Structured Review

GE Healthcare dntp
E138K mutation in HIV-1 RT restores enzyme <t>processivity</t> of both the M184I- and M184V-containing enzymes at low <t>dNTP</t> concentrations. The processivity of purified recombinant RT enzymes was analyzed using 5′-end-labeled DNA primer (D25) annealed
Dntp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 267 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/GE Healthcare
Average 93 stars, based on 267 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-04
93/100 stars

Images

1) Product Images from "Compensation by the E138K Mutation in HIV-1 Reverse Transcriptase for Deficits in Viral Replication Capacity and Enzyme Processivity Associated with the M184I/V Mutations ▿"

Article Title: Compensation by the E138K Mutation in HIV-1 Reverse Transcriptase for Deficits in Viral Replication Capacity and Enzyme Processivity Associated with the M184I/V Mutations ▿

Journal: Journal of Virology

doi: 10.1128/JVI.05584-11

E138K mutation in HIV-1 RT restores enzyme processivity of both the M184I- and M184V-containing enzymes at low dNTP concentrations. The processivity of purified recombinant RT enzymes was analyzed using 5′-end-labeled DNA primer (D25) annealed
Figure Legend Snippet: E138K mutation in HIV-1 RT restores enzyme processivity of both the M184I- and M184V-containing enzymes at low dNTP concentrations. The processivity of purified recombinant RT enzymes was analyzed using 5′-end-labeled DNA primer (D25) annealed

Techniques Used: Mutagenesis, Purification, Recombinant, Labeling

2) Product Images from "Role of a dipeptide insertion between codons 69 and 70 of HIV-1 reverse transcriptase in the mechanism of AZT resistance"

Article Title: Role of a dipeptide insertion between codons 69 and 70 of HIV-1 reverse transcriptase in the mechanism of AZT resistance

Journal: The EMBO Journal

doi: 10.1093/emboj/19.21.5752

Fig. 3. Time course of pyrophosphorolysis catalyzed by the studied RTs. Reactions were carried out in 50 mM HEPES pH 7.0, containing 15 mM NaCl, 15 mM magnesium aspartate, 130 mM potassium acetate, 1 mM DTT and 5% polyethylene glycol 6000, in the absence of dNTP. ( A ) Results of experiments carried out after addition of sodium PPi to 1 mM. For each enzyme, six lanes are shown, which correspond to aliquots taken after incubating the samples at 37°C for 0, 2, 5, 10, 20 and 50 min, respectively. The sequence of the primer is shown on the left. Plots indicating the amount of the 25 nucleotide primer remaining as a function of incubation time of pyrophosphoro lysis are shown for assays carried out with 1 mM ( B ) and 150 µM ( C ) sodium PPi. Filled squares, WT BH10; filled triangles, T69S; filled circles, T69SSS; filled diamonds, T69SSW; open squares, SS; open triangles, 2S0S; open diamonds, 2S4S.
Figure Legend Snippet: Fig. 3. Time course of pyrophosphorolysis catalyzed by the studied RTs. Reactions were carried out in 50 mM HEPES pH 7.0, containing 15 mM NaCl, 15 mM magnesium aspartate, 130 mM potassium acetate, 1 mM DTT and 5% polyethylene glycol 6000, in the absence of dNTP. ( A ) Results of experiments carried out after addition of sodium PPi to 1 mM. For each enzyme, six lanes are shown, which correspond to aliquots taken after incubating the samples at 37°C for 0, 2, 5, 10, 20 and 50 min, respectively. The sequence of the primer is shown on the left. Plots indicating the amount of the 25 nucleotide primer remaining as a function of incubation time of pyrophosphoro lysis are shown for assays carried out with 1 mM ( B ) and 150 µM ( C ) sodium PPi. Filled squares, WT BH10; filled triangles, T69S; filled circles, T69SSS; filled diamonds, T69SSW; open squares, SS; open triangles, 2S0S; open diamonds, 2S4S.

Techniques Used: Sequencing, Incubation, Lysis

Related Articles

Amplification:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: Paragraph title: Viral RNA extraction and amplification ... First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice.

Article Title: Immunomodulatory impact of the A2A adenosine receptor on the profile of chemokines produced by neutrophils
Article Snippet: Amplification of PMN cDNA was carried out in a Rotor-Gene 3000 operated with Rotor Gene software version 6.0.19 (Corbett Research, Mortlake, New South Wales, Australia). .. Each sample consisted of: 1 μg cDNA, 1.3 mM MgCl2 , 0.2 mM dNTP, 500 nM of primers, 0.5 unit of Taq polymerase (Amersham Biosciences) and SYBR Green dye (Molecular Probe, Eugene, OR; 1:30 000 dilution) in a reaction volume of 20 μl.

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis. .. Target cDNAs were amplified using gene-specific primers ( ) and SYBR Premix Ex Taq (TaKaRa Bio, Otsu, Japan) solution.

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: .. Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. RNA samples were diluted to a final concentration of 0.5 mg/mL in RNase-free water and stored at −80°C until use. cDNA synthesis was performed with 1 mg of total RNA with M-MLV reverse transcription reagents (Invitrogen), and real-time PCR was conducted using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) in 20 μL TaqMan Gene Expression Master Mix (Applied Biosystems) using 200 ng cDNA.

Article Title: CHEK2 variants associate with hereditary prostate cancer
Article Snippet: Primers used for amplification of exons 10–14, which are known to be repeated on several other chromosomes , were designed so that both primers for each primer pair had a base mismatch in the most 3′ nucleotide, compared with sequences from nonfunctional copies of CHEK2 . .. Genomic DNA was used at 25 ng per 15 μ l reaction mixture containing 1.5 mM MgCl2 ; 20 μ M each of dNTP; 0.5 μ Ci of α (33 P)-dCTP (Amersham Pharmacia, Uppsala, Sweden); 0.6 μ M of each primer; 1.0 U AmpliTaq Gold; and the reaction buffer provided by the supplier (PE Biosystems, Foster City, CA, USA).

Article Title: Midline carcinoma with t(15;19) and BRD4-NUT fusion oncogene in a 30-year-old female with response to docetaxel and radiotherapy
Article Snippet: Total RNA was extracted using the Trizol reagent according to the manufacturer's instructions (Invitrogen, Stockholm, Sweden), and 5 μg were reverse-transcribed in a 20 μL reaction volume containing 50 mM Tris-HCl pH 8.3 (at 25°C), 75 mM KCl, 3 mM MgCl2 , 10 mM DTT, 1 mM of each dNTP, 20 units RNA guard (Amersham Biosciences, Uppsala, Sweden), 10 pmol random hexamers, and 400 units M-MLV Reverse Transcriptase (Invitrogen). .. PCR amplification was performed using 1 μl of the cDNA as template in 50 μL reaction volume containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.25 mM MgCl2 , 0.2 mM of each dNTP, 1 unit Platinum Taq polymerase (Invitrogen) and 0.5 μM of each of the primers BR2276F: AAGTTGATGTGATTGCCGGCTCCTC and NUT1194R: GAGGTCTCTGGGCTTTACGCTGACG [ ] or BR2276F and NUT294R: CTGAAGGCATGATGGGCTGTGG.

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: A 494 bp fragment of the mtDNA D-loop (control region) was amplified via PCR, using the mammalian control region primers L15997 5'-CACCATTAGCACCCAAAGCT-3' located in the tRNA gene and H16498 5'-CCTGAAGTAGGAACCAGATG-3' [ ]. .. PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added.

Article Title: c-KIT and PDGFRA in breast phyllodes tumours: overexpression without mutations?
Article Snippet: Polymerase chain reaction (PCR) primers were designed to amplify exons 9, 11, 13, and 17 of the c-KIT gene and also for amplification of exons 12 and 18 of the PDGFRA gene. .. PCR was carried out using 250 ng of DNA, 1× PCR buffer (Amersham Biosciences, Piscataway, New Jersey, USA), 200μM of each dNTP (Amersham Biosciences), 10ρmol of each primer, and 1 U of Taq DNA polymerase (Amersham Biosciences) in a final volume of 25 μl.

Synthesized:

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis. .. An aliquot of synthesized cDNA was used as template for quantitative RT-PCR (qRT-PCR) using an Applied Biosystems 7300 Real-Time PCR System (Foster City, CA, USA).

Quantitative RT-PCR:

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis. .. An aliquot of synthesized cDNA was used as template for quantitative RT-PCR (qRT-PCR) using an Applied Biosystems 7300 Real-Time PCR System (Foster City, CA, USA).

SYBR Green Assay:

Article Title: Immunomodulatory impact of the A2A adenosine receptor on the profile of chemokines produced by neutrophils
Article Snippet: .. Each sample consisted of: 1 μg cDNA, 1.3 mM MgCl2 , 0.2 mM dNTP, 500 nM of primers, 0.5 unit of Taq polymerase (Amersham Biosciences) and SYBR Green dye (Molecular Probe, Eugene, OR; 1:30 000 dilution) in a reaction volume of 20 μl. .. Specificity of each reaction was ascertained by performing the Melt procedure (58–99°C; 1°C/5s) after completion of the amplification protocol, according to the manufacturer’s instructions.

Incubation:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice. .. The following mixture: 4 µl 5xbuffer, 1 µl DTT, 1 µl RNasin Ribonuclease Inhibitor 2500 U (Promega) and 1 µl SII transcriptase (18080–044 ) was added before an incubation at 50°C for 60 min followed by a heat inactivation at 70°C for 15 min.

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis. .. RNA was incubated in 20 μL of RT buffer (50 mM Tris–HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 , 5 mM dithiothreitol) containing 50 U SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and 20 U RNaseOUT RNase inhibitor (Invitrogen) for 60 min at 50 °C.

Article Title: Role of a dipeptide insertion between codons 69 and 70 of HIV-1 reverse transcriptase in the mechanism of AZT resistance
Article Snippet: Reactions were initiated by incubating the enzyme with the corresponding annealed template–primer in the absence of dNTP (10 min at 37°C), followed by the addition of dTTP (Amersham Pharmacia) or AZTTP (Moravek Biochemicals, Brea, CA) at various concentrations. .. The reaction mixtures were incubated for 20 s at 37°C, and then the reactions were stopped by adding 8 µl of 10 mM EDTA in 90% formamide containing 3 mg/ml xylene cyanol FF and 3 mg/ml bromophenol blue.

Expressing:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. RNA samples were diluted to a final concentration of 0.5 mg/mL in RNase-free water and stored at −80°C until use. cDNA synthesis was performed with 1 mg of total RNA with M-MLV reverse transcription reagents (Invitrogen), and real-time PCR was conducted using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) in 20 μL TaqMan Gene Expression Master Mix (Applied Biosystems) using 200 ng cDNA.

Modification:

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: Sequencing DNA was extracted from hare muscle tissue using a slight modification of the Chelex protocol [ ]. .. PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added.

Polymerase Chain Reaction:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: Taq DNA polymerase (M1865) of Promega Corporation (Winsconsin, USA) was used for the PCR amplification of both regions. .. First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice.

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. The primary sequences used for cIAP2 were as follows: forward, 5′-TCCTAGCTGCAGATTCGTTC-3′; reverse, 5′-CAAAGCAAGCCACTCTGTCT-3′ for a 349 bp PCR product.

Article Title: CHEK2 variants associate with hereditary prostate cancer
Article Snippet: Genomic DNA was used at 25 ng per 15 μ l reaction mixture containing 1.5 mM MgCl2 ; 20 μ M each of dNTP; 0.5 μ Ci of α (33 P)-dCTP (Amersham Pharmacia, Uppsala, Sweden); 0.6 μ M of each primer; 1.0 U AmpliTaq Gold; and the reaction buffer provided by the supplier (PE Biosystems, Foster City, CA, USA). .. After denaturation, the (33 P)-labeled PCR products were electrophoresed at 800 V for 12 h at room temperature, in 0.5 × mutation-detection-enhancement gel (FMC BioProducts, Rockland, ME, USA) with 1% glycerol in 0.5 × Tris-borate EDTA.

Article Title: Voltage-dependent Ca2+ channels, not ryanodine receptors, activate Ca2+-dependent BK potassium channels in human retinal pigment epithelial cells
Article Snippet: Next, 1 µg RNA was reverse transcribed at 37 °C for 1 h in the following reaction mixture: 1 µg oligo dT primer (Invitrogen), 1 mM of each dNTP, 20 U RNAguard (Amersham Biosciences Europe, Heidelberg, Germany), and 20 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen). .. For control PCR reactions human total brain RNA (Stratagene Europe, Amsterdam, Netherlands) was reverse transcribed under the same conditions.

Article Title: Midline carcinoma with t(15;19) and BRD4-NUT fusion oncogene in a 30-year-old female with response to docetaxel and radiotherapy
Article Snippet: Total RNA was extracted using the Trizol reagent according to the manufacturer's instructions (Invitrogen, Stockholm, Sweden), and 5 μg were reverse-transcribed in a 20 μL reaction volume containing 50 mM Tris-HCl pH 8.3 (at 25°C), 75 mM KCl, 3 mM MgCl2 , 10 mM DTT, 1 mM of each dNTP, 20 units RNA guard (Amersham Biosciences, Uppsala, Sweden), 10 pmol random hexamers, and 400 units M-MLV Reverse Transcriptase (Invitrogen). .. PCR amplification was performed using 1 μl of the cDNA as template in 50 μL reaction volume containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.25 mM MgCl2 , 0.2 mM of each dNTP, 1 unit Platinum Taq polymerase (Invitrogen) and 0.5 μM of each of the primers BR2276F: AAGTTGATGTGATTGCCGGCTCCTC and NUT1194R: GAGGTCTCTGGGCTTTACGCTGACG [ ] or BR2276F and NUT294R: CTGAAGGCATGATGGGCTGTGG.

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: .. PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added. .. Cycling conditions were 94°C for 3 min, and 35 cycles of 94°C for 30 s, 50°C for 40 s and 72°C for 60 s and a final extension step of 72°C for 7 min. Sequencing was conducted under BigDye™ terminator cycling conditions, the reacted products purified using ethanol precipitation and run using an Automatic Sequencer ABI 3730xl.

Article Title: c-KIT and PDGFRA in breast phyllodes tumours: overexpression without mutations?
Article Snippet: .. PCR was carried out using 250 ng of DNA, 1× PCR buffer (Amersham Biosciences, Piscataway, New Jersey, USA), 200μM of each dNTP (Amersham Biosciences), 10ρmol of each primer, and 1 U of Taq DNA polymerase (Amersham Biosciences) in a final volume of 25 μl. .. The PCR conditions were 96°C for five minutes, then 35 cycles of 30 seconds at 96°C, 30 seconds at the annealing temperature of the primer (table 1 ), and one minute at 72°C, followed by one cycle at 72°C for 10 minutes.

Sequencing:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. RNA samples were diluted to a final concentration of 0.5 mg/mL in RNase-free water and stored at −80°C until use. cDNA synthesis was performed with 1 mg of total RNA with M-MLV reverse transcription reagents (Invitrogen), and real-time PCR was conducted using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) in 20 μL TaqMan Gene Expression Master Mix (Applied Biosystems) using 200 ng cDNA.

Article Title: CHEK2 variants associate with hereditary prostate cancer
Article Snippet: Mutation screening with SSCP analysis Single-strand conformation polymorphism analysis of the entire coding sequence of the CHEK2 gene was designed to include all intron–exon boundaries (GenBank accession number AF086904). .. Genomic DNA was used at 25 ng per 15 μ l reaction mixture containing 1.5 mM MgCl2 ; 20 μ M each of dNTP; 0.5 μ Ci of α (33 P)-dCTP (Amersham Pharmacia, Uppsala, Sweden); 0.6 μ M of each primer; 1.0 U AmpliTaq Gold; and the reaction buffer provided by the supplier (PE Biosystems, Foster City, CA, USA).

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: Paragraph title: Sequencing ... PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added.

Recombinant:

Article Title: Compensation by the E138K Mutation in HIV-1 Reverse Transcriptase for Deficits in Viral Replication Capacity and Enzyme Processivity Associated with the M184I/V Mutations ▿
Article Snippet: To this end, we performed single-cycle processivity assays with recombinant RT enzymes at both low and high dNTP concentrations ( ). .. At 200 μM each dNTP, all enzymes displayed similar processivity based on the production of full-length products ( B); the distortion of running samples in each lane was from blotting the gel onto Whatman paper.

Mutagenesis:

Article Title: Compensation by the E138K Mutation in HIV-1 Reverse Transcriptase for Deficits in Viral Replication Capacity and Enzyme Processivity Associated with the M184I/V Mutations ▿
Article Snippet: Assays performed with 0.5 μM each dNTP showed that both M184I and M184V RTs have lower processivity than wild-type RT, whereas the three E138K-containing mutant enzymes had higher processivity, indicating that E138K compensates for the diminished enzyme processivity associated with M184I/V ( A). .. At 200 μM each dNTP, all enzymes displayed similar processivity based on the production of full-length products ( B); the distortion of running samples in each lane was from blotting the gel onto Whatman paper.

Article Title: CHEK2 variants associate with hereditary prostate cancer
Article Snippet: Paragraph title: Mutation screening with SSCP analysis ... Genomic DNA was used at 25 ng per 15 μ l reaction mixture containing 1.5 mM MgCl2 ; 20 μ M each of dNTP; 0.5 μ Ci of α (33 P)-dCTP (Amersham Pharmacia, Uppsala, Sweden); 0.6 μ M of each primer; 1.0 U AmpliTaq Gold; and the reaction buffer provided by the supplier (PE Biosystems, Foster City, CA, USA).

Isolation:

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Total RNA was isolated from the liver and HepG2 cells using the Isogen reagent (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. .. Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis.

Article Title: Voltage-dependent Ca2+ channels, not ryanodine receptors, activate Ca2+-dependent BK potassium channels in human retinal pigment epithelial cells
Article Snippet: Paragraph title: RNA isolation and RT PCR ... Next, 1 µg RNA was reverse transcribed at 37 °C for 1 h in the following reaction mixture: 1 µg oligo dT primer (Invitrogen), 1 mM of each dNTP, 20 U RNAguard (Amersham Biosciences Europe, Heidelberg, Germany), and 20 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen).

Size-exclusion Chromatography:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice. .. Thermocycler program was: one cycle of 95°C for 2 min 30 sec, 45 cycles each one with 95°C for 45 sec, 45°C for 30 sec and 72°C for 45 sec, and one final extension cycle at 72°C for 5 min. RT-PCR amplification from field sample isolates was done in the Institute Pasteur in Dakar, Senegal.

Labeling:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: .. Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. RNA samples were diluted to a final concentration of 0.5 mg/mL in RNase-free water and stored at −80°C until use. cDNA synthesis was performed with 1 mg of total RNA with M-MLV reverse transcription reagents (Invitrogen), and real-time PCR was conducted using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) in 20 μL TaqMan Gene Expression Master Mix (Applied Biosystems) using 200 ng cDNA.

Purification:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Total RNA was extracted from the specimens using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) per manufacturer’s instructions and purified using RNeasy mini kits (Qiagen, Valencia, CA, USA). .. Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA).

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added. .. Cycling conditions were 94°C for 3 min, and 35 cycles of 94°C for 30 s, 50°C for 40 s and 72°C for 60 s and a final extension step of 72°C for 7 min. Sequencing was conducted under BigDye™ terminator cycling conditions, the reacted products purified using ethanol precipitation and run using an Automatic Sequencer ABI 3730xl.

Article Title: c-KIT and PDGFRA in breast phyllodes tumours: overexpression without mutations?
Article Snippet: PCR was carried out using 250 ng of DNA, 1× PCR buffer (Amersham Biosciences, Piscataway, New Jersey, USA), 200μM of each dNTP (Amersham Biosciences), 10ρmol of each primer, and 1 U of Taq DNA polymerase (Amersham Biosciences) in a final volume of 25 μl. .. PCR products were purified using GFX™ PCR DNA and the Gel Band purification kit (Amersham Biosciences).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: Whereas for the L region the RT-PCR was amplified with the superscript II (SII) (Invitrogen, USA) and Takara taq DNA polymerase (Takara, USA) for the synthesis of the cDNA and polymerase amplification respectively. .. First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice.

Article Title: Voltage-dependent Ca2+ channels, not ryanodine receptors, activate Ca2+-dependent BK potassium channels in human retinal pigment epithelial cells
Article Snippet: Paragraph title: RNA isolation and RT PCR ... Next, 1 µg RNA was reverse transcribed at 37 °C for 1 h in the following reaction mixture: 1 µg oligo dT primer (Invitrogen), 1 mM of each dNTP, 20 U RNAguard (Amersham Biosciences Europe, Heidelberg, Germany), and 20 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen).

Article Title: Midline carcinoma with t(15;19) and BRD4-NUT fusion oncogene in a 30-year-old female with response to docetaxel and radiotherapy
Article Snippet: Paragraph title: RT-PCR analysis ... Total RNA was extracted using the Trizol reagent according to the manufacturer's instructions (Invitrogen, Stockholm, Sweden), and 5 μg were reverse-transcribed in a 20 μL reaction volume containing 50 mM Tris-HCl pH 8.3 (at 25°C), 75 mM KCl, 3 mM MgCl2 , 10 mM DTT, 1 mM of each dNTP, 20 units RNA guard (Amersham Biosciences, Uppsala, Sweden), 10 pmol random hexamers, and 400 units M-MLV Reverse Transcriptase (Invitrogen).

Blocking Assay:

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: Tubes were vortexed briefly, boiled at 100°C for 20 min in a heating block, centrifuged 3 min at 13000 rpm and stored at minus 20°C. .. PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added.

Chloramphenicol Acetyltransferase Assay:

Article Title: Voltage-dependent Ca2+ channels, not ryanodine receptors, activate Ca2+-dependent BK potassium channels in human retinal pigment epithelial cells
Article Snippet: Next, 1 µg RNA was reverse transcribed at 37 °C for 1 h in the following reaction mixture: 1 µg oligo dT primer (Invitrogen), 1 mM of each dNTP, 20 U RNAguard (Amersham Biosciences Europe, Heidelberg, Germany), and 20 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen). .. The following oligonucleotides specific for the BK channel gene kcnma1 ( NM_002247 ) were used: forward GGA ATG GGA GAC GCT TCA TA, reverse CCT GCA GCG AAG TAT CAT CAT CA.

Software:

Article Title: Immunomodulatory impact of the A2A adenosine receptor on the profile of chemokines produced by neutrophils
Article Snippet: Amplification of PMN cDNA was carried out in a Rotor-Gene 3000 operated with Rotor Gene software version 6.0.19 (Corbett Research, Mortlake, New South Wales, Australia). .. Each sample consisted of: 1 μg cDNA, 1.3 mM MgCl2 , 0.2 mM dNTP, 500 nM of primers, 0.5 unit of Taq polymerase (Amersham Biosciences) and SYBR Green dye (Molecular Probe, Eugene, OR; 1:30 000 dilution) in a reaction volume of 20 μl.

Real-time Polymerase Chain Reaction:

Article Title: Immunomodulatory impact of the A2A adenosine receptor on the profile of chemokines produced by neutrophils
Article Snippet: Paragraph title: Real-time PCR and cDNA reverse-transcription ... Each sample consisted of: 1 μg cDNA, 1.3 mM MgCl2 , 0.2 mM dNTP, 500 nM of primers, 0.5 unit of Taq polymerase (Amersham Biosciences) and SYBR Green dye (Molecular Probe, Eugene, OR; 1:30 000 dilution) in a reaction volume of 20 μl.

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis. .. An aliquot of synthesized cDNA was used as template for quantitative RT-PCR (qRT-PCR) using an Applied Biosystems 7300 Real-Time PCR System (Foster City, CA, USA).

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Paragraph title: 4. Real-time PCR for cIAP2 mRNA ... Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA).

RNA Extraction:

Article Title: Phylogeography of Rift Valley Fever Virus in Africa Reveals Multiple Introductions in Senegal and Mauritania
Article Snippet: Paragraph title: Viral RNA extraction and amplification ... First strand cDNA synthesis was performed in a final volume of 20 µl by incubating first 10 µl of eluted RNA, 1 µl dNTP (10 mM- Amersham), 1 µl of reverse primer (100 µg/µl) and 1 µl H2 O at 65°C for 5 min and then rapidly chilled on ice.

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: Paragraph title: 2.5. RNA Extraction and mRNA Quantification ... Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis.

Agarose Gel Electrophoresis:

Article Title: Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR
Article Snippet: The quantity and quality of RNA were determined spectrophotometrically, by measuring the absorbance at 260 nm in relation to that at 280 nm, and subsequent agarose gel electrophoresis. .. Four microgram of total RNA was denatured at 65 °C for 5 min with 2.5 μM oligo-dT primer (Hokkaido System Science Co., Sapporo, Japan) and 0.5 mM dNTP (GE Healthcare, Tokyo, Japan) for cDNA synthesis.

Electrophoresis:

Article Title: Role of a dipeptide insertion between codons 69 and 70 of HIV-1 reverse transcriptase in the mechanism of AZT resistance
Article Snippet: Reactions were initiated by incubating the enzyme with the corresponding annealed template–primer in the absence of dNTP (10 min at 37°C), followed by the addition of dTTP (Amersham Pharmacia) or AZTTP (Moravek Biochemicals, Brea, CA) at various concentrations. .. The extension products resulting from the incorporation of one nucleotide at the 3′ end of the primer were resolved by electrophoresis in 20% polyacrylamide–urea gels, and primer extension was quantitated by phosphoimaging with a BAS 1500 scanner (Fuji).

Ethanol Precipitation:

Article Title: Introgression of mountain hare (Lepus timidus) mitochondrial DNA into wild brown hares (Lepus europaeus) in Denmark
Article Snippet: PCR was performed in a total volume of 10 μl and contained 1 μl buffer (1.5 mM MgCl2 ), 1.6 μl dNTP (1.25 mM of A, C, G, T, respectively), 0.5 μl of each primer (10 pmol/μl), 0.1 μl Taq polymerase (Amersham Pharmacia Biotech), topped up with distilled water to 9 μl and 1 μl template DNA (40–60 ng/μl) was added. .. Cycling conditions were 94°C for 3 min, and 35 cycles of 94°C for 30 s, 50°C for 40 s and 72°C for 60 s and a final extension step of 72°C for 7 min. Sequencing was conducted under BigDye™ terminator cycling conditions, the reacted products purified using ethanol precipitation and run using an Automatic Sequencer ABI 3730xl.

Spectrophotometry:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: RNA samples were then treated with DNase I (Invitrogen) and quantified by spectrophotometry. .. Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA).

Concentration Assay:

Article Title: Helicobacter pylori Eradication Downregulates Cellular Inhibitor of Apoptosis Protein 2 in Gastric Carcinogenesis
Article Snippet: Total RNA was amplified and then labeled in the presence of fluorescent dNTP (Cy3 dUTP or Cy5 dUTP; GE Healthcare, Piscataway, NJ, USA). .. RNA samples were diluted to a final concentration of 0.5 mg/mL in RNase-free water and stored at −80°C until use. cDNA synthesis was performed with 1 mg of total RNA with M-MLV reverse transcription reagents (Invitrogen), and real-time PCR was conducted using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) in 20 μL TaqMan Gene Expression Master Mix (Applied Biosystems) using 200 ng cDNA.

Lysis:

Article Title: Voltage-dependent Ca2+ channels, not ryanodine receptors, activate Ca2+-dependent BK potassium channels in human retinal pigment epithelial cells
Article Snippet: The RPE cells were collected and lysed in the lysis buffer of the RNeasy Mini Kit (Qiagen, Hilden, Germany). .. Next, 1 µg RNA was reverse transcribed at 37 °C for 1 h in the following reaction mixture: 1 µg oligo dT primer (Invitrogen), 1 mM of each dNTP, 20 U RNAguard (Amersham Biosciences Europe, Heidelberg, Germany), and 20 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    GE Healthcare unlabeled dntps
    Pol λ can misincorporate deoxy- and ribonucleotides in the presence of physiological Mn ++ and Mg ++ concentrations. The sequences of the primer/templates used are indicated in Materials and Methods. ( A ) Reactions were performed as described in Materials and Methods, in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ and each of the four <t>dNTPs</t> at 5 µM final concentration. Lanes 1–4: 5′-labelled 18/40merA primer/template; lanes 6–9: 19/40merT; lanes 11–14: 20/40merG; lanes 16–19: 21/40merC. Lanes 5, 10, 15 and 20: control reactions with all four dNTPs at 5 µM each. Lanes 21–24: control reactions in the absence of dNTPs. Asterisks indicate the mismatches. ( B ) The experiment was performed as in panel A, but in the presence of 1 mM Mg ++ . The migration of four different primers is shown on the right side of the panel. Asterisks indicate the mismatches. ( C ) Reactions were performed as described in Materials and Methods in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ (lanes 1–20) or 1 mM Mg ++ (lanes 21–39) and each of the four <t>rNTPs</t> at a final concentration of 10 µM. Lanes 1–4; 21–24: 5′-labelled 18/40merA primer/template; lanes 17–20; 25–28: 19/40merT; lanes 11–15, 30–33: 20/40merG; lanes 16–19; 36–39: 21/40merC. Lanes 9, 15 and 34: reactions in the presence of a mixture of all four rNTPs at 10 µM each. Lanes 10, 16, 29 and 35: control reactions in the presence of all four dNTPs at 5 µM each final concentration. The running position of the four different primers is indicated on the left side of the panel.
    Unlabeled Dntps, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unlabeled dntps/product/GE Healthcare
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    unlabeled dntps - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    91
    GE Healthcare individual dntps
    Effects of amino acid substitutions on the <t>DNA</t> polymerase activity of Pol ι. The structure of the oligonucleotide substrate used to test the DNA polymerase activity is shown on top. Gel image of DNA polymerase activity of wild-type Pol ι and its mutant variants is shown below. Primer extension reactions were performed in the presence of Mg 2+ and Mn 2+ ions. All four <t>dNTPs</t> (N) or individual dNTP (A, G, T, C) were added to the reaction. The full-length and truncated (WT 420 ) variants of wild-type Pol ι were used for comparisons with the K60G and K207A mutants, respectively.
    Individual Dntps, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/individual dntps/product/GE Healthcare
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    individual dntps - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    92
    GE Healthcare ultrapure dntps
    Mutations in the thumb ‘mini-loop’ (NSH motif) of human Polμ specifically affect terminal transferase and NHEJ. ( A ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, <t>dNTPs</t> were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . ( B ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydT) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. ( C ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The black spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four <t>ddNTPs</t> (10 μM) was added in the presence of 2.5-mM MgCl 2 .
    Ultrapure Dntps, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultrapure dntps/product/GE Healthcare
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    ultrapure dntps - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Pol λ can misincorporate deoxy- and ribonucleotides in the presence of physiological Mn ++ and Mg ++ concentrations. The sequences of the primer/templates used are indicated in Materials and Methods. ( A ) Reactions were performed as described in Materials and Methods, in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ and each of the four dNTPs at 5 µM final concentration. Lanes 1–4: 5′-labelled 18/40merA primer/template; lanes 6–9: 19/40merT; lanes 11–14: 20/40merG; lanes 16–19: 21/40merC. Lanes 5, 10, 15 and 20: control reactions with all four dNTPs at 5 µM each. Lanes 21–24: control reactions in the absence of dNTPs. Asterisks indicate the mismatches. ( B ) The experiment was performed as in panel A, but in the presence of 1 mM Mg ++ . The migration of four different primers is shown on the right side of the panel. Asterisks indicate the mismatches. ( C ) Reactions were performed as described in Materials and Methods in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ (lanes 1–20) or 1 mM Mg ++ (lanes 21–39) and each of the four rNTPs at a final concentration of 10 µM. Lanes 1–4; 21–24: 5′-labelled 18/40merA primer/template; lanes 17–20; 25–28: 19/40merT; lanes 11–15, 30–33: 20/40merG; lanes 16–19; 36–39: 21/40merC. Lanes 9, 15 and 34: reactions in the presence of a mixture of all four rNTPs at 10 µM each. Lanes 10, 16, 29 and 35: control reactions in the presence of all four dNTPs at 5 µM each final concentration. The running position of the four different primers is indicated on the left side of the panel.

    Journal: Nucleic Acids Research

    Article Title: Human replication protein A can suppress the intrinsic in vitro mutator phenotype of human DNA polymerase ?

    doi: 10.1093/nar/gkl032

    Figure Lengend Snippet: Pol λ can misincorporate deoxy- and ribonucleotides in the presence of physiological Mn ++ and Mg ++ concentrations. The sequences of the primer/templates used are indicated in Materials and Methods. ( A ) Reactions were performed as described in Materials and Methods, in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ and each of the four dNTPs at 5 µM final concentration. Lanes 1–4: 5′-labelled 18/40merA primer/template; lanes 6–9: 19/40merT; lanes 11–14: 20/40merG; lanes 16–19: 21/40merC. Lanes 5, 10, 15 and 20: control reactions with all four dNTPs at 5 µM each. Lanes 21–24: control reactions in the absence of dNTPs. Asterisks indicate the mismatches. ( B ) The experiment was performed as in panel A, but in the presence of 1 mM Mg ++ . The migration of four different primers is shown on the right side of the panel. Asterisks indicate the mismatches. ( C ) Reactions were performed as described in Materials and Methods in the presence of 50 nM (0.5 pmol) pol λ, 0.1 mM Mn ++ (lanes 1–20) or 1 mM Mg ++ (lanes 21–39) and each of the four rNTPs at a final concentration of 10 µM. Lanes 1–4; 21–24: 5′-labelled 18/40merA primer/template; lanes 17–20; 25–28: 19/40merT; lanes 11–15, 30–33: 20/40merG; lanes 16–19; 36–39: 21/40merC. Lanes 9, 15 and 34: reactions in the presence of a mixture of all four rNTPs at 10 µM each. Lanes 10, 16, 29 and 35: control reactions in the presence of all four dNTPs at 5 µM each final concentration. The running position of the four different primers is indicated on the left side of the panel.

    Article Snippet: Chemicals [γ-32 P]ATP (3000 Ci/mmol) was from GE Healthcare Biosciences; unlabeled dNTPs, rNTPs, poly(dA)200 and oligo(dT)16 , were from Roche Molecular Biochemicals.

    Techniques: Concentration Assay, Migration

    The sequence context influences misincorporation by pol λ. All reactions were performed as described in Materials and Methods in the presence of 50 nM (0.5 pmol) pol λ. ( A ) Incorporation of the four dNTPs (lanes 1–4, 5 µM final concentration) or the four rNTPs (lanes 6–9, 20 µM final concentration) on the 5′-labelled 17/75mer primer template, in the presence of 0.1 mM Mn ++ . Lane C: control reaction in the absence of dNTPs or rNTPs. Lane 5: reaction in the presence of all four dNTPs (5 µM each). Lane 10: reaction in the presence of all four rNTPs (20 µM each). The position of the 17mer primer and the sequence of the first six positions on the template strand are indicated on the left side of the panel. ( B ) Reaction conditions were the same as for panel A, but 1 mM Mg ++ was used instead of Mn ++ . The four dNTPs were added individually (lanes 1–4) or all together (lane 5) at a final concentration of 5 µM each. Lane 6: reaction in the presence of all four rNTPs at 20 µM final concentration each. ( C ) Reaction conditions were as in panel A, but the 5′-labelled d(T) 16 /d(A) 200 primer/template was used. All four dNTPs (lanes 2–5) or rNTPs (lanes 6–9) were tested separately at a final concentration of 5 µM for dNTPs and 10 µM for rNTPs, in the presence of 0.1 mM Mn ++ . ( D ) Reaction conditions were the same as C, but 1 mM Mg ++ was used instead of Mn ++ .

    Journal: Nucleic Acids Research

    Article Title: Human replication protein A can suppress the intrinsic in vitro mutator phenotype of human DNA polymerase ?

    doi: 10.1093/nar/gkl032

    Figure Lengend Snippet: The sequence context influences misincorporation by pol λ. All reactions were performed as described in Materials and Methods in the presence of 50 nM (0.5 pmol) pol λ. ( A ) Incorporation of the four dNTPs (lanes 1–4, 5 µM final concentration) or the four rNTPs (lanes 6–9, 20 µM final concentration) on the 5′-labelled 17/75mer primer template, in the presence of 0.1 mM Mn ++ . Lane C: control reaction in the absence of dNTPs or rNTPs. Lane 5: reaction in the presence of all four dNTPs (5 µM each). Lane 10: reaction in the presence of all four rNTPs (20 µM each). The position of the 17mer primer and the sequence of the first six positions on the template strand are indicated on the left side of the panel. ( B ) Reaction conditions were the same as for panel A, but 1 mM Mg ++ was used instead of Mn ++ . The four dNTPs were added individually (lanes 1–4) or all together (lane 5) at a final concentration of 5 µM each. Lane 6: reaction in the presence of all four rNTPs at 20 µM final concentration each. ( C ) Reaction conditions were as in panel A, but the 5′-labelled d(T) 16 /d(A) 200 primer/template was used. All four dNTPs (lanes 2–5) or rNTPs (lanes 6–9) were tested separately at a final concentration of 5 µM for dNTPs and 10 µM for rNTPs, in the presence of 0.1 mM Mn ++ . ( D ) Reaction conditions were the same as C, but 1 mM Mg ++ was used instead of Mn ++ .

    Article Snippet: Chemicals [γ-32 P]ATP (3000 Ci/mmol) was from GE Healthcare Biosciences; unlabeled dNTPs, rNTPs, poly(dA)200 and oligo(dT)16 , were from Roche Molecular Biochemicals.

    Techniques: Sequencing, Concentration Assay

    Effects of amino acid substitutions on the DNA polymerase activity of Pol ι. The structure of the oligonucleotide substrate used to test the DNA polymerase activity is shown on top. Gel image of DNA polymerase activity of wild-type Pol ι and its mutant variants is shown below. Primer extension reactions were performed in the presence of Mg 2+ and Mn 2+ ions. All four dNTPs (N) or individual dNTP (A, G, T, C) were added to the reaction. The full-length and truncated (WT 420 ) variants of wild-type Pol ι were used for comparisons with the K60G and K207A mutants, respectively.

    Journal: Scientific Reports

    Article Title: Identification of amino acid residues involved in the dRP-lyase activity of human Pol ι

    doi: 10.1038/s41598-017-10668-5

    Figure Lengend Snippet: Effects of amino acid substitutions on the DNA polymerase activity of Pol ι. The structure of the oligonucleotide substrate used to test the DNA polymerase activity is shown on top. Gel image of DNA polymerase activity of wild-type Pol ι and its mutant variants is shown below. Primer extension reactions were performed in the presence of Mg 2+ and Mn 2+ ions. All four dNTPs (N) or individual dNTP (A, G, T, C) were added to the reaction. The full-length and truncated (WT 420 ) variants of wild-type Pol ι were used for comparisons with the K60G and K207A mutants, respectively.

    Article Snippet: Primer extension DNA polymerase reactions Standard primer extension reaction was carried out in 20 µl of reaction buffer containing 30 mM HEPES pH 7.8, 50 mM NaCl, 8% glycerol, 0.1 mg/ml bovine serum albumin, 40 nM DNA substrate, 100 μM each four or individual dNTPs (GE Healthcare).

    Techniques: Activity Assay, Mutagenesis

    Mutations in the thumb ‘mini-loop’ (NSH motif) of human Polμ specifically affect terminal transferase and NHEJ. ( A ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . ( B ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydT) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. ( C ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The black spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 .

    Journal: Nucleic Acids Research

    Article Title: Decision-making during NHEJ: a network of interactions in human Pol? implicated in substrate recognition and end-bridging

    doi: 10.1093/nar/gku475

    Figure Lengend Snippet: Mutations in the thumb ‘mini-loop’ (NSH motif) of human Polμ specifically affect terminal transferase and NHEJ. ( A ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . ( B ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydT) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. ( C ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The black spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 .

    Article Snippet: Ultrapure dNTPs, ddNTPs, [α-32 P] dNTPs (3000 Ci/mmol) and [γ-32 P]ATP (3000 Ci/mmol) were purchased from GE Healthcare (UK).

    Techniques: Non-Homologous End Joining, Activity Assay, Incubation, Hybridization

    Residues implicated in binding the template strand. ( A ) Different representations of the Polμ ternary complex structure (2IHM) showing the region of helix N: electrostatic surface (left panel) showing the high amount of positive charge, and cartoon representations with the four arginines shown in sticks in side and top views (middle and left panels, respectively). Numbering of Polμ residues corresponds to the human enzyme. Incoming dNTP is shown in yellow and DNA substrate is shown in green. ( B ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . After electrophoresis, labelled fragments were detected by autoradiography. ( C ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The black spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 . ( D ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydA) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. After electrophoresis, labelled fragments were detected by autoradiography.

    Journal: Nucleic Acids Research

    Article Title: Decision-making during NHEJ: a network of interactions in human Pol? implicated in substrate recognition and end-bridging

    doi: 10.1093/nar/gku475

    Figure Lengend Snippet: Residues implicated in binding the template strand. ( A ) Different representations of the Polμ ternary complex structure (2IHM) showing the region of helix N: electrostatic surface (left panel) showing the high amount of positive charge, and cartoon representations with the four arginines shown in sticks in side and top views (middle and left panels, respectively). Numbering of Polμ residues corresponds to the human enzyme. Incoming dNTP is shown in yellow and DNA substrate is shown in green. ( B ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . After electrophoresis, labelled fragments were detected by autoradiography. ( C ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The black spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 . ( D ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydA) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. After electrophoresis, labelled fragments were detected by autoradiography.

    Article Snippet: Ultrapure dNTPs, ddNTPs, [α-32 P] dNTPs (3000 Ci/mmol) and [γ-32 P]ATP (3000 Ci/mmol) were purchased from GE Healthcare (UK).

    Techniques: Binding Assay, Electrophoresis, Autoradiography, Non-Homologous End Joining, Hybridization, Activity Assay, Incubation

    Relationship between TdT activity and NHEJ efficiency: single mutations in Loop1 affecting its structure/function. ( A ) Cartoon representations of the structures of murine TdT bound to ssDNA (1KDH, light pink) and the murine Polμ ternary complex (2IHM, wheat), showing the Loop1 in a blue cartoon and selected residues in sticks and mesh. Numbering of Polμ residues corresponds to the human enzyme, for congruence with the numbering used throughout the text. DNA substrate is shown in green and incoming nucleotide in yellow. ( B ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . ( C ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydT) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. ( D ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The gray spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 .

    Journal: Nucleic Acids Research

    Article Title: Decision-making during NHEJ: a network of interactions in human Pol? implicated in substrate recognition and end-bridging

    doi: 10.1093/nar/gku475

    Figure Lengend Snippet: Relationship between TdT activity and NHEJ efficiency: single mutations in Loop1 affecting its structure/function. ( A ) Cartoon representations of the structures of murine TdT bound to ssDNA (1KDH, light pink) and the murine Polμ ternary complex (2IHM, wheat), showing the Loop1 in a blue cartoon and selected residues in sticks and mesh. Numbering of Polμ residues corresponds to the human enzyme, for congruence with the numbering used throughout the text. DNA substrate is shown in green and incoming nucleotide in yellow. ( B ) Gap-filling reactions were performed as described in the Materials and Methods section with the indicated proteins (25 nM) using a gaped substrate containing the oligonucleotides SP1C, T13C and DG1-P. When indicated, dNTPs were added separately at 10 nM in the presence of 2.5-mM MgCl 2 . ( C ) Terminal transferase activity assay with the indicated proteins (600 nM) using a homopolymeric substrate (polydT) and each of the four dNTPs (100 μM). Reactions were incubated for 30 min at 37ºC. ( D ) NHEJ reactions were performed with 200 nM of the indicated proteins and using four sets of substrates: the labelled substrates were formed by hybridization of 1G with 1D-NHEJ or D3-C with D1, and the cold substrates by hybridization of either 2G with 2D-NHEJ or D4-C with D2. The gray spheres indicate the presence of a 5′-P group in the downstream strand of the substrate. When indicated, each of the four ddNTPs (10 μM) was added in the presence of 2.5-mM MgCl 2 .

    Article Snippet: Ultrapure dNTPs, ddNTPs, [α-32 P] dNTPs (3000 Ci/mmol) and [γ-32 P]ATP (3000 Ci/mmol) were purchased from GE Healthcare (UK).

    Techniques: Activity Assay, Non-Homologous End Joining, Incubation, Hybridization

    Mutagenesis of the brooch specifically affects the end-joining activity of Polµ. ( A ) Gap-filling reactions were performed for 30 min at 30°C with wild-type Polµ and the indicated mutants (25 nM) using a gapped substrate containing the oligonucleotides SP1C, T13C and DG1-P. dNTPs were added separately at 10 nM in the presence of 2.5 mM MgCl 2 . ( B ) NHEJ reactions were performed with 200 nM Polµ and using two sets of substrates: the labelled substrates contain 1TG or 1C and 1D-NHEJ, and the cold substrates, either 2AC or 2C and 2D-NHEJ. The dark spheres indicate the presence of a 5′-P group, which forces binding of this substrate to the 8 kDa domain of Polµ and thus its usage as the downstream part of the break. ddNTPs were added separately at 10 µM in the presence of 2.5 mM MgCl 2 . ( C ) Quantification of primer extension by wild-type Polµ and the indicated mutants in gap-filling and NHEJ reactions.

    Journal: Nucleic Acids Research

    Article Title: A specific N-terminal extension of the 8 kDa domain is required for DNA end-bridging by human Polu and Pol?

    doi: 10.1093/nar/gkt681

    Figure Lengend Snippet: Mutagenesis of the brooch specifically affects the end-joining activity of Polµ. ( A ) Gap-filling reactions were performed for 30 min at 30°C with wild-type Polµ and the indicated mutants (25 nM) using a gapped substrate containing the oligonucleotides SP1C, T13C and DG1-P. dNTPs were added separately at 10 nM in the presence of 2.5 mM MgCl 2 . ( B ) NHEJ reactions were performed with 200 nM Polµ and using two sets of substrates: the labelled substrates contain 1TG or 1C and 1D-NHEJ, and the cold substrates, either 2AC or 2C and 2D-NHEJ. The dark spheres indicate the presence of a 5′-P group, which forces binding of this substrate to the 8 kDa domain of Polµ and thus its usage as the downstream part of the break. ddNTPs were added separately at 10 µM in the presence of 2.5 mM MgCl 2 . ( C ) Quantification of primer extension by wild-type Polµ and the indicated mutants in gap-filling and NHEJ reactions.

    Article Snippet: Ultrapure dNTPs, dideoxynucleotides (ddNTPs) and [γ-32 P]ATP (3000 Ci/mmol) were purchased from GE Healthcare (USA).

    Techniques: Mutagenesis, Activity Assay, Non-Homologous End Joining, Binding Assay