Structured Review

Thermo Fisher dntp mix
Dntp Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp mix/product/Thermo Fisher
Average 99 stars, based on 74 article reviews
Price from $9.99 to $1999.99
dntp mix - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA. .. For the EGFPp42 and EGFPp46 fusion plasmids, PCR products were amplified from the p42wt or the p46 wt encoding plasmids using the following primers: Forward primer (for both constructs): 5′-TTAAGTCTCGAGGAAACTTGGGTGGTGGA-3′ Reverse primer (pEGFPp42): 5′-AGCTTACTGCAGTCAAGCTTCATGGAGAGG-3′ Reverse primer (pEGFPp46): 5′- GACTAACTGCAGTCAGAGGATGGTGCAG-3′ The PCR products were cloned into the pEGFP-C2 vector (ClonTech, Takara Bio Europe SAS, Saint-Germain-en-Laye, France) using Xho1 and Pst1 restriction sites, and colonies were selected on 50 μg/mL kanamycin agar plates.

Amplification:

Article Title: A new variant of Croton yellow vein mosaic virus naturally infecting wild sunflower in India
Article Snippet: The primer pair AV494 and AC1048 [ ] was used to amplify the partial coat protein gene AV1 and 550 bp amplification was expected (14). .. Each reaction contained 1 µl DNA, 1 unit Taq DNA Polymerase (Invitrogen), 0.3 µl dNTP mix, 0.3 µl of each primer (10 mM), 2.5 µl 10× Taq Buffer (Invitrogen) and sterile water to make up total volume of 25 µl.

Article Title: Microsatellite Marker Discovery in the Stingless Bee Uruçu-Amarela (Melipona rufiventris Group, Hymenoptera, Meliponini) for Population Genetic Analysis
Article Snippet: Paragraph title: 2.4. PCR Amplification and Validation of Selected SSRs ... Reactions were performed in a 10-µL total volume containing at least 20 ng of genomic DNA, with 1.0 × buffer, 2 to 3 mM MgCl2 , 1.0 mM dNTP mix, 0.25 mM of each primer and 0.75 units of Taq DNA polymerase (Thermo Scientific Inc, Waltham, MA, USA).

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA. .. For the EGFPp42 and EGFPp46 fusion plasmids, PCR products were amplified from the p42wt or the p46 wt encoding plasmids using the following primers: Forward primer (for both constructs): 5′-TTAAGTCTCGAGGAAACTTGGGTGGTGGA-3′ Reverse primer (pEGFPp42): 5′-AGCTTACTGCAGTCAAGCTTCATGGAGAGG-3′ Reverse primer (pEGFPp46): 5′- GACTAACTGCAGTCAGAGGATGGTGCAG-3′ The PCR products were cloned into the pEGFP-C2 vector (ClonTech, Takara Bio Europe SAS, Saint-Germain-en-Laye, France) using Xho1 and Pst1 restriction sites, and colonies were selected on 50 μg/mL kanamycin agar plates.

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: .. Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase. .. The temperature cycling conditions were initial melting at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final extension at 72°C for 4 min. PCR products were visualized by 1% agarose gel electrophoresis.

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: .. Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

Article Title: Association Study between BGLAP Gene HindIII Polymorphism and Type 2 Diabetes Mellitus Development in Ukrainian Population
Article Snippet: .. The reaction mixture on the amplification stage consisted of 5 μ L FastDigest Green Buffer (10X) (Thermo Scientific™, USA), 0.5 μ L dNTP Mix (10 mM of each deoxynucleotide) (Thermo Scientific™, USA), 0.75 U DreamTaq DNA Polymerase (5 U/μ L) (Thermo Scientific™, USA), 0.1 μ L each primer, 75-100 ng DNA, and bidistilled water to 25 μ L. The primer sequences and PCR conditions are indicated in . .. Amplification was performed by Thermocycler GeneAmp PCR System 2700 (Thermo Fisher Scientific, USA).

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: These primers are adapted from widely-used universal primers for the amplification of marine prokaryotic [ , ] and eukaryotic [ ] taxa, modified to improve coverage of SAR11 and haptophytes [ , ]. .. Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water.

Synthesized:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany). .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: .. One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. According to the previously characterized comparative CT method , the threshold cycle (CT ) value was defined as the PCR cycle at which the relative fluorescent unit (RFU) crossed a threshold line (100 RFU).

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: .. For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany). ..

Construct:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA. .. For the EGFPp42 and EGFPp46 fusion plasmids, PCR products were amplified from the p42wt or the p46 wt encoding plasmids using the following primers: Forward primer (for both constructs): 5′-TTAAGTCTCGAGGAAACTTGGGTGGTGGA-3′ Reverse primer (pEGFPp42): 5′-AGCTTACTGCAGTCAAGCTTCATGGAGAGG-3′ Reverse primer (pEGFPp46): 5′- GACTAACTGCAGTCAGAGGATGGTGCAG-3′ The PCR products were cloned into the pEGFP-C2 vector (ClonTech, Takara Bio Europe SAS, Saint-Germain-en-Laye, France) using Xho1 and Pst1 restriction sites, and colonies were selected on 50 μg/mL kanamycin agar plates.

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Libraries were constructed and amplified using the TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme Biotech).

Real-time Polymerase Chain Reaction:

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: .. One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. According to the previously characterized comparative CT method , the threshold cycle (CT ) value was defined as the PCR cycle at which the relative fluorescent unit (RFU) crossed a threshold line (100 RFU).

Incubation:

Article Title: In Vivo RNAi-Mediated eIF3m Knockdown Affects Ribosome Biogenesis and Transcription but Has Limited Impact on mRNA-Specific Translation
Article Snippet: .. After ligation, reaction was precipitated with ethanol, and a reverse transcription was set up: 11.5 μL ligation product resuspended in water, 1 μL reverse transcription primer, 1 μL dNTP mix (10 mM), with incubation at 65°C, placement on ice, and the addition of 4 μL 5× buffer, 2 μL DTT, 0.5 μL Superase-In, and 0.5 μL SuperScript III (Life Technologies). .. To get rid of RNA, we added 0.8 μL of 2 M NaOH for hydrolysis and incubated for 30 min at 98°C.

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA. .. One microliter of Dpn1 restriction endonuclease was added to the PCR products and incubated at 37 °C for 2 h. Positive colonies were selected on 100 μg/mL ampicillin agar plates.

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: .. Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase. .. The temperature cycling conditions were initial melting at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final extension at 72°C for 4 min. PCR products were visualized by 1% agarose gel electrophoresis.

Article Title: Association Study between BGLAP Gene HindIII Polymorphism and Type 2 Diabetes Mellitus Development in Ukrainian Population
Article Snippet: The reaction mixture on the amplification stage consisted of 5 μ L FastDigest Green Buffer (10X) (Thermo Scientific™, USA), 0.5 μ L dNTP Mix (10 mM of each deoxynucleotide) (Thermo Scientific™, USA), 0.75 U DreamTaq DNA Polymerase (5 U/μ L) (Thermo Scientific™, USA), 0.1 μ L each primer, 75-100 ng DNA, and bidistilled water to 25 μ L. The primer sequences and PCR conditions are indicated in . .. On the restriction stage, 2 U of Hind III (Thermo Scientific™, USA), 0.8 μ L of 10X Buffer R (10 mM Tris-HCl (pH 8.5), 10 mM MgCl2 , 100 mM KCl, 0.1 mg/mL BSA) (Thermo Scientific™, USA), and bidistilled water to 2 μ L were added to 6 μ L of each sample and then incubated at 37°C for 20 hours.

Expressing:

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. The mRNA expression level of each gene was quantified based on the average CT value from three replicates and was normalized to β-actin (ACTB) using the formula 2−(C T target gene – C T ACTB) (2−ΔC T ).

Modification:

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: These primers are adapted from widely-used universal primers for the amplification of marine prokaryotic [ , ] and eukaryotic [ ] taxa, modified to improve coverage of SAR11 and haptophytes [ , ]. .. Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water.

Ligation:

Article Title: In Vivo RNAi-Mediated eIF3m Knockdown Affects Ribosome Biogenesis and Transcription but Has Limited Impact on mRNA-Specific Translation
Article Snippet: .. After ligation, reaction was precipitated with ethanol, and a reverse transcription was set up: 11.5 μL ligation product resuspended in water, 1 μL reverse transcription primer, 1 μL dNTP mix (10 mM), with incubation at 65°C, placement on ice, and the addition of 4 μL 5× buffer, 2 μL DTT, 0.5 μL Superase-In, and 0.5 μL SuperScript III (Life Technologies). .. To get rid of RNA, we added 0.8 μL of 2 M NaOH for hydrolysis and incubated for 30 min at 98°C.

Polymerase Chain Reaction:

Article Title: Genome-wide mapping of nucleotide excision repair with XR-seq
Article Snippet: Human DNA polymerase k (Enzymax, cat. no. 27) CRITICAL Enzymes from other suppliers may not be as efficient. dNTP mix (2.5 mM; Thermo Fisher, cat. no. ) Terminal transferase (NEB, cat. no. M0315L) [α−32 P]-3′ dATP (Cordycepin; PerkinElmer, cat. no. NEG026250UC) CAUTION This is a radioactive product. .. Terminal transferase (TdT) (NEB, cat. no. M0315S) Kapa HiFi PCR HotStart ReadyMix, (Kapa Biosystems, cat. no. KK 2602) Gel-loading dye (purple, with SDS; NEB, cat. no. B7024S) Gel-loading dye (purple, no SDS; NEB, cat. no. B7025S) Acrylamide (Thermo Fisher, cat. no. 15512–023) CAUTION Acrylamide is an irritant and is toxic and carcinogenic.

Article Title: A new variant of Croton yellow vein mosaic virus naturally infecting wild sunflower in India
Article Snippet: Paragraph title: PCR and RCA ... Each reaction contained 1 µl DNA, 1 unit Taq DNA Polymerase (Invitrogen), 0.3 µl dNTP mix, 0.3 µl of each primer (10 mM), 2.5 µl 10× Taq Buffer (Invitrogen) and sterile water to make up total volume of 25 µl.

Article Title: Microsatellite Marker Discovery in the Stingless Bee Uruçu-Amarela (Melipona rufiventris Group, Hymenoptera, Meliponini) for Population Genetic Analysis
Article Snippet: Paragraph title: 2.4. PCR Amplification and Validation of Selected SSRs ... Reactions were performed in a 10-µL total volume containing at least 20 ng of genomic DNA, with 1.0 × buffer, 2 to 3 mM MgCl2 , 1.0 mM dNTP mix, 0.25 mM of each primer and 0.75 units of Taq DNA polymerase (Thermo Scientific Inc, Waltham, MA, USA).

Article Title: Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris
Article Snippet: .. Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma, 93443–100ML), 3.125 mM dNTP mix (Thermo Fisher, R0193), 3.125 μM Oligo-dT30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). .. 96-well lysis plates were also prepared with 4 μl lysis buffer.

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: Forward primer (p46ΔCaaX): 5′ - CAG AAG AGG ACT GGA CCT GAA TGC CAG TGC ATC - 3′ Reverse primer (p46ΔCaaX): 5′ - GAT GCA CTG GCA TTC AGG TCC AGT CCT CTT CTG - 3′ Forward primer (p42CaaX): 5′-AA GCT TGC ACC ATC CTC TGA GAC ATA TAG CTG GAG ACC ATT CTT-3′ Reverse primer (p42CaaX): 5′-GAG GAT GGT GCA AGC TTC ATG GAG AGG GGC AGG GAT GAA TG-3′ PCR amplifications were performed using the above primers. .. The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA.

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: .. Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase. .. The temperature cycling conditions were initial melting at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final extension at 72°C for 4 min. PCR products were visualized by 1% agarose gel electrophoresis.

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

Article Title: Association Study between BGLAP Gene HindIII Polymorphism and Type 2 Diabetes Mellitus Development in Ukrainian Population
Article Snippet: .. The reaction mixture on the amplification stage consisted of 5 μ L FastDigest Green Buffer (10X) (Thermo Scientific™, USA), 0.5 μ L dNTP Mix (10 mM of each deoxynucleotide) (Thermo Scientific™, USA), 0.75 U DreamTaq DNA Polymerase (5 U/μ L) (Thermo Scientific™, USA), 0.1 μ L each primer, 75-100 ng DNA, and bidistilled water to 25 μ L. The primer sequences and PCR conditions are indicated in . .. Amplification was performed by Thermocycler GeneAmp PCR System 2700 (Thermo Fisher Scientific, USA).

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: .. Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water. .. 18S PCR reaction mixtures were identical except polymerase amounts were doubled (0.2 μl per reaction) to address weak amplification, with a compensating water volume decrease to 19.3 μl.

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. According to the previously characterized comparative CT method , the threshold cycle (CT ) value was defined as the PCR cycle at which the relative fluorescent unit (RFU) crossed a threshold line (100 RFU).

Article Title: Staurosporine-Induced Apoptosis of Cultured Rat Hippocampal Neurons Involves Caspase-1-Like Proteases as Upstream Initiators and Increased Production of Superoxide as a Main Downstream Effector
Article Snippet: .. RT was performed in 45 μl of RT-mix consisting of 100 U MMLV-RT (Life Technologies), 2.2 m m MgCl2 (Amersham, Braunschweig, Germany), dNTP mix (dATP, dCTP, dGTP, dTTP, 0.2 m m each; Life Technologies), 4 m m DTT (Life Technologies), 20 U RNase-inhibitor (Promega), 50 μ m oligo-(T)-primer (MWG Biotech, Ebersberg, Germany), 1 × PCR buffer (Amersham), and RNase-free water. ..

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany). .. PCR reaction was carried out in a total volume of 27 µl containing PCR master mix (13 µl), FWD and REV specific primers (each 1 µl), and cDNA as a template (1.5 µl) and nuclease free water (10.5 µl).

Sequencing:

Article Title: In Vivo RNAi-Mediated eIF3m Knockdown Affects Ribosome Biogenesis and Transcription but Has Limited Impact on mRNA-Specific Translation
Article Snippet: The sequencing library was prepared similarly to the protocol described in the ARTseq Kit (Epicenter), with some changes. .. After ligation, reaction was precipitated with ethanol, and a reverse transcription was set up: 11.5 μL ligation product resuspended in water, 1 μL reverse transcription primer, 1 μL dNTP mix (10 mM), with incubation at 65°C, placement on ice, and the addition of 4 μL 5× buffer, 2 μL DTT, 0.5 μL Superase-In, and 0.5 μL SuperScript III (Life Technologies).

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: .. Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: Paragraph title: DNA extraction for 16S and 18S rDNA sequencing ... Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water.

Recombinant:

Article Title: Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris
Article Snippet: .. Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma, 93443–100ML), 3.125 mM dNTP mix (Thermo Fisher, R0193), 3.125 μM Oligo-dT30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). .. 96-well lysis plates were also prepared with 4 μl lysis buffer.

Transmission Electron Microscopy:

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: .. Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

DNA Extraction:

Article Title: Association Study between BGLAP Gene HindIII Polymorphism and Type 2 Diabetes Mellitus Development in Ukrainian Population
Article Snippet: Genotyping Whole venous blood was used for DNA extraction by NeoPrep100 DNA_Blood kit (Neogene, Ukraine). .. The reaction mixture on the amplification stage consisted of 5 μ L FastDigest Green Buffer (10X) (Thermo Scientific™, USA), 0.5 μ L dNTP Mix (10 mM of each deoxynucleotide) (Thermo Scientific™, USA), 0.75 U DreamTaq DNA Polymerase (5 U/μ L) (Thermo Scientific™, USA), 0.1 μ L each primer, 75-100 ng DNA, and bidistilled water to 25 μ L. The primer sequences and PCR conditions are indicated in .

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: Paragraph title: DNA extraction for 16S and 18S rDNA sequencing ... Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water.

Mutagenesis:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: Plasmids The CaaX (CTIL) motif was deleted in the p46 encoding plasmid and added to the p42 encoding plasmid by Quick Change Site-Directed Mutagenesis (Stratagene, La Jolla, California, USA). .. The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA.

Isolation:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: Paragraph title: RNA isolation and cDNA synthesis ... For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: Total RNA was extracted from 20-30 mg of isolated brain tissue from 3-month-old C57Bl/6 animals by using RNeasy Mini Kit (Qiagen, Chats-worth, CA) according to the protocol provided by the manufacturer. .. Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase.

Article Title: Staurosporine-Induced Apoptosis of Cultured Rat Hippocampal Neurons Involves Caspase-1-Like Proteases as Upstream Initiators and Increased Production of Superoxide as a Main Downstream Effector
Article Snippet: Total cellular RNA isolated from secondary cultures of rat cortical astrocytes, from rat brain (striatum and septum), and from mouse brain (neocortex) served as controls. .. RT was performed in 45 μl of RT-mix consisting of 100 U MMLV-RT (Life Technologies), 2.2 m m MgCl2 (Amersham, Braunschweig, Germany), dNTP mix (dATP, dCTP, dGTP, dTTP, 0.2 m m each; Life Technologies), 4 m m DTT (Life Technologies), 20 U RNase-inhibitor (Promega), 50 μ m oligo-(T)-primer (MWG Biotech, Ebersberg, Germany), 1 × PCR buffer (Amersham), and RNase-free water.

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and reverse transcription-polymerase chain reaction ... For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany).

Size-exclusion Chromatography:

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase. .. The temperature cycling conditions were initial melting at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final extension at 72°C for 4 min. PCR products were visualized by 1% agarose gel electrophoresis.

Purification:

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. The amplified cDNA products were purified with Agencourt XP DNA beads (Beckman), and the concentration of each sample was quantified by Qubit HsDNA kits (Invitrogen).

Article Title: Linking patterns of net community production and marine microbial community structure in the western North Atlantic
Article Snippet: Each 16S PCR reaction (25 μl volume) consisted of 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mix (10 μM each), 1 μl 50 mM MgSO4 , 0.5 μl each of forward and reverse primer (10 μM), 0.1 μl Platinum Taq Hi-Fidelity Polymerase (Thermo Fisher, Waltham, MA, USA), and 19.4 μl of sterile water. .. PCR products were purified using the Qiagen QIAquick PCR Purification Kit and quantified using a Qubit 3.0 fluorometer (Life Technologies, Carlsbad, CA, USA).

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: .. One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. According to the previously characterized comparative CT method , the threshold cycle (CT ) value was defined as the PCR cycle at which the relative fluorescent unit (RFU) crossed a threshold line (100 RFU).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany). .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: .. For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany). ..

Quantitative RT-PCR:

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: Detailed procedures for tissue collection, and reverse transcription and quantitative real-time polymerase chain reaction (RT-qPCR) were previously described . .. One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA).

FACS:

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: .. Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

Activated Clotting Time Assay:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: Forward primer (p46ΔCaaX): 5′ - CAG AAG AGG ACT GGA CCT GAA TGC CAG TGC ATC - 3′ Reverse primer (p46ΔCaaX): 5′ - GAT GCA CTG GCA TTC AGG TCC AGT CCT CTT CTG - 3′ Forward primer (p42CaaX): 5′-AA GCT TGC ACC ATC CTC TGA GAC ATA TAG CTG GAG ACC ATT CTT-3′ Reverse primer (p42CaaX): 5′-GAG GAT GGT GCA AGC TTC ATG GAG AGG GGC AGG GAT GAA TG-3′ PCR amplifications were performed using the above primers. .. The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA.

Plasmid Preparation:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: Plasmids The CaaX (CTIL) motif was deleted in the p46 encoding plasmid and added to the p42 encoding plasmid by Quick Change Site-Directed Mutagenesis (Stratagene, La Jolla, California, USA). .. The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA.

SYBR Green Assay:

Article Title: Differential mRNA expression of neuroinflammatory modulators in the spinal cord and thalamus of type 2 diabetic monkeys
Article Snippet: .. One microgram of purified total RNA was converted to cDNA by reverse transcription using Random primers (Promega, Madison, WI), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Promega). qPCR was performed by using the synthesized cDNA, gene-specific primers ( , Sigma-Aldrich, St. Louis, MO), and iTaq™ Universal SYBR® Green Supermix with iCycler and iQ Real-Time PCR systems (Bio-Rad, Hercules, CA). .. According to the previously characterized comparative CT method , the threshold cycle (CT ) value was defined as the PCR cycle at which the relative fluorescent unit (RFU) crossed a threshold line (100 RFU).

RNA Extraction:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: For this purpose, Sina-Clon RNA extraction kit (CinnaGen, Tehran, Iran) was used. .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: RNA isolation, cDNA synthesis and reverse transcription-polymerase chain reaction Previously collected and stored (-70°C) ovaries were used for total RNA extraction, based on the standard TRIZOL method ( ). .. For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany).

Agarose Gel Electrophoresis:

Article Title: A new variant of Croton yellow vein mosaic virus naturally infecting wild sunflower in India
Article Snippet: Each reaction contained 1 µl DNA, 1 unit Taq DNA Polymerase (Invitrogen), 0.3 µl dNTP mix, 0.3 µl of each primer (10 mM), 2.5 µl 10× Taq Buffer (Invitrogen) and sterile water to make up total volume of 25 µl. .. PCR amplicons were screened by using agarose gel electrophoresis and was stained using EtBr.

Article Title: Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Article Snippet: Total RNA (4 μg) was reverse transcribed in a 20 μl reaction volume containing 500 μg/ml oligo-dT and (in m m ) 50 Tris-HCl, pH 8.3, 75 KCl, 3 MgCl2 plus 0.01 m DTT, 500 μ m dNTP mix, and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego, CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 μl of first-strand cDNA was added to 25 μl of reaction volume containing (in m m ) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2 , 2 dNTP mix plus 0.1 μ m forward and reverse primers and 1 U of Taq DNA polymerase. .. The temperature cycling conditions were initial melting at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final extension at 72°C for 4 min. PCR products were visualized by 1% agarose gel electrophoresis.

Spectrophotometry:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: Moreover, the total RNA concentration (ng/μl) was evaluated using NanoDrop-1000 spectrophotometer and compared between groups (Molavi et al. ). .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Preliminary Findings of Platelet-Rich Plasma-Induced Ameliorative Effect on Polycystic Ovarian Syndrome
Article Snippet: The amount of total RNA was determined using nanodrop spectrophotometer (260 nm and A260/280 ratio=1.8-2.0), and thereafter the samples were stored at -70°C. .. For reverse transcription-polymerase chain reaction (RTPCR), cDNA was synthesized in a 20 µl reaction mixture containing 1 µg total RNA, oligo (dT) primer (1 µl), 5×reaction buffer (4 µl), RNase inhibitor (1 µl), 10 mM dNTP mix (2 µl), M-MuLV Reverse Transcriptase (1 µl) according to the manufacturer’s protocol (Fermentas, Germany).

Concentration Assay:

Article Title: Testicular torsion and reperfusion: evidences for biochemical and molecular alterations
Article Snippet: Moreover, the total RNA concentration (ng/μl) was evaluated using NanoDrop-1000 spectrophotometer and compared between groups (Molavi et al. ). .. For reverse transcription polymerase chain reaction (RT-PCR), the cDNA was synthesized in a 20-μl reaction mixture containing 1 μg RNA, 1 μl oligo (dT) primer, 4 μl 5 × reaction buffer, 1 μl RNAse inhibitor, 10 mM dNTP mix (2 μl), and M-MuLV Reverse Transcriptase (1 μl) according to the manufacturer’s protocol (Fermentas, GmbH, Germany).

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. The amplified cDNA products were purified with Agencourt XP DNA beads (Beckman), and the concentration of each sample was quantified by Qubit HsDNA kits (Invitrogen).

Article Title: Staurosporine-Induced Apoptosis of Cultured Rat Hippocampal Neurons Involves Caspase-1-Like Proteases as Upstream Initiators and Increased Production of Superoxide as a Main Downstream Effector
Article Snippet: RNA concentration was determined UV-photometrically by absorbance at 260 nm, and purity of the samples was confirmed by A 260 / A 280 ratios between 1.7 and 2.0. .. RT was performed in 45 μl of RT-mix consisting of 100 U MMLV-RT (Life Technologies), 2.2 m m MgCl2 (Amersham, Braunschweig, Germany), dNTP mix (dATP, dCTP, dGTP, dTTP, 0.2 m m each; Life Technologies), 4 m m DTT (Life Technologies), 20 U RNase-inhibitor (Promega), 50 μ m oligo-(T)-primer (MWG Biotech, Ebersberg, Germany), 1 × PCR buffer (Amersham), and RNase-free water.

Lysis:

Article Title: Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris
Article Snippet: .. Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma, 93443–100ML), 3.125 mM dNTP mix (Thermo Fisher, R0193), 3.125 μM Oligo-dT30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). .. 96-well lysis plates were also prepared with 4 μl lysis buffer.

Article Title: Distinct epigenetic features of tumor-reactive CD8+ T cells in colorectal cancer patients revealed by genome-wide DNA methylation analysis
Article Snippet: .. Cell sorting, reverse transcription, amplification, and sequencing One thousand cells of different subtypes including naïve and TEM CD8+ T cells from PBMC, tumor-reactive CD8+ T cells, and two clusters of tumor bystander CD8+ T cells were enriched by gating 7AAD−CD3+CD8+CD45RO−CD45RA+CCR7+, 7AAD−CD3+CD8+CD45RO+CD45RA−CCR7−, 7AAD−CD3+CD8+CD103+CD39+, 7AAD−CD3+CD8+CD103+CD39−, and 7AAD−CD3+CD8+CD103−CD39−, respectively, and sorted into 0.2 mL tubes (Axygen) chilled to 4 °C, prepared with lysis buffer with 1 μL 10 mM dNTP mix (Invitrogen), 1 μL 10 μM Oligo dT primer, 1.9 μL 1% Triton X-100 (Sigma), and 0.1 μL 40 U μL−1 RNase Inhibitor (Takara). .. Transcriptome amplifications were performed according to Smart-Seq2 protocol [ ] with modification of reagent amount and PCR cycle numbers.

CTG Assay:

Article Title: The Cellular Localization of the p42 and p46 Oligoadenylate Synthetase 1 Isoforms and Their Impact on Mitochondrial Respiration
Article Snippet: Forward primer (p46ΔCaaX): 5′ - CAG AAG AGG ACT GGA CCT GAA TGC CAG TGC ATC - 3′ Reverse primer (p46ΔCaaX): 5′ - GAT GCA CTG GCA TTC AGG TCC AGT CCT CTT CTG - 3′ Forward primer (p42CaaX): 5′-AA GCT TGC ACC ATC CTC TGA GAC ATA TAG CTG GAG ACC ATT CTT-3′ Reverse primer (p42CaaX): 5′-GAG GAT GGT GCA AGC TTC ATG GAG AGG GGC AGG GAT GAA TG-3′ PCR amplifications were performed using the above primers. .. The reactions were in a total volume of 30 uL in 1 × Pfu reaction buffer with 3 mM MgSO4 , 250 μM dNTP mix, 1 μL Pfu DNA polymerase (Invitrogen, ThermoFisher Scientific, Roskilde, Denmark), 125 ng of each primer and 40 ng of template DNA.

Staining:

Article Title: A new variant of Croton yellow vein mosaic virus naturally infecting wild sunflower in India
Article Snippet: Each reaction contained 1 µl DNA, 1 unit Taq DNA Polymerase (Invitrogen), 0.3 µl dNTP mix, 0.3 µl of each primer (10 mM), 2.5 µl 10× Taq Buffer (Invitrogen) and sterile water to make up total volume of 25 µl. .. PCR amplicons were screened by using agarose gel electrophoresis and was stained using EtBr.

Hood:

Article Title: Genome-wide mapping of nucleotide excision repair with XR-seq
Article Snippet: Handle it in a fume hood with extreme care and wear protective clothing, gloves and safety goggles. .. Human DNA polymerase k (Enzymax, cat. no. 27) CRITICAL Enzymes from other suppliers may not be as efficient. dNTP mix (2.5 mM; Thermo Fisher, cat. no. ) Terminal transferase (NEB, cat. no. M0315L) [α−32 P]-3′ dATP (Cordycepin; PerkinElmer, cat. no. NEG026250UC) CAUTION This is a radioactive product.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher dntp mix
    Dntp Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mix/product/Thermo Fisher
    Average 90 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results