Structured Review

TaKaRa dntp mixture
Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp mixture/product/TaKaRa
Average 99 stars, based on 21 article reviews
Price from $9.99 to $1999.99
dntp mixture - by Bioz Stars, 2019-12
99/100 stars

Images

Related Articles

Amplification:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: Aliquots from the reverse transcription reaction were used for PCR amplification with primer pairs ubiquitously expressing GAPDH as an internal control. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells
Article Snippet: Paragraph title: Reverse transcription (RT) amplification of mRNA ... RT reactions were performed to generate cDNA using 2 μg RNA, Moloney murine leukemia virus reverse transcriptase, ribonuclease inhibitor and a dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s instructions.

Article Title: Association of cervical microbial community with persistence, clearance and negativity of Human Papillomavirus in Korean women: a longitudinal study
Article Snippet: The 16 S universal primers 27 F (5′ GAGTTTGATCMTGGCTCAG 3′) and 518 R (5′ WTTACCGCGGCTGC-TGG 3′) were used for amplification. .. A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara).

Article Title: Tumor cells have decreased ability to metabolize H2O2: Implications for pharmacological ascorbate in cancer therapy
Article Snippet: Hence, the amount of PCR amplification is inversely proportional to lesion frequency within a given DNA sample. .. The total volume of reaction was 50 µL, containing 15 ng (nDNA assay), or 5 ng (mtDNA assay) of total genomic DNA, 1X LA PCR buffer II (Mg2+ plus), 400 µM dNTP mixture, 0.4 µM primers and 2.5 units of Takara LA Taq.

Article Title: EPB41L3 is a potential tumor suppressor gene and prognostic indicator in esophageal squamous cell carcinoma
Article Snippet: The modified DNA was maintained at −20°C until PCR amplification. .. MSP was performed with 0.25 µ l Taq HS, primers (500 nM), 50 ng total genomic DNA, and dNTP Mixture, and 10X PCR Buffer (both from Takara Biotechnology Co., Ltd., Dalian, China) in a total reaction volume of 20 µ l. The primer pairs for EPB41L3 were as follows: to detect unmethylated sites, US, 5′-TTTGTGTATTGT TGTTGAGGAGTG-3′ and UAS, 5′-CACAATCCCCCACTCCA AAAAACA-3′; and to detect methylated sites, MS, 5′-GCAGTG CAAAGTGATACTTC-3′ and MAS, 5′-TCTGGTGGATAAA ATTTCACAT-3′.

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Reactions were performed on a TGradient thermocycler (Biometra, Göttingen, Germany). .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

Article Title: Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1α Signaling Pathway
Article Snippet: Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL. .. The conditions for long PCR were as previously reported [ ] and the PCR products were digested with the restriction enzyme NcoI (Promega, Madison, WI, USA) at 37 °C for 2 h and fractionated through 1% agarose gel.

Mass Spectrometry:

Article Title: EPB41L3 is a potential tumor suppressor gene and prognostic indicator in esophageal squamous cell carcinoma
Article Snippet: The modified DNA was maintained at −20°C until PCR amplification. .. MSP was performed with 0.25 µ l Taq HS, primers (500 nM), 50 ng total genomic DNA, and dNTP Mixture, and 10X PCR Buffer (both from Takara Biotechnology Co., Ltd., Dalian, China) in a total reaction volume of 20 µ l. The primer pairs for EPB41L3 were as follows: to detect unmethylated sites, US, 5′-TTTGTGTATTGT TGTTGAGGAGTG-3′ and UAS, 5′-CACAATCCCCCACTCCA AAAAACA-3′; and to detect methylated sites, MS, 5′-GCAGTG CAAAGTGATACTTC-3′ and MAS, 5′-TCTGGTGGATAAA ATTTCACAT-3′. .. The thermocycling conditions for the MSP were: 95°C for 10 min, then 38 cycles of 94°C for 30 sec, 58°C or 60°C or 55°C for 30 sec and 72°C for 30 sec, followed by 72°C for 5 min, as previously described ( ).

Synthesized:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd., Shanghai, China, and were as follows: Brain-derived neurotrophic factor: forward primer 5’-GCC CAT ATG ACC ATC CTT TTC CTT A-3’, reverse primer 5’-CTA TCT TCC CCT TTT AAT GGT CAG -3’, the length was 25 bp; GAPDH: forward primer 5’-ACC ACA GTC CAT GCC ATC AC-3’, reverse primer 5’-TCC ACC ACC CTG TTG CTG TA- 3’, the length was 20 bp. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: For semi-quantitative RT-PCR, first-strand cDNA was synthesized using 5 μg of total RNA and M-MLV reverse transcriptase (Promega). .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Article Title: Diabetes Aggravates Post-ischaemic Renal Fibrosis through Persistent Activation of TGF-β1 and Shh Signalling
Article Snippet: Total RNA was extracted from kidney tissue by using the Nucleospin® RNA kit (Macherey-Nagel, Düren, W. Germany) according to the manufacturer’s instructions and was quantified using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc., San Jose, CA, USA). .. Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea). .. Real-time PCR was performed in reactions with a final volume of 20 μl containing 1 μl of cDNA, 10 pmol of each sense and antisense primer, and 17 μl of Power SYBR® Green PCR Master mix (Applied Biosystems, Beverly, MA, USA) and was detected using the Applied Biosystems® StepOnePlus™ Real-Time PCR System.

Article Title: Expression of somatostatin and its receptor 1–5 in endometriotic tissues and cells
Article Snippet: The primers were synthesized by Nanjing GenScript Biotechnical Co., Ltd (Nanjing, China) and had the following sequences (in 5′-3′ direction): SS upstream, GCTGCTGTCTGAACCC and downstream, CGTTCTCGGGGTGCCATAG (product length, 138 bp); GAPDH upstream, TGCACCACCAACTGC and downstream, GGCATGGACTGTGGTCATGAG (product length, 87 bp). .. Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl.

Quantitative RT-PCR:

Article Title: Interleukin-21 plays a critical role in the pathogenesis and severity of type I autoimmune hepatitis
Article Snippet: Paragraph title: Quantitative RT-PCR ... RNA was reverse transcribed to single stranded cDNA using the Random Primer, dNTP Mixture (Takara Shuzo Co., Ltd., Shiga, Japan) and RNasin®

Article Title: Spatial transcriptomic survey of human embryonic cerebral cortex by single-cell RNA-seq analysis
Article Snippet: Paragraph title: RT-qPCR validation ... Then reverse transcription was carried out in a volume of 19 μl, containing 2.5 ng/μl oligod(T) primer (Takara, Cat# 3806), 0.5 mM dNTP mixture (Takara, Cat# R045B), 2 U/μl RNase inhibitor (Ambion, Cat# AM2684), 5 mM DTT, 1× first strand and 0.5 U/μl superscript III reverse transcriptase (Invitrogen, Cat# 18080-044).

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: Paragraph title: Total RNA isolation, and semi-quantitative and quantitative RT-PCR analysis ... PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Article Title: Expression of somatostatin and its receptor 1–5 in endometriotic tissues and cells
Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) ... Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl.

Article Title: Organic Peroxide-Sensing Repressor OhrR Regulates Organic Hydroperoxide Stress Resistance and Avermectin Production in Streptomyces avermitilis
Article Snippet: The concentrations of RNA were measured by NanoVue Plus spectrophotometer (GE Healthcare). .. Each RNA sample (2 μg) was reverse transcribed by random hexamers (25 μM), dNTP mixture (10 mM) and M-MLV (TaKaRa, Japan). qRT-PCR was performed to determine the transcription levels of various genes using primers listed in Supplementary Table . .. Each reaction system (20 μl) contains template cDNA, forward and reverse primers (each 300 nM) and 10 μl FastStart Universal SYBR Green Master (ROX).

Real-time Polymerase Chain Reaction:

Article Title: Spatial transcriptomic survey of human embryonic cerebral cortex by single-cell RNA-seq analysis
Article Snippet: Then reverse transcription was carried out in a volume of 19 μl, containing 2.5 ng/μl oligod(T) primer (Takara, Cat# 3806), 0.5 mM dNTP mixture (Takara, Cat# R045B), 2 U/μl RNase inhibitor (Ambion, Cat# AM2684), 5 mM DTT, 1× first strand and 0.5 U/μl superscript III reverse transcriptase (Invitrogen, Cat# 18080-044). .. Then reverse transcription was carried out in a volume of 19 μl, containing 2.5 ng/μl oligod(T) primer (Takara, Cat# 3806), 0.5 mM dNTP mixture (Takara, Cat# R045B), 2 U/μl RNase inhibitor (Ambion, Cat# AM2684), 5 mM DTT, 1× first strand and 0.5 U/μl superscript III reverse transcriptase (Invitrogen, Cat# 18080-044).

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction. .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Article Title: Diabetes Aggravates Post-ischaemic Renal Fibrosis through Persistent Activation of TGF-β1 and Shh Signalling
Article Snippet: Paragraph title: Isolation of total RNA and real-time PCR ... Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea).

Article Title: Tumor cells have decreased ability to metabolize H2O2: Implications for pharmacological ascorbate in cancer therapy
Article Snippet: Paragraph title: Genomic DNA isolation and quantitative PCR (QPCR) ... The total volume of reaction was 50 µL, containing 15 ng (nDNA assay), or 5 ng (mtDNA assay) of total genomic DNA, 1X LA PCR buffer II (Mg2+ plus), 400 µM dNTP mixture, 0.4 µM primers and 2.5 units of Takara LA Taq.

Article Title: Notch1 deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation
Article Snippet: Paragraph title: Quantitative real-time PCR ... Total RNA (500 ng) and 300 pmol random primers were mixed and heated at 65 °C for 5 minutes, and reverse transcribed using RTase M-MLV buffer, dNTP mixture, and RTase M-MLV (2640A, Takara, Ohtsu, Japan) at 37 °C for 50 minutes.

Incubation:

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

Expressing:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: Paragraph title: Reverse transcription-PCR for brain-derived neurotrophic factor mRNA expression ... The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: Diabetes Aggravates Post-ischaemic Renal Fibrosis through Persistent Activation of TGF-β1 and Shh Signalling
Article Snippet: Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea). .. Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea).

Article Title: Expression of somatostatin and its receptor 1–5 in endometriotic tissues and cells
Article Snippet: Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl. .. Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl.

Article Title: Notch1 deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation
Article Snippet: Total RNA (500 ng) and 300 pmol random primers were mixed and heated at 65 °C for 5 minutes, and reverse transcribed using RTase M-MLV buffer, dNTP mixture, and RTase M-MLV (2640A, Takara, Ohtsu, Japan) at 37 °C for 50 minutes. .. Total RNA (500 ng) and 300 pmol random primers were mixed and heated at 65 °C for 5 minutes, and reverse transcribed using RTase M-MLV buffer, dNTP mixture, and RTase M-MLV (2640A, Takara, Ohtsu, Japan) at 37 °C for 50 minutes.

Article Title: Organic Peroxide-Sensing Repressor OhrR Regulates Organic Hydroperoxide Stress Resistance and Avermectin Production in Streptomyces avermitilis
Article Snippet: Each RNA sample (2 μg) was reverse transcribed by random hexamers (25 μM), dNTP mixture (10 mM) and M-MLV (TaKaRa, Japan). qRT-PCR was performed to determine the transcription levels of various genes using primers listed in Supplementary Table . .. Each reaction system (20 μl) contains template cDNA, forward and reverse primers (each 300 nM) and 10 μl FastStart Universal SYBR Green Master (ROX).

Modification:

Article Title: EPB41L3 is a potential tumor suppressor gene and prognostic indicator in esophageal squamous cell carcinoma
Article Snippet: The modified DNA was maintained at −20°C until PCR amplification. .. MSP was performed with 0.25 µ l Taq HS, primers (500 nM), 50 ng total genomic DNA, and dNTP Mixture, and 10X PCR Buffer (both from Takara Biotechnology Co., Ltd., Dalian, China) in a total reaction volume of 20 µ l. The primer pairs for EPB41L3 were as follows: to detect unmethylated sites, US, 5′-TTTGTGTATTGT TGTTGAGGAGTG-3′ and UAS, 5′-CACAATCCCCCACTCCA AAAAACA-3′; and to detect methylated sites, MS, 5′-GCAGTG CAAAGTGATACTTC-3′ and MAS, 5′-TCTGGTGGATAAA ATTTCACAT-3′.

Article Title: Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1α Signaling Pathway
Article Snippet: The long PCR method yielded reliable quantification of virtually completely intact rat mitochondrial DNA (mtDNA) with the use of mouse mtDNA as an internal control, as previously reported [ ], with modification. .. Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL.

Chloramphenicol Acetyltransferase Assay:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd., Shanghai, China, and were as follows: Brain-derived neurotrophic factor: forward primer 5’-GCC CAT ATG ACC ATC CTT TTC CTT A-3’, reverse primer 5’-CTA TCT TCC CCT TTT AAT GGT CAG -3’, the length was 25 bp; GAPDH: forward primer 5’-ACC ACA GTC CAT GCC ATC AC-3’, reverse primer 5’-TCC ACC ACC CTG TTG CTG TA- 3’, the length was 20 bp. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Sequencing:

Article Title: PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells
Article Snippet: RT reactions were performed to generate cDNA using 2 μg RNA, Moloney murine leukemia virus reverse transcriptase, ribonuclease inhibitor and a dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s instructions. .. Semi-quantitative, RT-polymerase chain reaction (PCR) was conducted using the cDNA templates.

Article Title: Association of cervical microbial community with persistence, clearance and negativity of Human Papillomavirus in Korean women: a longitudinal study
Article Snippet: A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara). .. A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara).

other:

Article Title: A natural non-Watson–Crick base pair in human mitochondrial tRNAThr causes structural and functional susceptibility to local mutations
Article Snippet: The dNTP mixture was purchased from Takara (Japan).

Polymerase Chain Reaction:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd., Shanghai, China, and were as follows: Brain-derived neurotrophic factor: forward primer 5’-GCC CAT ATG ACC ATC CTT TTC CTT A-3’, reverse primer 5’-CTA TCT TCC CCT TTT AAT GGT CAG -3’, the length was 25 bp; GAPDH: forward primer 5’-ACC ACA GTC CAT GCC ATC AC-3’, reverse primer 5’-TCC ACC ACC CTG TTG CTG TA- 3’, the length was 20 bp. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL. .. The PCR reaction was cycled 30 times at 94°C for 5 minutes, 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 1 minute.

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: For semi-quantitative RT-PCR, first-strand cDNA was synthesized using 5 μg of total RNA and M-MLV reverse transcriptase (Promega). .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction. .. The gene-specific primers for ACO s are listed in .

Article Title: PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells
Article Snippet: RT reactions were performed to generate cDNA using 2 μg RNA, Moloney murine leukemia virus reverse transcriptase, ribonuclease inhibitor and a dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s instructions. .. RT reactions were performed to generate cDNA using 2 μg RNA, Moloney murine leukemia virus reverse transcriptase, ribonuclease inhibitor and a dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s instructions.

Article Title: Association of cervical microbial community with persistence, clearance and negativity of Human Papillomavirus in Korean women: a longitudinal study
Article Snippet: The 16 S universal primers 27 F (5′ GAGTTTGATCMTGGCTCAG 3′) and 518 R (5′ WTTACCGCGGCTGC-TGG 3′) were used for amplification. .. A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara). .. The PCR conditions and pyrosequencing protocols are available elsewhere .

Article Title: Tumor cells have decreased ability to metabolize H2O2: Implications for pharmacological ascorbate in cancer therapy
Article Snippet: QPCR was performed in a 2720 Thermal Cycle (Applied Biosystems, Foster City, CA) with LA PCR Kit, Version 2.1 (Clontech Laboratories, Mountain View, CA). .. The total volume of reaction was 50 µL, containing 15 ng (nDNA assay), or 5 ng (mtDNA assay) of total genomic DNA, 1X LA PCR buffer II (Mg2+ plus), 400 µM dNTP mixture, 0.4 µM primers and 2.5 units of Takara LA Taq. .. The oligonucleotide primers used in this study were prepared by Integrated DNA Technologies (Coralville, IA).

Article Title: Expression of somatostatin and its receptor 1–5 in endometriotic tissues and cells
Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) ... Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl.

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: PCR was performed using the rTaq PCR system (Takara). .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase. .. The PCR conditions were set to the following: denaturation for 5 min at 94 °C, followed by 22 cycles of amplification, which consisted of denaturation at 94 °C for 30 seconds, annealing at 60 °C for 30 seconds and extension at 72 °C for 3 minutes.

Article Title: EPB41L3 is a potential tumor suppressor gene and prognostic indicator in esophageal squamous cell carcinoma
Article Snippet: The modified DNA was maintained at −20°C until PCR amplification. .. MSP was performed with 0.25 µ l Taq HS, primers (500 nM), 50 ng total genomic DNA, and dNTP Mixture, and 10X PCR Buffer (both from Takara Biotechnology Co., Ltd., Dalian, China) in a total reaction volume of 20 µ l. The primer pairs for EPB41L3 were as follows: to detect unmethylated sites, US, 5′-TTTGTGTATTGT TGTTGAGGAGTG-3′ and UAS, 5′-CACAATCCCCCACTCCA AAAAACA-3′; and to detect methylated sites, MS, 5′-GCAGTG CAAAGTGATACTTC-3′ and MAS, 5′-TCTGGTGGATAAA ATTTCACAT-3′. .. The thermocycling conditions for the MSP were: 95°C for 10 min, then 38 cycles of 94°C for 30 sec, 58°C or 60°C or 55°C for 30 sec and 72°C for 30 sec, followed by 72°C for 5 min, as previously described ( ).

Article Title: Organic Peroxide-Sensing Repressor OhrR Regulates Organic Hydroperoxide Stress Resistance and Avermectin Production in Streptomyces avermitilis
Article Snippet: Each RNA sample (2 μg) was reverse transcribed by random hexamers (25 μM), dNTP mixture (10 mM) and M-MLV (TaKaRa, Japan). qRT-PCR was performed to determine the transcription levels of various genes using primers listed in Supplementary Table . .. Each reaction system (20 μl) contains template cDNA, forward and reverse primers (each 300 nM) and 10 μl FastStart Universal SYBR Green Master (ROX).

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Reactions were performed on a TGradient thermocycler (Biometra, Göttingen, Germany). .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

Article Title: Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1α Signaling Pathway
Article Snippet: Paragraph title: 4.9. Long PCR for Quantitation of Mitochondrial DNA ... Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL.

Recombinant:

Article Title: A minimalist mitochondrial threonyl-tRNA synthetase exhibits tRNA-isoacceptor specificity during proofreading
Article Snippet: The dNTP mixture was obtained from TaKaRa (Japan). .. The dNTP mixture was obtained from TaKaRa (Japan).

DNA Extraction:

Article Title: Association of cervical microbial community with persistence, clearance and negativity of Human Papillomavirus in Korean women: a longitudinal study
Article Snippet: Paragraph title: DNA isolation and pyrosequencing ... A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara).

Article Title: Tumor cells have decreased ability to metabolize H2O2: Implications for pharmacological ascorbate in cancer therapy
Article Snippet: Paragraph title: Genomic DNA isolation and quantitative PCR (QPCR) ... The total volume of reaction was 50 µL, containing 15 ng (nDNA assay), or 5 ng (mtDNA assay) of total genomic DNA, 1X LA PCR buffer II (Mg2+ plus), 400 µM dNTP mixture, 0.4 µM primers and 2.5 units of Takara LA Taq.

Methylation:

Article Title: EPB41L3 is a potential tumor suppressor gene and prognostic indicator in esophageal squamous cell carcinoma
Article Snippet: The modified DNA was maintained at −20°C until PCR amplification. .. MSP was performed with 0.25 µ l Taq HS, primers (500 nM), 50 ng total genomic DNA, and dNTP Mixture, and 10X PCR Buffer (both from Takara Biotechnology Co., Ltd., Dalian, China) in a total reaction volume of 20 µ l. The primer pairs for EPB41L3 were as follows: to detect unmethylated sites, US, 5′-TTTGTGTATTGT TGTTGAGGAGTG-3′ and UAS, 5′-CACAATCCCCCACTCCA AAAAACA-3′; and to detect methylated sites, MS, 5′-GCAGTG CAAAGTGATACTTC-3′ and MAS, 5′-TCTGGTGGATAAA ATTTCACAT-3′. .. The thermocycling conditions for the MSP were: 95°C for 10 min, then 38 cycles of 94°C for 30 sec, 58°C or 60°C or 55°C for 30 sec and 72°C for 30 sec, followed by 72°C for 5 min, as previously described ( ).

Mutagenesis:

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: Total RNA was extracted from the wild-type, mutant, and chemical-treated seedlings using TRI reagent (Sigma). .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Isolation:

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: Paragraph title: Total RNA isolation, and semi-quantitative and quantitative RT-PCR analysis ... PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Article Title: Association of cervical microbial community with persistence, clearance and negativity of Human Papillomavirus in Korean women: a longitudinal study
Article Snippet: DNA from cervical samples were isolated using the Fast DNA SPIN kit (MP Biomedicals, Santa Ana, CA, USA). .. A 20 ng aliquot of each sample was used for a 50 µl PCR reaction containing 10 × taq buffer, a dNTP mixture (Takara, shiga, Japan), 10 μm of the bar-coded fusion primers, and 2 U of taq Polymerase (extaq, takara).

Article Title: Diabetes Aggravates Post-ischaemic Renal Fibrosis through Persistent Activation of TGF-β1 and Shh Signalling
Article Snippet: Paragraph title: Isolation of total RNA and real-time PCR ... Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea).

Article Title: Notch1 deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation
Article Snippet: Isolated RNA was further cleaned by phenol-chloroform extraction, followed by ethanol precipitation. .. Total RNA (500 ng) and 300 pmol random primers were mixed and heated at 65 °C for 5 minutes, and reverse transcribed using RTase M-MLV buffer, dNTP mixture, and RTase M-MLV (2640A, Takara, Ohtsu, Japan) at 37 °C for 50 minutes.

Article Title: Organic Peroxide-Sensing Repressor OhrR Regulates Organic Hydroperoxide Stress Resistance and Avermectin Production in Streptomyces avermitilis
Article Snippet: RNA was isolated from S. avermitilis mycelia grown in FM-I or YEME, using TRIzol reagent (Tiangen, China) as described previously ( ). .. Each RNA sample (2 μg) was reverse transcribed by random hexamers (25 μM), dNTP mixture (10 mM) and M-MLV (TaKaRa, Japan). qRT-PCR was performed to determine the transcription levels of various genes using primers listed in Supplementary Table .

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: For semi-quantitative RT-PCR, first-strand cDNA was synthesized using 5 μg of total RNA and M-MLV reverse transcriptase (Promega). .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Construct:

Article Title: A minimalist mitochondrial threonyl-tRNA synthetase exhibits tRNA-isoacceptor specificity during proofreading
Article Snippet: The dNTP mixture was obtained from TaKaRa (Japan). .. The dNTP mixture was obtained from TaKaRa (Japan).

Activated Clotting Time Assay:

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

Plasmid Preparation:

Article Title: A minimalist mitochondrial threonyl-tRNA synthetase exhibits tRNA-isoacceptor specificity during proofreading
Article Snippet: The dNTP mixture was obtained from TaKaRa (Japan). .. The dNTP mixture was obtained from TaKaRa (Japan).

Software:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells
Article Snippet: RT reactions were performed to generate cDNA using 2 μg RNA, Moloney murine leukemia virus reverse transcriptase, ribonuclease inhibitor and a dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s instructions. .. According to the RIZ1 mRNA sequence published by the National Center for Biotechnology Information (NCBI), the 5,157 bp protein-coding region is located between base pairs 857 and 6,013.

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase. .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase.

SYBR Green Assay:

Article Title: Spatial transcriptomic survey of human embryonic cerebral cortex by single-cell RNA-seq analysis
Article Snippet: Then reverse transcription was carried out in a volume of 19 μl, containing 2.5 ng/μl oligod(T) primer (Takara, Cat# 3806), 0.5 mM dNTP mixture (Takara, Cat# R045B), 2 U/μl RNase inhibitor (Ambion, Cat# AM2684), 5 mM DTT, 1× first strand and 0.5 U/μl superscript III reverse transcriptase (Invitrogen, Cat# 18080-044). .. Then reverse transcription was carried out in a volume of 19 μl, containing 2.5 ng/μl oligod(T) primer (Takara, Cat# 3806), 0.5 mM dNTP mixture (Takara, Cat# R045B), 2 U/μl RNase inhibitor (Ambion, Cat# AM2684), 5 mM DTT, 1× first strand and 0.5 U/μl superscript III reverse transcriptase (Invitrogen, Cat# 18080-044).

Article Title: Expression of somatostatin and its receptor 1–5 in endometriotic tissues and cells
Article Snippet: Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H2 O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl. .. The mixture was stirred at 70°C for 5 min and then the 10 µl mixture, 4 µl 5X PrimeScript II Buffer, 0.5 µl RNase inhibitor, 1 µl PrimeScript II RTase and 4.5 µl RNase-free ddH2 O were mixed followed by a reaction at 45°C for 45 min and 95°C for 5 min. PCR was performed on a Mastercycler® RealPlex2 thermal cycler (Eppendorf, Hamburg, Germany) and data were analyzed by MxPro software (version 4.0; (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA).

Agarose Gel Electrophoresis:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase. .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase.

Article Title: Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1α Signaling Pathway
Article Snippet: Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL. .. Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL.

Electrophoresis:

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase. .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase.

Ethanol Precipitation:

Article Title: Notch1 deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation
Article Snippet: Isolated RNA was further cleaned by phenol-chloroform extraction, followed by ethanol precipitation. .. Total RNA (500 ng) and 300 pmol random primers were mixed and heated at 65 °C for 5 minutes, and reverse transcribed using RTase M-MLV buffer, dNTP mixture, and RTase M-MLV (2640A, Takara, Ohtsu, Japan) at 37 °C for 50 minutes.

Quantitation Assay:

Article Title: Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1α Signaling Pathway
Article Snippet: Paragraph title: 4.9. Long PCR for Quantitation of Mitochondrial DNA ... Briefly, the reaction mixtures included 0.4 ng of rat total DNA, 4 pmol of each oligonucleotide primer, 400 mmol/L of dNTP mixture, and 0.5 U of LA Taq enzyme (Takara Bio., Kusatsu, Japan) with a total volume of 10 mL.

Spectrophotometry:

Article Title: Diabetes Aggravates Post-ischaemic Renal Fibrosis through Persistent Activation of TGF-β1 and Shh Signalling
Article Snippet: Total RNA was extracted from kidney tissue by using the Nucleospin® RNA kit (Macherey-Nagel, Düren, W. Germany) according to the manufacturer’s instructions and was quantified using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc., San Jose, CA, USA). .. Complementary DNA was synthesized using random primers (Promega, Madison, WI, USA), DNTP mixture (TaKaRa Bio Inc., Otsu-shi, Shiga, Japan) and M-MLV reverse transcriptase (Mbiotech Inc., Hanam, Korea).

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: The extracted DNA was quantified using a NANODROP 2000 spectrophotometer (Thermo). .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase.

Article Title: Organic Peroxide-Sensing Repressor OhrR Regulates Organic Hydroperoxide Stress Resistance and Avermectin Production in Streptomyces avermitilis
Article Snippet: The concentrations of RNA were measured by NanoVue Plus spectrophotometer (GE Healthcare). .. Each RNA sample (2 μg) was reverse transcribed by random hexamers (25 μM), dNTP mixture (10 mM) and M-MLV (TaKaRa, Japan). qRT-PCR was performed to determine the transcription levels of various genes using primers listed in Supplementary Table .

Sampling:

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: To explore the degree of isolate pool overlap among locations given the proximity of the sampling sites, Escherichia coli were genotyped by repetitive element palindromic PCR, which detects the distribution of repetitive DNA sequences as genomic fingerprints ( ; ). .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

Concentration Assay:

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: Reactions were performed on a TGradient thermocycler (Biometra, Göttingen, Germany). .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

CTG Assay:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd., Shanghai, China, and were as follows: Brain-derived neurotrophic factor: forward primer 5’-GCC CAT ATG ACC ATC CTT TTC CTT A-3’, reverse primer 5’-CTA TCT TCC CCT TTT AAT GGT CAG -3’, the length was 25 bp; GAPDH: forward primer 5’-ACC ACA GTC CAT GCC ATC AC-3’, reverse primer 5’-TCC ACC ACC CTG TTG CTG TA- 3’, the length was 20 bp. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Staining:

Article Title: Brain-derived neurotrophic factor expression in dorsal root ganglion neurons in response to reanastomosis of the distal stoma after nerve grafting
Article Snippet: The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL. .. The PCR reactions contained 2.0 μL dNTP mixture (Takara, Tokyo, Japan), 2.0 μL forward primer, 1.0 μL dNTP (10 mM), 5.0 μL buffer, 2.0 U Taq DNA polymerase (Toyobo, Osaka, Japan) 1.0 μL of cDNA added to ddH2O to make a final volume of 50 μL.

Article Title: Arabidopsis ACC Oxidase 1 Coordinated by Multiple Signals Mediates Ethylene Biosynthesis and Is Involved in Root Development
Article Snippet: PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction. .. PCR was performed in a reaction containing 1 μl cDNA, 0.25 μl Real Taq (RBC, Taiwan), 2.5 μl 2.5 mM dNTP mixture, 2.5 μl 10× buffer (Takara, Japan), and 1 μl of each primer (10 pmol) in a 25 μl reaction.

Article Title: DNA Backbone Sulfur-Modification Expands Microbial Growth Range under Multiple Stresses by its anti-oxidation function
Article Snippet: The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase. .. The 25 μl PCR mixture contained 0.01 ng to 0.08 ng of genomic DNA as the template, 2 μM of the two primers, 200 μM dNTP mixture (Takara), 10 × PCR buffer, and 0.5 μl of the polymerase.

Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
Article Snippet: The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 76
    TaKaRa dntp mix
    Dntp Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 76/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mix/product/TaKaRa
    Average 76 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2019-12
    76/100 stars
      Buy from Supplier

    79
    TaKaRa pcr mixture ii
    Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified <t>cDNA</t> molecules in single cells was measured after the 2nd <t>PCR.</t> ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).
    Pcr Mixture Ii, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mixture ii/product/TaKaRa
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr mixture ii - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    78
    TaKaRa pcr mixture iii
    Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and <t>PCR.</t> ( d ) Amplification efficiency was strongly affected by the presence of SuperScript <t>III.</t> The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.
    Pcr Mixture Iii, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mixture iii/product/TaKaRa
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr mixture iii - by Bioz Stars, 2019-12
    78/100 stars
      Buy from Supplier

    Image Search Results


    Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified cDNA molecules in single cells was measured after the 2nd PCR. ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified cDNA molecules in single cells was measured after the 2nd PCR. ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Single-cell Analysis, Expressing, Amplification, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Reduction of primer-dimer production by introducing VN sequence to UP2 primers. Although the production of primer-dimers by PCR is a big issue in terms of whole-cDNA amplification, it is greatly reduced by the use of UP2 primers with poly(T) plus VN sequences at 3′ termini. Electrophoregrams of PCR products obtained with two different primers (denoted as 1 and 2 in the figures) for the 2nd-strand synthesis are shown in figures ( a1–c2 ). In the figures, ‘a’, ‘b’ and ‘c’ stand for crude 1st PCR products, purified 1st PCR products and 2nd PCR products, respectively. The primers used in the cases of Figures a1, b1 and c1 were UP2 primer having poly(T) sequence at 3′ termini. The primers used in the cases of Figures a2, b2 and c2 were anchored UP2 primers having poly(T) plus VN sequences at the 3′ termini. ( d ) The number of amplified cDNA molecules (EEF1G gene) after the 1st PCR, as well as the 2nd PCR, obtained with the two kinds of primers for 2nd-strand synthesis.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Reduction of primer-dimer production by introducing VN sequence to UP2 primers. Although the production of primer-dimers by PCR is a big issue in terms of whole-cDNA amplification, it is greatly reduced by the use of UP2 primers with poly(T) plus VN sequences at 3′ termini. Electrophoregrams of PCR products obtained with two different primers (denoted as 1 and 2 in the figures) for the 2nd-strand synthesis are shown in figures ( a1–c2 ). In the figures, ‘a’, ‘b’ and ‘c’ stand for crude 1st PCR products, purified 1st PCR products and 2nd PCR products, respectively. The primers used in the cases of Figures a1, b1 and c1 were UP2 primer having poly(T) sequence at 3′ termini. The primers used in the cases of Figures a2, b2 and c2 were anchored UP2 primers having poly(T) plus VN sequences at the 3′ termini. ( d ) The number of amplified cDNA molecules (EEF1G gene) after the 1st PCR, as well as the 2nd PCR, obtained with the two kinds of primers for 2nd-strand synthesis.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification, Purification

    Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Purification, Polymerase Chain Reaction, Produced

    Change of products produced with 10 7 beads immobilizing RT primers with various densities. Starting material in all cases was 2 pg of mRNA. The error bars are independent amplification replicates. ( a ) Number of amplified cDNA molecules (EEF1G gene) in cDNA libraries after 2nd PCR. ( b ) Number of cDNA molecules (EEF1G gene) produced on beads in RT. ( c ) Electrophoregrams of crude 1st PCR products. ( d ) Electrophoregrams after purifying the crude 1st PCR products showed in the electrophoregrams of graph ‘c’.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Change of products produced with 10 7 beads immobilizing RT primers with various densities. Starting material in all cases was 2 pg of mRNA. The error bars are independent amplification replicates. ( a ) Number of amplified cDNA molecules (EEF1G gene) in cDNA libraries after 2nd PCR. ( b ) Number of cDNA molecules (EEF1G gene) produced on beads in RT. ( c ) Electrophoregrams of crude 1st PCR products. ( d ) Electrophoregrams after purifying the crude 1st PCR products showed in the electrophoregrams of graph ‘c’.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Produced, Amplification, Polymerase Chain Reaction

    Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Article Snippet: Another 15 cycles of PCR was then performed on the four fractions, each containing 1 μl of the 50 -μl purified PCR products together with 49 μl of PCR mixture III (5-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 1-μM AUP1, 1-μM AUP2 and 2.5-U TaKaRa ExTaqTM HS).

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Purification, Polymerase Chain Reaction, Produced