dntp mix  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    dNTP Mix
    Description:
    200 μl premixed dNTP solution 10 mM each dATP dCTP dGTP dTTP education use only
    Catalog Number:
    1708874EDU
    Price:
    None
    Category:
    PCR Instrumentation
    Buy from Supplier


    Structured Review

    Bio-Rad dntp mix
    dNTP Mix
    200 μl premixed dNTP solution 10 mM each dATP dCTP dGTP dTTP education use only
    https://www.bioz.com/result/dntp mix/product/Bio-Rad
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: Generation of human FBP1 promoter-luciferase reporter constructs and site-directed mutagenesis The 886 nucleotides upstream of transcription start site together with the first 20 nucleotides downstream of transcription site of human FBP1 gene (-886/+20) were cloned from genomic DNA by a PCR technique using the hFBP1 forward and reverse primers (sequences shown in ) designed from human FBP1 gene sequence deposited at NCBI (accession no. NT_008470). .. The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: In order to avoid the presence of clones, the isolates were firstly analyzed by rep-PCR using oligonucleotide GTG5 (5′-GTG GTG GTG GTG GTG-3′) primer (Invitrogen, Life Technologies, Milan, Italy). .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl.

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Paragraph title: Cloning and expression ... Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C.

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: In order to avoid the presence of clones, the isolates were firstly analyzed by rep-PCR using oligonucleotide GTG5 (5′-GTG GTG GTG GTG GTG-3′) primer (Invitrogen, Life Technologies, Milan, Italy). .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl.

    Amplification:

    Article Title: Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell
    Article Snippet: Each reaction was set up with 2.5 μL of 10X iTaq buffer, 1.5 mM MgCl2 , 0.625U iTaq DNA polymerase (170-8870, Bio-Rad), 0.5 μL of 10 mM dNTP mix (170-8874, Bio-Rad), 1 μL each of telomere forward and reverse primers (10 μM), and 1 μL each of Alu forward and reverse primers (10 μM). .. Relative telomere length (T/R ratio) was calculated by comparing the values of telomere (T) and reference gene Alu (R) in individual cells by the 2-ΔΔCt method when the standard curves of telomere and Alu showed similar high amplification efficiency.

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: .. Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C. .. Fresh PCR products were cloned into pET102/D-TOPO® vector from Champion™ pET Directional TOPO® Expression Kit expressed in E. coli BL21 Star™ (DE3).

    Article Title: Catalase overexpression modulates metabolic parameters in a new ‘stress-less’ leptin-deficient mouse model
    Article Snippet: .. For genotyping, 0.25 μg (1 μL) of each DNA sample was added to a reaction mix of 18.125 μL RNase free H2 O, 2.5 μL of 10X i Taq Buffer, 0.75 μL of MgCl2 50 mM, 0.5 μL dNTP mix 10 mM, 1 μL forward primer, 1 μL reverse primer, 0.125 μL i Taq DNA polymerase to prepare for amplification of DNA in the BioRad MyiQ (BioRad, Hercules, CA). .. PCR protocol was conducted as described in previous publications [ , ].

    Article Title: Identification of torque teno virus in culture-negative endophthalmitis by representational deep-DNA sequencing
    Article Snippet: The master mix containing 10x Buffer, Taq polymerase, dNTP mix and the primers was treated with 8-methoxypsoralen (25μg/mL) and UV nicked for 5 min (Bio-Rad GS gene linker, UV chamber) to bind any contaminating DNA. .. PCR amplification was performed in a MasterCycler gradient (Eppendorf, Hamburg, Germany).

    Article Title: Association of Cholesteryl Ester Transfer Protein (CETP) Gene -629C/A Polymorphism with Angiographically Proven Atherosclerosis
    Article Snippet: .. DNA amplification was done using 25 µl of cocktail mixture containing 13 µl of nuclease free water; 1.5 µl of d NTP mix; 2.5 µl of 10× buffer; 0.5 µl of Taq polymerase; 2 µl of each forward and 2 µl reverse primer (2 pmol) and 2 µl of (2 pmol) of reverse primer on thermal cycler PTC BIORAD with primers flanking polymorphic region of -629CETP gene. ..

    Article Title: Optimization of DNA extraction for advancing coral microbiota investigations
    Article Snippet: .. To assess PCR efficiency, unaltered DNA template (0.18–47 ng μl−1 ) was amplified in 25 μl reactions containing 1.25 units of GoTaq® Flexi DNA Polymerase (Promega), 5× Colorless GoTaq® Flexi Buffer, 2.5 mM MgCl2 , 200 μM dNTP mix, and 200 nM of each barcoded primer in a thermocycler (Bio-Rad Laboratories). .. The following PCR reaction conditions were used: 95 °C for 2 min, followed by 40 cycles of 95 °C for 20 s, 55 °C for 15 s, and 72 °C for 5 min, concluding with an extension step of 72 °C for 10 min. PCR products were visually screened electrophoretically for quality using a 1% agarose and tris-borate-EDTA gel illuminated with ultraviolet light with the Hyperladder 50 bp DNA ladder (5 ng μl−1 ) (Bioline).

    Construct:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: Paragraph title: Generation of human FBP1 promoter-luciferase reporter constructs and site-directed mutagenesis ... The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad).

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: In Vitro Cleavage of On-Target and Off-Target Substrates Plasmid templates for PCR were constructed by ligation of annealed oligonucleotides CLTA(#) site fwd/rev into Hin dIII/Xba I double-digested pUC19 (NEB). .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Electrophoresis:

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad). .. On-target cleavage reactions were purified with the QIAquick PCR Purification Kit (Qiagen) and off-target cleavage reactions were purified with the QIAquick Nucleotide Removal Kit (Qiagen) before electrophoresis in a Criterion 5% polyacrylamide TBE gel (Bio-Rad).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    Incubation:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). .. Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: Pellet was dissolved in 200 μl of InstaGene matrix and incubated at 56°C for 30 min (Thermomixer Comfort, Eppendorf). .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl.

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C. .. Expression was done in 200 mL LB broth containing 100 µg/mL ampicillin in 1 L shake flask, incubated at 37 °C with 250 rpm shaking in INFORS HP (Ecotron) incubator shaker.

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad). .. 10 U of Klenow Fragment (3′→5′ exo-) (NEB) were added to the reaction mixture and double-stranded off-target templates were obtained by overlap extension for 1 h at 37 °C followed by enzyme inactivation for 20 min at 75 °C, then purified with the QIAquick PCR Purification Kit (Qiagen).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: Pellet was dissolved in 200 μl of InstaGene matrix and incubated at 56°C for 30 min (Thermomixer Comfort, Eppendorf). .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl.

    Luciferase:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The PCR products were digested with Sac I and Xho I before ligation into Sac I and Xho I sites of the pGL4 luciferase reporter vector (Promega).

    Expressing:

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Paragraph title: Cloning and expression ... Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C.

    Article Title: Sitagliptin Reduces Inflammation and Chronic Immune Cell Activation in HIV+ Adults With Impaired Glucose Tolerance
    Article Snippet: Total RNA (200 ng) was reverse transcribed to cDNA in a 20-μL reaction volume (iScript Reverse Transcription Supermix containing RT buffer, MgCl2 , dNTP mix, oligo [dT] random primers, RNase inhibitor, and iScript RNase H+ MMLV reverse transcriptase; Bio-Rad). .. Reverse transcription conditions followed the manufacturer's protocol using a Thermal Cycler 480 (Perkin-Elmer). cDNA preamplification (SsoAdvance PreAmp Supermix; Bio-Rad) was required due to the small tissue sample size and relatively low target mRNA expression in adipose tissue.

    Modification:

    Article Title: In Vitro Selection Using Modified or Unnatural Nucleotides
    Article Snippet: .. Transcribed RNA pools, modified and unmodified (prepared as in Basic Protocol 1 but without radiolabeled ATP) 3000 Ci/mmol α-32 P-labeled dATP (e.g., Perkin Elmer) ThermoScript reverse transcriptase kit (Invitrogen, Life Technologies), kit includes: 5× Buffer, 100 mM DTT, RNase OUT (ribonuclease inhibitor), and RT enzyme 100 µM reverse (3’-end) primer 10 mM dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP) 2× denaturing stop dye (see recipe) 10% (w/v) denaturing polyacrylamide gel (see recipe; APPENDIX 3B ), 0.8 mm thick Thermal cycler Gel blotting paper (Bio-Rad) Plastic wrap Gel dryer with heat and vacuum (e.g., Bio-Rad) Phosphorimager screen Phosphorimager Image analysis software (e.g., GE Healthcare Life Sciences ImageQuant) Additional reagents and equipment for denaturing polyacrylamide gel electrophoresis (PAGE; APPENDIX 3B ) .. 1 Combine the following RT reactions in two separate tubes (13 µL total volume): 10.5 µL (10 pmol or ~0.5 µg) transcribed RNA pool (modified in one tube, unmodified in the other) 1.0 µL 100 µM reverse (3’-end) primer 0.5 µL α-32 P-labeled dATP (this volume should be varied based on the age and subsequent activity of the radiolabeled dATP) 1.0 µL 10 mM dNTP mix Do not use radiolabeled RNA as the input.

    Ligation:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The PCR products were digested with Sac I and Xho I before ligation into Sac I and Xho I sites of the pGL4 luciferase reporter vector (Promega).

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: In Vitro Cleavage of On-Target and Off-Target Substrates Plasmid templates for PCR were constructed by ligation of annealed oligonucleotides CLTA(#) site fwd/rev into Hin dIII/Xba I double-digested pUC19 (NEB). .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Protease Inhibitor:

    Article Title: Cystic fibrosis transmembrane conductance regulator dysfunction in VIP knockout mice
    Article Snippet: ECL+ chemiluminescence detection kit was from GE Healthcare (Buckinghamshire, UK). iTaq DNA Polymerase kit, iScript cDNA Synthesis kit, and dNTP mix were from Bio-Rad (Mississauga, ON, Canada). .. Protease Inhibitor Cocktail was from Roche (Laval, QC, Canada).

    SYBR Green Assay:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). .. Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA).

    Article Title: Sitagliptin Reduces Inflammation and Chronic Immune Cell Activation in HIV+ Adults With Impaired Glucose Tolerance
    Article Snippet: Total RNA (200 ng) was reverse transcribed to cDNA in a 20-μL reaction volume (iScript Reverse Transcription Supermix containing RT buffer, MgCl2 , dNTP mix, oligo [dT] random primers, RNase inhibitor, and iScript RNase H+ MMLV reverse transcriptase; Bio-Rad). .. This reaction master mix is optimized for unbiased, target-specific cDNA preamplification (× 103 ) using PrimePCR PreAmp SYBR Green (Bio-Rad).

    Cell Culture:

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C. .. The expression was induced with 0.75 mM IPTG when optical density A600nm reached 0.5 for 8 h. After induction, cell culture was centrifuged at 12,000× g for 20 min at 4 °C.

    Generated:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: Five 5’-truncated hFBP1 gene promoter fragments consisting of 520, 420, 320, 220 and 120 nucleotides were generated by PCR using forward oligonucleotide primers that direct to different nucleotide positions at the 5’-end of the FBP1 promoter and the common reverse primer (hFBP1-Rev) using full length (906 bp hBP1) as a template. .. The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad).

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: Off-target substrate DNAs were generated by primer extension. .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Sequencing:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: Generation of human FBP1 promoter-luciferase reporter constructs and site-directed mutagenesis The 886 nucleotides upstream of transcription start site together with the first 20 nucleotides downstream of transcription site of human FBP1 gene (-886/+20) were cloned from genomic DNA by a PCR technique using the hFBP1 forward and reverse primers (sequences shown in ) designed from human FBP1 gene sequence deposited at NCBI (accession no. NT_008470). .. The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad).

    Binding Assay:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The binding sites of C/EBPα (-218/-208 and -228/-218) or HNF4α (-212/-198, -359/-346 and -566/-554) in the hFBP1 promoter-luciferase reporter were mutated by Quick change site-directed mutagenesis (Stratagene Agilent Technologies) using the 320 nucleotides fragment of hFBP1 or the 906 bp nucleotides of hFBP1 promoter-reporter construct as template.

    DNA Extraction:

    Article Title: Association of Cholesteryl Ester Transfer Protein (CETP) Gene -629C/A Polymorphism with Angiographically Proven Atherosclerosis
    Article Snippet: DNA extraction was done by using DNA extraction kit from QIGEN. .. DNA amplification was done using 25 µl of cocktail mixture containing 13 µl of nuclease free water; 1.5 µl of d NTP mix; 2.5 µl of 10× buffer; 0.5 µl of Taq polymerase; 2 µl of each forward and 2 µl reverse primer (2 pmol) and 2 µl of (2 pmol) of reverse primer on thermal cycler PTC BIORAD with primers flanking polymorphic region of -629CETP gene.

    Fluorescence:

    Article Title: Cystic fibrosis transmembrane conductance regulator dysfunction in VIP knockout mice
    Article Snippet: Normal goat serum and Vectashield Mounting Media for Fluorescence were from Vector Laboratories (Burlingame, CA). .. ECL+ chemiluminescence detection kit was from GE Healthcare (Buckinghamshire, UK). iTaq DNA Polymerase kit, iScript cDNA Synthesis kit, and dNTP mix were from Bio-Rad (Mississauga, ON, Canada).

    Mutagenesis:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: Paragraph title: Generation of human FBP1 promoter-luciferase reporter constructs and site-directed mutagenesis ... The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad).

    Isolation:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: .. Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). .. Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA).

    Size-exclusion Chromatography:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The PCR profile consisted of initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 45 sec, annealing at 60°C for 45 sec and extension at 72°C for 2 min, and final extension at 72°C for 10 min.

    Purification:

    Article Title: Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell
    Article Snippet: Each reaction was set up with 2.5 μL of 10X iTaq buffer, 1.5 mM MgCl2 , 0.625U iTaq DNA polymerase (170-8870, Bio-Rad), 0.5 μL of 10 mM dNTP mix (170-8874, Bio-Rad), 1 μL each of telomere forward and reverse primers (10 μM), and 1 μL each of Alu forward and reverse primers (10 μM). .. Thermal cycler reaction conditions were set at 95 °C for 3 min followed by 18 cycles of 95 °C for 30 s, 60 °C annealing for 30 s, and extension at 72 °C for 30 s. PCR products were purified using DNA clean and concentrator-5 kit (D4004, Zymo Research) and eluted in 64 μL of double distilled water. iQ™ SYBR® Green-based real-time PCR (170-8882, Bio-Rad) was performed using the same primer sets.

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: On-target substrate DNAs were generated by PCR with the plasmid templates and test fwd and test rev primers, then purified with the QIAquick PCR Purification Kit (Qiagen). .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Polymerase Chain Reaction:

    Article Title: Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell
    Article Snippet: Each reaction was set up with 2.5 μL of 10X iTaq buffer, 1.5 mM MgCl2 , 0.625U iTaq DNA polymerase (170-8870, Bio-Rad), 0.5 μL of 10 mM dNTP mix (170-8874, Bio-Rad), 1 μL each of telomere forward and reverse primers (10 μM), and 1 μL each of Alu forward and reverse primers (10 μM). .. Thermal cycler reaction conditions were set at 95 °C for 3 min followed by 18 cycles of 95 °C for 30 s, 60 °C annealing for 30 s, and extension at 72 °C for 30 s. PCR products were purified using DNA clean and concentrator-5 kit (D4004, Zymo Research) and eluted in 64 μL of double distilled water. iQ™ SYBR® Green-based real-time PCR (170-8882, Bio-Rad) was performed using the same primer sets.

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: .. The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The PCR profile consisted of initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 45 sec, annealing at 60°C for 45 sec and extension at 72°C for 2 min, and final extension at 72°C for 10 min.

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). .. Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR was carried out using an initial denaturation step at 95°C for 4 min, followed by 35 cycles of 1 min at 94°C, 1 min at 40°C, and 1 min at 72°C each, and by a final extension of 8 min at 72°C.

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Cloning and expression The glgB from G. mahadia Geo-05 were amplified using polymerase chain reaction (PCR). .. Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C.

    Article Title: Catalase overexpression modulates metabolic parameters in a new ‘stress-less’ leptin-deficient mouse model
    Article Snippet: For genotyping, 0.25 μg (1 μL) of each DNA sample was added to a reaction mix of 18.125 μL RNase free H2 O, 2.5 μL of 10X i Taq Buffer, 0.75 μL of MgCl2 50 mM, 0.5 μL dNTP mix 10 mM, 1 μL forward primer, 1 μL reverse primer, 0.125 μL i Taq DNA polymerase to prepare for amplification of DNA in the BioRad MyiQ (BioRad, Hercules, CA). .. PCR protocol was conducted as described in previous publications [ , ].

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: On-target substrate DNAs were generated by PCR with the plasmid templates and test fwd and test rev primers, then purified with the QIAquick PCR Purification Kit (Qiagen). .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Article Title: Identification of torque teno virus in culture-negative endophthalmitis by representational deep-DNA sequencing
    Article Snippet: HotStarTaq plus DNA polymerase was used for the PCR reactions. .. The master mix containing 10x Buffer, Taq polymerase, dNTP mix and the primers was treated with 8-methoxypsoralen (25μg/mL) and UV nicked for 5 min (Bio-Rad GS gene linker, UV chamber) to bind any contaminating DNA.

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR was carried out using an initial denaturation step at 95°C for 4 min, followed by 35 cycles of 1 min at 94°C, 1 min at 40°C, and 1 min at 72°C each, and by a final extension of 8 min at 72°C.

    Article Title: Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
    Article Snippet: Paragraph title: PCR ... One microliter of cDNA was used in each reaction along with iTaq DNA Polymerase and dNTP mix (Bio-Rad, Hercules, CA).

    Article Title: Association of Cholesteryl Ester Transfer Protein (CETP) Gene -629C/A Polymorphism with Angiographically Proven Atherosclerosis
    Article Snippet: DNA amplification was done using 25 µl of cocktail mixture containing 13 µl of nuclease free water; 1.5 µl of d NTP mix; 2.5 µl of 10× buffer; 0.5 µl of Taq polymerase; 2 µl of each forward and 2 µl reverse primer (2 pmol) and 2 µl of (2 pmol) of reverse primer on thermal cycler PTC BIORAD with primers flanking polymorphic region of -629CETP gene. .. The Program for CETP -629 PCR assay was as follows: Initial denaturation at 95 °C for 5 min, cycle denaturation at 95 °C for 30 s, cycle annealing at 57 °C for 45 s, cycle extension at 72 °C for 30 s, final extension at 72 °C for 7 min.

    Article Title: Optimization of DNA extraction for advancing coral microbiota investigations
    Article Snippet: .. To assess PCR efficiency, unaltered DNA template (0.18–47 ng μl−1 ) was amplified in 25 μl reactions containing 1.25 units of GoTaq® Flexi DNA Polymerase (Promega), 5× Colorless GoTaq® Flexi Buffer, 2.5 mM MgCl2 , 200 μM dNTP mix, and 200 nM of each barcoded primer in a thermocycler (Bio-Rad Laboratories). .. The following PCR reaction conditions were used: 95 °C for 2 min, followed by 40 cycles of 95 °C for 20 s, 55 °C for 15 s, and 72 °C for 5 min, concluding with an extension step of 72 °C for 10 min. PCR products were visually screened electrophoretically for quality using a 1% agarose and tris-borate-EDTA gel illuminated with ultraviolet light with the Hyperladder 50 bp DNA ladder (5 ng μl−1 ) (Bioline).

    Quantitative RT-PCR:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: Paragraph title: Quantitative Real-Time RT-PCR ... Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA).

    Article Title: Sitagliptin Reduces Inflammation and Chronic Immune Cell Activation in HIV+ Adults With Impaired Glucose Tolerance
    Article Snippet: The adipose sample was immediately rinsed with ice-cold saline, frozen in liquid nitrogen, and stored (−80°C) until batch analysis using quantitative RT-PCR for mRNA transcripts: CCL2 (monocyte chemotactic protein-1 [MCP-1]), and EMR1 (EGF-like module-containing, mucin-like hormone receptor 1), the human homolog of mouse F4/80 found on tissue-resident monocytes and macrophages ( ). .. Total RNA (200 ng) was reverse transcribed to cDNA in a 20-μL reaction volume (iScript Reverse Transcription Supermix containing RT buffer, MgCl2 , dNTP mix, oligo [dT] random primers, RNase inhibitor, and iScript RNase H+ MMLV reverse transcriptase; Bio-Rad).

    Polyacrylamide Gel Electrophoresis:

    Article Title: In Vitro Selection Using Modified or Unnatural Nucleotides
    Article Snippet: .. Transcribed RNA pools, modified and unmodified (prepared as in Basic Protocol 1 but without radiolabeled ATP) 3000 Ci/mmol α-32 P-labeled dATP (e.g., Perkin Elmer) ThermoScript reverse transcriptase kit (Invitrogen, Life Technologies), kit includes: 5× Buffer, 100 mM DTT, RNase OUT (ribonuclease inhibitor), and RT enzyme 100 µM reverse (3’-end) primer 10 mM dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP) 2× denaturing stop dye (see recipe) 10% (w/v) denaturing polyacrylamide gel (see recipe; APPENDIX 3B ), 0.8 mm thick Thermal cycler Gel blotting paper (Bio-Rad) Plastic wrap Gel dryer with heat and vacuum (e.g., Bio-Rad) Phosphorimager screen Phosphorimager Image analysis software (e.g., GE Healthcare Life Sciences ImageQuant) Additional reagents and equipment for denaturing polyacrylamide gel electrophoresis (PAGE; APPENDIX 3B ) .. 1 Combine the following RT reactions in two separate tubes (13 µL total volume): 10.5 µL (10 pmol or ~0.5 µg) transcribed RNA pool (modified in one tube, unmodified in the other) 1.0 µL 100 µM reverse (3’-end) primer 0.5 µL α-32 P-labeled dATP (this volume should be varied based on the age and subsequent activity of the radiolabeled dATP) 1.0 µL 10 mM dNTP mix Do not use radiolabeled RNA as the input.

    Staining:

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
    Article Snippet: Forward and reverse primers used for amplifying rat PAR4 were prepared commercially, based on published data ( ): sense, 5′-GGA ATG CCA GAC GCC CAG CAT C-3′; and antisense, 5′-GGT GAG GCG TTG ACC ACG CA-3′ (PCR product, 559 bp). .. One microliter of cDNA was used in each reaction along with iTaq DNA Polymerase and dNTP mix (Bio-Rad, Hercules, CA).

    Plasmid Preparation:

    Article Title: CCAAT-enhancer binding protein-α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α) regulate expression of the human fructose-1,6-bisphosphatase 1 (FBP1) gene in human hepatocellular carcinoma HepG2 cells
    Article Snippet: The PCR was carried out in a 50 μl reaction mixture containing 1x PCR reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 0.2 mM dNTP mixture, 1.5 mM MgCl2 , 0.5 μM each primer, 50 ng genomic DNA and 2.5 units Taq DNA polymerase in an automated thermal cycler MJ Mini (Bio-Rad). .. The PCR products were digested with Sac I and Xho I before ligation into Sac I and Xho I sites of the pGL4 luciferase reporter vector (Promega).

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: The forward primer has additional four bases at the 5′ end to prepare the insert for cloning reaction into pET102/D-TOPO® vector (Invitrogen). .. Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C.

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: On-target substrate DNAs were generated by PCR with the plasmid templates and test fwd and test rev primers, then purified with the QIAquick PCR Purification Kit (Qiagen). .. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Software:

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. Rep-PCR profiles were analyzed by BioNumerics 5.0 software (Applied Maths) using Pearson’s correlation coefficient with UPGMA (Unweighted Pair Group Method with Arithmetic Mean) clustering of averaged profile similarities.

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. Rep-PCR profiles were analyzed by BioNumerics 5.0 software (Applied Maths) using Pearson’s correlation coefficient with UPGMA (Unweighted Pair Group Method with Arithmetic Mean) clustering of averaged profile similarities.

    Article Title: In Vitro Selection Using Modified or Unnatural Nucleotides
    Article Snippet: .. Transcribed RNA pools, modified and unmodified (prepared as in Basic Protocol 1 but without radiolabeled ATP) 3000 Ci/mmol α-32 P-labeled dATP (e.g., Perkin Elmer) ThermoScript reverse transcriptase kit (Invitrogen, Life Technologies), kit includes: 5× Buffer, 100 mM DTT, RNase OUT (ribonuclease inhibitor), and RT enzyme 100 µM reverse (3’-end) primer 10 mM dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP) 2× denaturing stop dye (see recipe) 10% (w/v) denaturing polyacrylamide gel (see recipe; APPENDIX 3B ), 0.8 mm thick Thermal cycler Gel blotting paper (Bio-Rad) Plastic wrap Gel dryer with heat and vacuum (e.g., Bio-Rad) Phosphorimager screen Phosphorimager Image analysis software (e.g., GE Healthcare Life Sciences ImageQuant) Additional reagents and equipment for denaturing polyacrylamide gel electrophoresis (PAGE; APPENDIX 3B ) .. 1 Combine the following RT reactions in two separate tubes (13 µL total volume): 10.5 µL (10 pmol or ~0.5 µg) transcribed RNA pool (modified in one tube, unmodified in the other) 1.0 µL 100 µM reverse (3’-end) primer 0.5 µL α-32 P-labeled dATP (this volume should be varied based on the age and subsequent activity of the radiolabeled dATP) 1.0 µL 10 mM dNTP mix Do not use radiolabeled RNA as the input.

    Real-time Polymerase Chain Reaction:

    Article Title: Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell
    Article Snippet: Single-cell telomere length assay Single-cell telomere length was measured using single-cell telomere length measurement by qPCR assay, as previously described [ ]. .. Each reaction was set up with 2.5 μL of 10X iTaq buffer, 1.5 mM MgCl2 , 0.625U iTaq DNA polymerase (170-8870, Bio-Rad), 0.5 μL of 10 mM dNTP mix (170-8874, Bio-Rad), 1 μL each of telomere forward and reverse primers (10 μM), and 1 μL each of Alu forward and reverse primers (10 μM).

    Article Title: Identification of torque teno virus in culture-negative endophthalmitis by representational deep-DNA sequencing
    Article Snippet: Paragraph title: 16S bacterial, TTV, and actin qPCR ... The master mix containing 10x Buffer, Taq polymerase, dNTP mix and the primers was treated with 8-methoxypsoralen (25μg/mL) and UV nicked for 5 min (Bio-Rad GS gene linker, UV chamber) to bind any contaminating DNA.

    Multiplex Assay:

    Article Title: Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell
    Article Snippet: A multiplex pre-amplification (pre-PCR) step that can amplify telomere repeats (T) and Alu reference gene (R) were simultaneously employed with telomere primers (forward primer: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT, reverse primer: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT), and Alu primers (forward primer: GACCATCCCGGCTAAAACG, reverse primer: CGGGTTCACGCCATTCTC). .. Each reaction was set up with 2.5 μL of 10X iTaq buffer, 1.5 mM MgCl2 , 0.625U iTaq DNA polymerase (170-8870, Bio-Rad), 0.5 μL of 10 mM dNTP mix (170-8874, Bio-Rad), 1 μL each of telomere forward and reverse primers (10 μM), and 1 μL each of Alu forward and reverse primers (10 μM).

    Positron Emission Tomography:

    Article Title: Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05
    Article Snippet: Amplification process was carried out in a reaction mixture containing 20–50 ng DNA template, 0.2 µM forward and reverse primers, 0.2 mM dNTP mix, 1.2 U Pfu DNA polymerase and 1×Pfu Buffer with MgSO4 .The genes were amplified using a thermocycler (MyCycler™, BioRad) with the temperature program of predenaturation at 95 °C for 5 min; 35 cycles of 30 s denaturation at 95 °C, 30 s annealing at 57 °C and 4 min extension at 72 °C; followed by final elongation step at 72 °C for 7 min and hold at 10 °C. .. Fresh PCR products were cloned into pET102/D-TOPO® vector from Champion™ pET Directional TOPO® Expression Kit expressed in E. coli BL21 Star™ (DE3).

    Agarose Gel Electrophoresis:

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl. .. PCR products were separated by electrophoresis (3 h at 130 V) on 1.7% (w/v) agarose gel stained with 0.1 μl/ml SYBR safe (Invitrogen) and visualized by UV transillumination.

    In Vitro:

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity
    Article Snippet: Paragraph title: In Vitro Cleavage of On-Target and Off-Target Substrates ... 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95 °C and cooled at 0.1 °C/s to 37 °C in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad).

    Spectrophotometry:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: The quality and quantity of the extracted RNA in each tissue was examined with spectrophotometry (Beckman DU7500). .. Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA).

    Article Title: Sitagliptin Reduces Inflammation and Chronic Immune Cell Activation in HIV+ Adults With Impaired Glucose Tolerance
    Article Snippet: Total RNA was extracted (Aurum Total RNA Fatty and Fibrous Tissue kit; Bio-Rad) according to the manufacturer's protocol and quantified using a NanoDrop 2000 UV-VIS spectrophotometer (Thermo Scientific). .. Total RNA (200 ng) was reverse transcribed to cDNA in a 20-μL reaction volume (iScript Reverse Transcription Supermix containing RT buffer, MgCl2 , dNTP mix, oligo [dT] random primers, RNase inhibitor, and iScript RNase H+ MMLV reverse transcriptase; Bio-Rad).

    Article Title: Adaptation to Aerobic Environment of Lactobacillus johnsonii/gasseri Strains
    Article Snippet: Quality and quantity of DNA was assessed using a NanoDrop spectrophotometer 1000 (Thermo Scientific, Milan, Italy). .. The reaction was performed in 20 μl mixtures containing: 50 ng DNA template, 2.5 μl of 10× PCR Buffer (Invitrogen, Milan, Italy), 50 mM MgCl2 , 10 mM dNTPs mix, 10 μM primer, and Taq Polymerase (Bio-Rad) 5 U/μl.

    Concentration Assay:

    Article Title: Electro-Acupuncture Alleviates Chronic Unpredictable Stress-Induced Depressive- and Anxiety-Like Behavior and Hippocampal Neuroinflammation in Rat Model of Depression
    Article Snippet: .. Equal amounts of RNA (2 μg/sample) isolated from the each hippocampi was reacted with M-MLV reverse transcriptase (iScriptTM cDNA Synthesis Kit, Bio-Rad, CA, USA) to generate cDNA in the following reaction: 5 μl of 5× M-MLV Reverse Transcriptase Reaction Buffer which included, in the final concentration, 1 μl of 0.5 ug/μl Oligo(dT)15 Primer (Bio-Rad), 2 μl of 10 mM dNTP Mix (Bio-Rad), 1 μl of 200 U/μl M-MLV reverse transcriptase (Bio-Rad, CA, USA), and 0.5 μl of 40 U/μl RNase inhibitor (Bio-Rad, CA, USA). .. Each reaction was then incubated at 37°C for 1 h. Equal amounts of cDNA (2 μl) were then used for subsequent PCR using iTap SYBR Green Master Mix (Bio-Rad, CA, USA).

    Lysis:

    Article Title: Sitagliptin Reduces Inflammation and Chronic Immune Cell Activation in HIV+ Adults With Impaired Glucose Tolerance
    Article Snippet: Frozen tissue (100 mg) was suspended in 250 μL PureZOL (Bio-Rad) and homogenized using a RINO Pink Bead Lysis kit (Bullet Blender Blue 24; MidSci). .. Total RNA (200 ng) was reverse transcribed to cDNA in a 20-μL reaction volume (iScript Reverse Transcription Supermix containing RT buffer, MgCl2 , dNTP mix, oligo [dT] random primers, RNase inhibitor, and iScript RNase H+ MMLV reverse transcriptase; Bio-Rad).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad dntp mixture
    Dntp Mixture, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mixture/product/Bio-Rad
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    dntp mixture - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results