Structured Review

Eurobio dntp
Dntp, supplied by Eurobio, used in various techniques. Bioz Stars score: 90/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Eurobio
Average 90 stars, based on 34 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-04
90/100 stars

Images

Related Articles

Amplification:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: .. PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water. .. PCR products were separated by agarose gel electrophoresis, followed by ethidium bromide staining.

Article Title: Establishment of a Human Thymic Myoid Cell Line
Article Snippet: PCR was carried out in a total volume of 100 μl containing 10 μl of RT reaction mixture, 10 μl of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2 , 0.1% gelatin, 1% Triton X-100), 0.5 μmol/L of each primer, 200 μmol/L of each dNTP, and 2.5 units of Taq polymerase (Eurobio). .. The reaction mixture was overlaid with mineral oil and then amplified in a PHC3 thermal cycler (Techne, Cambridge, UK) as follows: denaturing step, 94°C for 1 minute; annealing step at the indicated hybridization temperature (Table 1) for 1 minute; extension step, 72°C for 2 minutes.

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: Paragraph title: PCR amplification ... The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio).

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: .. PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France). .. The thermal cycle consisted of an initial 5 min denaturation at 95 °C followed by 35 cycles of 30 s denaturation at 95 °C, primer hybridization at 52 °C for 30 s, elongation at 72 °C for 5 min and a final 5 min elongation step at 72 °C.

Article Title: Copy Number Variation and Differential Expression of a Protective Endogenous Retrovirus in Sheep
Article Snippet: Paragraph title: DNA and cDNA Gag Amplification ... The PCR reactions were performed in 50 µl volumes containing Taq polymerase buffer, 1.65 mM MgCl2 , 200 µM each dNTP, 0.2 µM each primer, 100 to 500 ng of genomic DNA, and 1.25 U of Taq polymerase (Eurobio).

Article Title: Country-wide assessment of the genetic polymorphism in Plasmodium falciparum and Plasmodium vivax antigens detected with rapid diagnostic tests for malaria
Article Snippet: Paragraph title: Amplification by polymerase chain reaction ... The inner PCR was performed in a final reaction mixture of 55 μl containing PCR amplicons, 0.27 μM of each primer, 2.5 mM MgCl2 , 360 μM of each dNTP (Eurobio© ) and 2.5 U of FIREPol (Solis Biodyne© ).

Article Title: Protective immunity against atherosclerosis carried by B cells of hypercholesterolemic mice
Article Snippet: .. DNA was normalized between samples based on absorbance at 260 nm and amplified by PCR in a mastermix containing 67 mM Tris-HCl, 16 mM (NH4 )2 SO4 , 0.1% Tween-20, 0.75 mM MgCl2 , 0.2 mM dNTP, 1% vol/vol dimethylsulfoxide, 40 U/ml Euroblue Taq polymerase (Eurobio SA, Les Ulis, France), 2 μM primers (upper: 5′-GGA-CGC-GGC-GGT-GGT-AAT-GAC-AAG-3′; lower: 5′-GCG-CGG-CCG-GGT-AGC-ACA-GG-3′). .. The kinetics of the reaction were characterized by analyzing liver DNA after 30, 34, 38, 40, 42, 44, 46, and 48 PCR cycles.

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. Single plaque-isolated Tk− HSVLatβ-gal (HSVLatβ-gal) were then amplified on Vero cells.

Positive Control:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water. .. DNA of a strain of V. cholerae O1, Classical, Inaba (Institut Pasteur—CNRVC 940147) was run as a positive control.

Polymerase Chain Reaction:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: .. PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water. .. PCR products were separated by agarose gel electrophoresis, followed by ethidium bromide staining.

Article Title: Establishment of a Human Thymic Myoid Cell Line
Article Snippet: .. PCR was carried out in a total volume of 100 μl containing 10 μl of RT reaction mixture, 10 μl of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2 , 0.1% gelatin, 1% Triton X-100), 0.5 μmol/L of each primer, 200 μmol/L of each dNTP, and 2.5 units of Taq polymerase (Eurobio). .. The reaction mixture was overlaid with mineral oil and then amplified in a PHC3 thermal cycler (Techne, Cambridge, UK) as follows: denaturing step, 94°C for 1 minute; annealing step at the indicated hybridization temperature (Table 1) for 1 minute; extension step, 72°C for 2 minutes.

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: .. The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio). .. Initial denaturation at 94 °C for 5 min was followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 62 °C for 1 min. and extension at 72 °C for 1 min with a final elongation time of 10 min at 72 °C.

Article Title: TREK-1, a K+ channel involved in neuroprotection and general anesthesia
Article Snippet: .. PCR reactions were performed on 1 μl of a 20–30 times water dilution of the crude tail lysate in 15 μl final volume containing 67 mM Tris–HCl (pH 8.8), 16 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 200 mM dNTP and 0.2 μl Taq polymerase (Eurobio). .. Conditions were as follows: for TREK-1, 94°C/3 min≫(94°C/20 s≫58°C/20 s≫72°C/35 s) × 33, oligos (see ) #1 (5′GGT GCC AGG TAT GAA TAG AG3′), #2 (5′TTC TGA GCA GCA GAC TTG G3′), #3 (5′GTG TGA CTG GGA ATA AGA GG3′); for TRAAK, 94°C/3 min≫(94°C/30 s > 63.5°C/25 s > 72°C/35 s) × 35, primers #1 (5′CCCTGCTCCTTCTTCCC3′), #2 (3′ATTCTTCCTTCCTCCCTTCC5′), #3 (5′TGGACGAAGAGCATCAGGG3′), #4 (5′GAGGAGCAGCCAACTTTAGC3′) (see ).

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: .. The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl). .. The PCR conditions were set as follows: 1 cycle (94°C for 5 min), 33 cycles (94oC for 1 min, 55oC for 2 min, 72°C for 2 min), and 1 cycle (72°C for 20 min) in a Thermostable DNA Termocycler (Bio-Rad Laboratories, California, USA).

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Reverse primers were designed in such a way that PCR products were different in size (458 and 217 bp for P . walteri and P . synaselloides complex, respectively) and could be differentiated by electrophoresis on 1.5% agarose gels. .. Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: .. PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France). .. The thermal cycle consisted of an initial 5 min denaturation at 95 °C followed by 35 cycles of 30 s denaturation at 95 °C, primer hybridization at 52 °C for 30 s, elongation at 72 °C for 5 min and a final 5 min elongation step at 72 °C.

Article Title: Copy Number Variation and Differential Expression of a Protective Endogenous Retrovirus in Sheep
Article Snippet: .. The PCR reactions were performed in 50 µl volumes containing Taq polymerase buffer, 1.65 mM MgCl2 , 200 µM each dNTP, 0.2 µM each primer, 100 to 500 ng of genomic DNA, and 1.25 U of Taq polymerase (Eurobio). .. Positive and negative controls were based on PCR reactions performed using the penJS65A1 and pJS21 plasmids, which contain, respectively, enJSRV and exJSRV proviral sequences.

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: .. Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. Single plaque-isolated Tk− HSVLatβ-gal (HSVLatβ-gal) were then amplified on Vero cells.

Article Title: Country-wide assessment of the genetic polymorphism in Plasmodium falciparum and Plasmodium vivax antigens detected with rapid diagnostic tests for malaria
Article Snippet: .. The outer PCR was carried out in a final volume of 20 μl containing DNA template, 0.25 μM of each primer, 2.5 mM MgCl2 , 200 μM of each dNTP (Eurobio© ) and 1 U of FIREPol (Solis Biodyne© ). .. The inner PCR was performed in a final reaction mixture of 55 μl containing PCR amplicons, 0.27 μM of each primer, 2.5 mM MgCl2 , 360 μM of each dNTP (Eurobio© ) and 2.5 U of FIREPol (Solis Biodyne© ).

Construct:

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: Paragraph title: Plasmids and constructs ... The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl).

Electrophoresis:

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio). .. Amplicons were analysed by electrophoresis in 1.5% agarose gel containing ethidium bromide.

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl). .. After electrophoresis on 0.7% agarose gel (Roche, Germany) and determination of the size of the obtained DNA, the products of the first PCR were used as the template for the second (nested) PCR with sense and anti-sense of inner primers in V2R ( ).

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Reverse primers were designed in such a way that PCR products were different in size (458 and 217 bp for P . walteri and P . synaselloides complex, respectively) and could be differentiated by electrophoresis on 1.5% agarose gels. .. Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Incubation:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Cellular debris were spun down, and new confluent Vero cells were infected with the resulting supernatant and incubated at 37°C in the presence of 10 μ m acyclovir. .. Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide.

Hybridization:

Article Title: Establishment of a Human Thymic Myoid Cell Line
Article Snippet: PCR was carried out in a total volume of 100 μl containing 10 μl of RT reaction mixture, 10 μl of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2 , 0.1% gelatin, 1% Triton X-100), 0.5 μmol/L of each primer, 200 μmol/L of each dNTP, and 2.5 units of Taq polymerase (Eurobio). .. The reaction mixture was overlaid with mineral oil and then amplified in a PHC3 thermal cycler (Techne, Cambridge, UK) as follows: denaturing step, 94°C for 1 minute; annealing step at the indicated hybridization temperature (Table 1) for 1 minute; extension step, 72°C for 2 minutes.

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France). .. The thermal cycle consisted of an initial 5 min denaturation at 95 °C followed by 35 cycles of 30 s denaturation at 95 °C, primer hybridization at 52 °C for 30 s, elongation at 72 °C for 5 min and a final 5 min elongation step at 72 °C.

Article Title: Country-wide assessment of the genetic polymorphism in Plasmodium falciparum and Plasmodium vivax antigens detected with rapid diagnostic tests for malaria
Article Snippet: The inner PCR was performed in a final reaction mixture of 55 μl containing PCR amplicons, 0.27 μM of each primer, 2.5 mM MgCl2 , 360 μM of each dNTP (Eurobio© ) and 2.5 U of FIREPol (Solis Biodyne© ). .. Similar conditions were used for the inner PCR, but with different hybridization (58°C for 20 s) and elongation (72°C for 70 s) temperatures.

Infection:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Cellular debris were spun down, and new confluent Vero cells were infected with the resulting supernatant and incubated at 37°C in the presence of 10 μ m acyclovir. .. Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide.

Generated:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Tk− HSVLatβ-gal was generated by cotransfecting 5 μg of linearized p23d DNA, using the calcium phosphate precipitation method, with 5 μg of HSVLatβ-gal into Vero cells grown in 1× DMEM (Life Technologies, Gaithersburg, MD) containing 10 U/ml of penicillin and streptomycin, 7.5 m m sodium bicarbonate, 2 m m glutamine, and 10% fetal calf serum. .. Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Establishment of a Human Thymic Myoid Cell Line
Article Snippet: Paragraph title: RT-PCR ... PCR was carried out in a total volume of 100 μl containing 10 μl of RT reaction mixture, 10 μl of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2 , 0.1% gelatin, 1% Triton X-100), 0.5 μmol/L of each primer, 200 μmol/L of each dNTP, and 2.5 units of Taq polymerase (Eurobio).

Recombinant:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. Recombinant HSVLatEnk were isolated by PCR analysis and purified by successive limiting dilutions.

DNA Extraction:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: Molecular identification DNA extraction : DNA extraction was done on overnight subculture on NA2 using the chloroform-phenol procedure ( ). .. PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water.

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Given the prevalence of cryptic species in the Proasellus genus [ ] and the occurrence of a morphologically similar species complex Proasellus synaselloides (Henry, 1963) living in sympatry with P . walteri , molecular verifications were conducted for each individual after genomic DNA extraction (see below). .. Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Mutagenesis:

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: Nested polymerase chain reaction (PCR) was used for the synthesis of the mutant V2 receptor insert. .. The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl).

Isolation:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. Recombinant HSVLatEnk were isolated by PCR analysis and purified by successive limiting dilutions.

Size-exclusion Chromatography:

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio). .. Initial denaturation at 94 °C for 5 min was followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 62 °C for 1 min. and extension at 72 °C for 1 min with a final elongation time of 10 min at 72 °C.

Purification:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. Recombinant HSVLatEnk were isolated by PCR analysis and purified by successive limiting dilutions.

Sequencing:

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Molecular identifications of species selected for cross-species transferability of microsatellites ( ) were performed by sequencing a fragment of the 16S using genus-specific primers (Forward: as above; reverse 16Sbr: 5′- CCGGTCTGAACTCAGATCACGT -3’ [ ]) and by comparing obtained sequences to available references . .. Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: Paragraph title: 16S rRNA, rpoB, hsp60, gyrB and dnaJ genes amplification and sequencing ... PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France).

Blocking Assay:

Article Title: Protective immunity against atherosclerosis carried by B cells of hypercholesterolemic mice
Article Snippet: DNA was normalized between samples based on absorbance at 260 nm and amplified by PCR in a mastermix containing 67 mM Tris-HCl, 16 mM (NH4 )2 SO4 , 0.1% Tween-20, 0.75 mM MgCl2 , 0.2 mM dNTP, 1% vol/vol dimethylsulfoxide, 40 U/ml Euroblue Taq polymerase (Eurobio SA, Les Ulis, France), 2 μM primers (upper: 5′-GGA-CGC-GGC-GGT-GGT-AAT-GAC-AAG-3′; lower: 5′-GCG-CGG-CCG-GGT-AGC-ACA-GG-3′). .. In all these analyses, the first PCR cycle started with 2.5 minutes in a hot block at 92°C followed by 1 minute at 61°C and 2 minutes at 72°C.

Lysis:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Lysis plaques resistant to acyclovir were picked and separated in two aliquots. .. Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide.

Nested PCR:

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: Nested polymerase chain reaction (PCR) was used for the synthesis of the mutant V2 receptor insert. .. The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl).

Article Title: Country-wide assessment of the genetic polymorphism in Plasmodium falciparum and Plasmodium vivax antigens detected with rapid diagnostic tests for malaria
Article Snippet: Plasmodium vivax DNA was amplified by nested PCR. .. The inner PCR was performed in a final reaction mixture of 55 μl containing PCR amplicons, 0.27 μM of each primer, 2.5 mM MgCl2 , 360 μM of each dNTP (Eurobio© ) and 2.5 U of FIREPol (Solis Biodyne© ).

Plasmid Preparation:

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: A schematic presentation of pcDNA3 plasmid containing wild type V2R and the location of the above mentioned primers is shown in . .. The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl).

Software:

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: A pair of primers was designed for DRI (aspartate-arginine-isoleucine) mutant by using WDNASIS26 program (Hitachi Software Engineering Co., Tokyo, Japan). .. The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl).

Multiplex Assay:

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Following Chapman et al. [ ], we developed a multiplex PCR scheme using one genus-specific forward primer (16S-ProaF1: 5’-CCTATGAGTCGTTTAAATGGCCGCA-3’ [ ]) and two species-specific reverse primers (16S-Pwalt-R458: 5’- CTATCTATATATATATTTGCTTATATAGGG-3’ , 16S-Psyna-R217: 5’- TAAAGTTTTATAGGGTCTTATCGTCCA-3’ , for P . walteri and P . synaselloides complex, respectively) targeting the 16S mitochondrial DNA. .. Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Agarose Gel Electrophoresis:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water. .. PCR products were separated by agarose gel electrophoresis, followed by ethidium bromide staining.

Article Title: Establishment of a Human Thymic Myoid Cell Line
Article Snippet: PCR was carried out in a total volume of 100 μl containing 10 μl of RT reaction mixture, 10 μl of PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2 , 0.1% gelatin, 1% Triton X-100), 0.5 μmol/L of each primer, 200 μmol/L of each dNTP, and 2.5 units of Taq polymerase (Eurobio). .. PCR products were analyzed on 1.5% agarose gel containing ethidium bromide.

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio). .. Amplicons were analysed by electrophoresis in 1.5% agarose gel containing ethidium bromide.

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl). .. After electrophoresis on 0.7% agarose gel (Roche, Germany) and determination of the size of the obtained DNA, the products of the first PCR were used as the template for the second (nested) PCR with sense and anti-sense of inner primers in V2R ( ).

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France). .. PCR reaction was examined by electrophoresing 5 μL of PCR product on a 1% agarose gel stained with ethidium bromide.

Sampling:

Article Title: Microsatellite Development and First Population Size Estimates for the Groundwater Isopod Proasellus walteri
Article Snippet: Paragraph title: Sampling and taxonomic identification ... Standard PCRs were conducted with a final 15 µl volume containing 1.5 µl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 µl of each primer (10 µM), 0.18 µl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 µl of BSA (10 mg ml-1 , New England Biolabs, Ipswich, USA), 0.13 µl of dNTP (20 mM, Eurogenetec), 0.13 µl of EurobioTaq DNA Polymerase (5 U µl-1 , Eurobio, Courtaboeuf, France) and 2 µl of genomic DNA (c. 10 ng µl-1 ).

Produced:

Article Title: Protective immunity against atherosclerosis carried by B cells of hypercholesterolemic mice
Article Snippet: DNA was normalized between samples based on absorbance at 260 nm and amplified by PCR in a mastermix containing 67 mM Tris-HCl, 16 mM (NH4 )2 SO4 , 0.1% Tween-20, 0.75 mM MgCl2 , 0.2 mM dNTP, 1% vol/vol dimethylsulfoxide, 40 U/ml Euroblue Taq polymerase (Eurobio SA, Les Ulis, France), 2 μM primers (upper: 5′-GGA-CGC-GGC-GGT-GGT-AAT-GAC-AAG-3′; lower: 5′-GCG-CGG-CCG-GGT-AGC-ACA-GG-3′). .. A 37-cycle PCR was chosen for the subsequent analyses since sufficient reaction product was produced to permit easy detection while the reaction was still in an exponential phase (see Results).

CTG Assay:

Article Title: ITS2-rDNA Sequence Variation of Phlebotomus sergenti s.l. (Dip: Psychodidae) Populations in Iran
Article Snippet: PCR were performed in a 50 μl volume using 5 μl of extracted DNA solution and 50 pmol of each of the two primers of C1a: 5′-CCT GGT TAG TTT CTT TTC CTC CGC T-3′ and JTS3 : 5′-CGC AGC TAA CTG TGT GAA ATC-3′. .. The PCR mix contained (final concentrations) 10 mM Tris HCl, pH 8.3, 1.5 mM MgCl2, KCl 50 mM, Triton X 100 0.01%, 200 μM dNTP each, and 0.25 μl (1.25 units) of Taq DNA polymerase (Eurobio).

Article Title: TREK-1, a K+ channel involved in neuroprotection and general anesthesia
Article Snippet: PCR reactions were performed on 1 μl of a 20–30 times water dilution of the crude tail lysate in 15 μl final volume containing 67 mM Tris–HCl (pH 8.8), 16 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 200 mM dNTP and 0.2 μl Taq polymerase (Eurobio). .. Conditions were as follows: for TREK-1, 94°C/3 min≫(94°C/20 s≫58°C/20 s≫72°C/35 s) × 33, oligos (see ) #1 (5′GGT GCC AGG TAT GAA TAG AG3′), #2 (5′TTC TGA GCA GCA GAC TTG G3′), #3 (5′GTG TGA CTG GGA ATA AGA GG3′); for TRAAK, 94°C/3 min≫(94°C/30 s > 63.5°C/25 s > 72°C/35 s) × 35, primers #1 (5′CCCTGCTCCTTCTTCCC3′), #2 (3′ATTCTTCCTTCCTCCCTTCC5′), #3 (5′TGGACGAAGAGCATCAGGG3′), #4 (5′GAGGAGCAGCCAACTTTAGC3′) (see ).

Staining:

Article Title: Vibrio cholerae in the Environment: A Simple Method for Reliable Identification of the Species
Article Snippet: PCR assays : PCR amplification of the target DNA was carried out in a thermal cycler (Hybaid-PCR express) using 200-μL PCR tubes with a reaction mixture volume of 25 μL containing 3 μL of template DNA, 0.2 μL of each primer (100 μM), 2.5 μL of 2 mM dNTP, 0.125 μL (5 U/μL) of Taq polymerase (Eurobio), 2.5 μL of 10X reaction buffer, 1.25 μL of MgCl2 50 M (Eurobio), and ultra-pure water. .. PCR products were separated by agarose gel electrophoresis, followed by ethidium bromide staining.

Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
Article Snippet: The first PCR was performed using 50 ng cDNA of V2R (as template), 5 µl 10X PCR buffer containing 2 mM MgCl2 (Biotools, B & M Labs, Madrid, Spane), 0.5 mM dNTP (Eurobio Laboratories, France), 5 U Taq DNA polymerase (Biotools), 2.5 µM of each sense and anti-sense of DRI with outer primers in V2R in 2 steps (total volume of 50 µl). .. The PCR products were confirmed by staining of the agarose gel with ethidium bromide using a UV transilluminator, and the obtained DNA bands were detected.

Article Title: High-quality draft genome sequence of Enterobacter sp. Bisph2, a glyphosate-degrading bacterium isolated from a sandy soil of Biskra, Algeria
Article Snippet: PCR amplification was carried-out in a 50 μL volume containing 5 μL template, 50 mM KCl, 1.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each oligonucleotide primers and 0.5 units of Taq DNA polymerase (EuroblueTaq, Eurobio, Les Ulis, France). .. PCR reaction was examined by electrophoresing 5 μL of PCR product on a 1% agarose gel stained with ethidium bromide.

Homologous Recombination:

Article Title: Therapeutic Efficacy in Experimental Polyarthritis of Viral-Driven Enkephalin Overproduction in Sensory Neurons
Article Snippet: Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were made with 40 pmol of primers (primer A, 5′GCGCTCCTCGTACCAGCGAAG3′; primer B, 5′CCAGCGTCTTGTCAT TGGCG3′) (Fig. ) in a mixture containing 10 m m each dNTP, 25 m m MgSO4 , and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5% formamide. .. HSVLatEnk was generated by pLatEnk DNA homologous recombination with HSVLatβ-gal DNA in Vero cells as indicated above.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Eurobio dntp
    Dntp, supplied by Eurobio, used in various techniques. Bioz Stars score: 90/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Eurobio
    Average 90 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results