooth disease
Article Snippet: Cell lysis and multiplex nested PCR procedure The cells were lysed by incubation with alkaline lysis buffer at 65℃ for 10 minutes. .. For the second round of DNA amplification, 0.5 μL of the primary PCR product was added to another tube containing 2 μL of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 1.5 mmol/L MgCl2 , 200 μmol/L of each dNTP, 2 IU Neotherm DNA polymerase (GeneCraft Co.), and 1-5 pmol of each specific inner primer pair in a total volume of 20 μL, and the amplification was performed for 40 cycles as described above.

CTG Assay:

Article Title: Characterization of microsatellites for the endangered Ruta oreojasme (Rutaceae) and cross-amplification in related species 1
Article Snippet: Enrichment involved incubating adapter-ligated restricted DNA with filter-bonded synthetic repeat motifs, (AG)17 , (AC)17 , (AAC)10 , (CCG)10 , (CTG)10 , and (AAT)10 . .. PCRs were performed in 25 μL and contained approximately 50 ng of DNA, 5 pmol of each unlabeled primer, 1.5 mM of MgCl2 , 0.2 mM of each dNTP, 1× PCR buffer, and 0.5 U of SupraTherm DNA Polymerase (GeneCraft, Cologne, Germany).

Gel Extraction:

Article Title: Temporal dynamics in the free-living bacterial community composition in the coastal North Sea
Article Snippet: Each 50 μL PCR consisted of 0.25 μL of both primers, 5 μL of dNTP (Integra, Woburn, MA), 2% of DMSO, and 0.4 μL of Taq polymerase Biotherm D (Genecraft, Köln, Germany), 5 μL of the corresponding PCR buffer (Genecraft), and 1–2 μL of the DNA extract, made up to 50 μL with UV-treated ultrapure water (Sigma). .. The PCR products in the expected size range (1500 bp) were excised from the gel and extracted with Qiaquick Gel Extraction kit (Qiagen, Hilden, Germany).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Genecraft dntp
    Dntp, supplied by Genecraft, used in various techniques. Bioz Stars score: 97/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Genecraft
    Average 97 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-03
    97/100 stars
      Buy from Supplier

    Image Search Results