dneasy blood  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    DNeasy Kit
    Description:

    Catalog Number:
    69506
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen dneasy blood
    DNA yield from seven extraction protocols <t>(DNeasy:</t> <t>Qiagen</t> DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    https://www.bioz.com/result/dneasy blood/product/Qiagen
    Average 99 stars, based on 2793 article reviews
    Price from $9.99 to $1999.99
    dneasy blood - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    2) Product Images from "Methods to maximise recovery of environmental DNA from water samples"

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0179251

    Experimental design for Experiment 2A to investigate which DNA extraction kit-filter paper combination would give the best DNA yield. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.
    Figure Legend Snippet: Experimental design for Experiment 2A to investigate which DNA extraction kit-filter paper combination would give the best DNA yield. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Techniques Used: DNA Extraction

    DNA yield from eight DNA extraction kit-filter paper combinations from samples in aquaria with UV-sterilized water. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. CN = Cellulose Nitrate, MCE = Mixed Cellulose Ester, PES = Polyethersulfone, PCTE = Polycarbonate track-etched. Error bars show the ±2 standard deviation of the mean.
    Figure Legend Snippet: DNA yield from eight DNA extraction kit-filter paper combinations from samples in aquaria with UV-sterilized water. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. CN = Cellulose Nitrate, MCE = Mixed Cellulose Ester, PES = Polyethersulfone, PCTE = Polycarbonate track-etched. Error bars show the ±2 standard deviation of the mean.

    Techniques Used: DNA Extraction, Standard Deviation

    Experimental design for Experiment 2B investigating DNA yields in five different DNA extraction kit-filter paper combination from stream water. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.
    Figure Legend Snippet: Experimental design for Experiment 2B investigating DNA yields in five different DNA extraction kit-filter paper combination from stream water. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Techniques Used: DNA Extraction

    Experimental design used to compare five different combinations of capture, preservation and DNA extraction methods. N is the number of technical replicates and each replicate represents one 250 ml water sample. DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.
    Figure Legend Snippet: Experimental design used to compare five different combinations of capture, preservation and DNA extraction methods. N is the number of technical replicates and each replicate represents one 250 ml water sample. DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Techniques Used: Preserving, DNA Extraction

    DNA yield from five different extraction kit-filter paper combinations from stream water samples. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. Error bars show the ±2 standard deviation of the mean.
    Figure Legend Snippet: DNA yield from five different extraction kit-filter paper combinations from stream water samples. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. Error bars show the ±2 standard deviation of the mean.

    Techniques Used: Standard Deviation

    3) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    4) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    5) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    6) Product Images from "Evaluation of rapid extraction and isothermal amplification techniques for the detection of Leishmania donovani DNA from skin lesions of suspected cases at the point of need in Sri Lanka"

    Article Title: Evaluation of rapid extraction and isothermal amplification techniques for the detection of Leishmania donovani DNA from skin lesions of suspected cases at the point of need in Sri Lanka

    Journal: Parasites & Vectors

    doi: 10.1186/s13071-018-3238-1

    Comparison between the sample types and test methods. The slit skin smears were examined with microscopy. The skin scrapping and aspirate were tested at the point of need with SpeedXtract (SE) and recombinase polymerase amplification (RPA) assay. The punch biopsies were screened with SE and RPA as well as DNeasy blood and tissue kit (mini) and polymerase chain reaction (PCR). Abbreviations : ID, sample identification code; POS, Leishmania donovani was detected; NEG, negative test results
    Figure Legend Snippet: Comparison between the sample types and test methods. The slit skin smears were examined with microscopy. The skin scrapping and aspirate were tested at the point of need with SpeedXtract (SE) and recombinase polymerase amplification (RPA) assay. The punch biopsies were screened with SE and RPA as well as DNeasy blood and tissue kit (mini) and polymerase chain reaction (PCR). Abbreviations : ID, sample identification code; POS, Leishmania donovani was detected; NEG, negative test results

    Techniques Used: Microscopy, Recombinase Polymerase Amplification, Polymerase Chain Reaction

    7) Product Images from "The Anatomy to Genomics (ATG) Start Genetics medical school initiative: incorporating exome sequencing data from cadavers used for Anatomy instruction into the first year curriculum"

    Article Title: The Anatomy to Genomics (ATG) Start Genetics medical school initiative: incorporating exome sequencing data from cadavers used for Anatomy instruction into the first year curriculum

    Journal: BMC Medical Genomics

    doi: 10.1186/s12920-016-0223-4

    Agarose gel electrophoresis of DNA isolated from cadaver tissues using the DNeasy Blood Tissue Kit. MW = Quick-load 1 kb DNA Ladder (New England BioLabs). Lane 1: Liver without RNAse treatment. Lane 2: Heart without RNAse treatment. Lane 3: Liver with RNAse treatment. Lane 4: Heart with RNAse treatment. Lane 5: Skeletal Muscle with RNAse treatment. Lane 6: Skin with RNAse treatment
    Figure Legend Snippet: Agarose gel electrophoresis of DNA isolated from cadaver tissues using the DNeasy Blood Tissue Kit. MW = Quick-load 1 kb DNA Ladder (New England BioLabs). Lane 1: Liver without RNAse treatment. Lane 2: Heart without RNAse treatment. Lane 3: Liver with RNAse treatment. Lane 4: Heart with RNAse treatment. Lane 5: Skeletal Muscle with RNAse treatment. Lane 6: Skin with RNAse treatment

    Techniques Used: Agarose Gel Electrophoresis, Isolation

    Agarose gel electrophoresis of DNA isolated from cadaver tissues. MW = GeneRuler 1 kb Plus DNA Ladder (Thermo Fisher Scientific). Lane 1: Heart DNA extracted with DNeasy Blood Tissue Kit. Lane 2: Liver DNA extracted with DNeasy Blood Tissue Kit. Lane 3: Heart DNA extracted with FFPE kit. Lane 4: Liver DNA extracted with FFPE kit
    Figure Legend Snippet: Agarose gel electrophoresis of DNA isolated from cadaver tissues. MW = GeneRuler 1 kb Plus DNA Ladder (Thermo Fisher Scientific). Lane 1: Heart DNA extracted with DNeasy Blood Tissue Kit. Lane 2: Liver DNA extracted with DNeasy Blood Tissue Kit. Lane 3: Heart DNA extracted with FFPE kit. Lane 4: Liver DNA extracted with FFPE kit

    Techniques Used: Agarose Gel Electrophoresis, Isolation, Formalin-fixed Paraffin-Embedded

    8) Product Images from "Loop-mediated isothermal amplification (LAMP) assay—A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena)"

    Article Title: Loop-mediated isothermal amplification (LAMP) assay—A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0184349

    Application of the LAMP assay on a stranded harbour porpoise. Gel electrophoresis of all LAMP products of the stranded harbour porpoise. Directly tested MSwab ™ samples (without DNA isolation) and DNA isolation of the MSwab ™ medium using DNeasy ® blood and tissue kit.
    Figure Legend Snippet: Application of the LAMP assay on a stranded harbour porpoise. Gel electrophoresis of all LAMP products of the stranded harbour porpoise. Directly tested MSwab ™ samples (without DNA isolation) and DNA isolation of the MSwab ™ medium using DNeasy ® blood and tissue kit.

    Techniques Used: Lamp Assay, Nucleic Acid Electrophoresis, DNA Extraction

    9) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    10) Product Images from "DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure"

    Article Title: DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    Journal: MicrobiologyOpen

    doi: 10.1002/mbo3.216

    Measures of success for each bacterial extraction protocol (Phenol–chloroform: PC; Qiagen DNeasy Blood Tissue Kit: Qiagen; PowerSoil DNA Isolation Kit: PowerSoil; and PowerSoil DNA Isolation Kit with the addition of a tissue homogenization and digestion step: modified PowerSoil). (A) Mean ± SE copies of bacterial 16S rRNA gene/ μ L. (B) Mean ± SE total DNA concentrations (ng/ μ L). Letters above bars show significant differences as determined by paired t -tests ( P
    Figure Legend Snippet: Measures of success for each bacterial extraction protocol (Phenol–chloroform: PC; Qiagen DNeasy Blood Tissue Kit: Qiagen; PowerSoil DNA Isolation Kit: PowerSoil; and PowerSoil DNA Isolation Kit with the addition of a tissue homogenization and digestion step: modified PowerSoil). (A) Mean ± SE copies of bacterial 16S rRNA gene/ μ L. (B) Mean ± SE total DNA concentrations (ng/ μ L). Letters above bars show significant differences as determined by paired t -tests ( P

    Techniques Used: DNA Extraction, Homogenization, Modification

    11) Product Images from "Absolute Enumeration of Probiotic Strains Lactobacillus acidophilus NCFM® and Bifidobacterium animalis subsp. lactis Bl-04® via Chip-Based Digital PCR"

    Article Title: Absolute Enumeration of Probiotic Strains Lactobacillus acidophilus NCFM® and Bifidobacterium animalis subsp. lactis Bl-04® via Chip-Based Digital PCR

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.00704

    Qiagen DNeasy replicate isolations of DNA from NCFM overnight cells not treated with PMA. Columns with differing letter are significantly different from each other.
    Figure Legend Snippet: Qiagen DNeasy replicate isolations of DNA from NCFM overnight cells not treated with PMA. Columns with differing letter are significantly different from each other.

    Techniques Used:

    12) Product Images from "Conventional and PCR Detection of Aphelenchoides fragariae in Diverse Ornamental Host Plant Species"

    Article Title: Conventional and PCR Detection of Aphelenchoides fragariae in Diverse Ornamental Host Plant Species

    Journal:

    doi:

    Comparison of DNA extraction methods for detection of Aphelenchoides fragariae in naturally infected Asplenium nidus (Bird's nest fern) plant tissue using species-specific PCR primers. Lane 1: healthy A. nidus extracted with Qiagen Dneasy Plant Mini Kit;
    Figure Legend Snippet: Comparison of DNA extraction methods for detection of Aphelenchoides fragariae in naturally infected Asplenium nidus (Bird's nest fern) plant tissue using species-specific PCR primers. Lane 1: healthy A. nidus extracted with Qiagen Dneasy Plant Mini Kit;

    Techniques Used: DNA Extraction, Infection, Polymerase Chain Reaction

    13) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    14) Product Images from "Comparing Two Common DNA Extraction Kits for the Characterization of Symbiotic Microbial Communities from Ascidian Tissue"

    Article Title: Comparing Two Common DNA Extraction Kits for the Characterization of Symbiotic Microbial Communities from Ascidian Tissue

    Journal: Microbes and Environments

    doi: 10.1264/jsme2.ME18031

    Non-metric multi-dimensional scaling plot based on the Bray-Curtis similarity of microbial communities obtained using DNeasy (black triangles) and PowerSoil (gray circles) kits. Circles encompass samples clustering at > 30% similarity and correspond to replicates of Clavelina oblonga (dashed line) and Polyandrocarpa anguinea (solid line), indicating a high degree of host-specificity and low technical variation across DNA extraction methods.
    Figure Legend Snippet: Non-metric multi-dimensional scaling plot based on the Bray-Curtis similarity of microbial communities obtained using DNeasy (black triangles) and PowerSoil (gray circles) kits. Circles encompass samples clustering at > 30% similarity and correspond to replicates of Clavelina oblonga (dashed line) and Polyandrocarpa anguinea (solid line), indicating a high degree of host-specificity and low technical variation across DNA extraction methods.

    Techniques Used: DNA Extraction

    Microbial community composition averaged by source and kit (a), and for each replicate sample within each source: Clavelina oblonga , DNeasy (b), C. oblonga , PowerSoil (c), Polyandrocarpa anguinea , DNeasy (d), and P. anguinea , PowerSoil (e). Phylum-level classifications are shown, except for Proteobacteria , which were divided into four classes: Alpha -, Gamma -, Delta -, and Epsilonproteobacteria . Each library represents 20,007 sequence reads.
    Figure Legend Snippet: Microbial community composition averaged by source and kit (a), and for each replicate sample within each source: Clavelina oblonga , DNeasy (b), C. oblonga , PowerSoil (c), Polyandrocarpa anguinea , DNeasy (d), and P. anguinea , PowerSoil (e). Phylum-level classifications are shown, except for Proteobacteria , which were divided into four classes: Alpha -, Gamma -, Delta -, and Epsilonproteobacteria . Each library represents 20,007 sequence reads.

    Techniques Used: Sequencing

    15) Product Images from "Absolute Enumeration of Probiotic Strains Lactobacillus acidophilus NCFM® and Bifidobacterium animalis subsp. lactis Bl-04® via Chip-Based Digital PCR"

    Article Title: Absolute Enumeration of Probiotic Strains Lactobacillus acidophilus NCFM® and Bifidobacterium animalis subsp. lactis Bl-04® via Chip-Based Digital PCR

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.00704

    Qiagen DNeasy replicate isolations of DNA from NCFM overnight cells not treated with PMA. Columns with differing letter are significantly different from each other.
    Figure Legend Snippet: Qiagen DNeasy replicate isolations of DNA from NCFM overnight cells not treated with PMA. Columns with differing letter are significantly different from each other.

    Techniques Used:

    16) Product Images from "16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles"

    Article Title: 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

    Journal: Microbiome

    doi: 10.1186/2049-2618-2-31

    Variability of oropharyngeal microbiome profiles with storage temperatures. (A) Variability of oropharyngeal microbiome profiles with storage temperatures for the MO BIO PowerSoil extraction method. Four specimens were collected from each subject and stored for 4 weeks at different temperatures. Microbiome profiles at the genus level were estimated using QIIME. The figure presents the principal coordinate analysis based on the weighted UniFrac distances between these microbiome profiles. Each coordinate axis explains the specified percent of the total community variability. (B) Variability of oropharyngeal microbiome profiles with storage temperatures for the Qiagen DNeasy extraction method. Four specimens were collected from each subject and stored for four weeks at different temperatures. Microbiome profiles at the genus level were estimated using QIIME. The figure presents the principal coordinate analysis based on the weighted UniFrac distances between these microbiome profiles. Each coordinate axis explains the specified percent of the total community variability.
    Figure Legend Snippet: Variability of oropharyngeal microbiome profiles with storage temperatures. (A) Variability of oropharyngeal microbiome profiles with storage temperatures for the MO BIO PowerSoil extraction method. Four specimens were collected from each subject and stored for 4 weeks at different temperatures. Microbiome profiles at the genus level were estimated using QIIME. The figure presents the principal coordinate analysis based on the weighted UniFrac distances between these microbiome profiles. Each coordinate axis explains the specified percent of the total community variability. (B) Variability of oropharyngeal microbiome profiles with storage temperatures for the Qiagen DNeasy extraction method. Four specimens were collected from each subject and stored for four weeks at different temperatures. Microbiome profiles at the genus level were estimated using QIIME. The figure presents the principal coordinate analysis based on the weighted UniFrac distances between these microbiome profiles. Each coordinate axis explains the specified percent of the total community variability.

    Techniques Used:

    Normalization of PCR amplification by choosing PCR cycle number close to the Ct value. Throat swabs from healthy volunteers were extracted with Qiagen DNeasy (D) or MO BIO PowerSoil (M). DNA extracts were subjected to 16S gene TaqMan qPCR and subsequent PCR using a cycle number of 20, 25, or 30 based on individual sample's qPCR Ct value. PCR amplicons were quantified by PicoGreen dsDNA assay. DNA concentrations for DNA extracts ( blue markers and axis ) and PCR amplicons ( red markers and axis ) are shown in 16S gene copies/μl in the same scale. DNA sample name, 08S1M as an example, depicts the subject number (08), swab number (S1), and extraction method (M).
    Figure Legend Snippet: Normalization of PCR amplification by choosing PCR cycle number close to the Ct value. Throat swabs from healthy volunteers were extracted with Qiagen DNeasy (D) or MO BIO PowerSoil (M). DNA extracts were subjected to 16S gene TaqMan qPCR and subsequent PCR using a cycle number of 20, 25, or 30 based on individual sample's qPCR Ct value. PCR amplicons were quantified by PicoGreen dsDNA assay. DNA concentrations for DNA extracts ( blue markers and axis ) and PCR amplicons ( red markers and axis ) are shown in 16S gene copies/μl in the same scale. DNA sample name, 08S1M as an example, depicts the subject number (08), swab number (S1), and extraction method (M).

    Techniques Used: Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction, Picogreen Assay

    Storage temperature comparisons for Qiagen DNeasy and MO BIO PowerSoil DNA extraction methods for the mock bacterial community HM-280. Identical samples from the mock community were stored at four different temperatures and extracted after 4 weeks using the two methods, Qiagen DNeasy and MO BIO PowerSoil. Microbial profiles at the genus level were estimated using QIIME. Overall, samples were well preserved at lower temperatures for both methods, whereas significant differences were observed at 37°C.
    Figure Legend Snippet: Storage temperature comparisons for Qiagen DNeasy and MO BIO PowerSoil DNA extraction methods for the mock bacterial community HM-280. Identical samples from the mock community were stored at four different temperatures and extracted after 4 weeks using the two methods, Qiagen DNeasy and MO BIO PowerSoil. Microbial profiles at the genus level were estimated using QIIME. Overall, samples were well preserved at lower temperatures for both methods, whereas significant differences were observed at 37°C.

    Techniques Used: DNA Extraction

    17) Product Images from "Comparing Two Common DNA Extraction Kits for the Characterization of Symbiotic Microbial Communities from Ascidian Tissue"

    Article Title: Comparing Two Common DNA Extraction Kits for the Characterization of Symbiotic Microbial Communities from Ascidian Tissue

    Journal: Microbes and Environments

    doi: 10.1264/jsme2.ME18031

    Non-metric multi-dimensional scaling plot based on the Bray-Curtis similarity of microbial communities obtained using DNeasy (black triangles) and PowerSoil (gray circles) kits. Circles encompass samples clustering at > 30% similarity and correspond to replicates of Clavelina oblonga (dashed line) and Polyandrocarpa anguinea (solid line), indicating a high degree of host-specificity and low technical variation across DNA extraction methods.
    Figure Legend Snippet: Non-metric multi-dimensional scaling plot based on the Bray-Curtis similarity of microbial communities obtained using DNeasy (black triangles) and PowerSoil (gray circles) kits. Circles encompass samples clustering at > 30% similarity and correspond to replicates of Clavelina oblonga (dashed line) and Polyandrocarpa anguinea (solid line), indicating a high degree of host-specificity and low technical variation across DNA extraction methods.

    Techniques Used: DNA Extraction

    18) Product Images from "Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization"

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.4843

    DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)
    Figure Legend Snippet: DNA yield from seven extraction protocols (DNeasy: Qiagen DNeasy Blood Tissue Kit; MO BIO PW: MO BIO PowerWater DNA Isolation Kit; MO BIO PMS: MO BIO PowerMax Soil DNA Isolation Kit; Dnature: Presto™ Mini gDNA Bacteria Kit; PCI: phenol‐chloroform‐isoamyl extraction procedure; Silica: Silica extraction procedure; and Magnetic beads: Magnetic beads extraction procedure) obtained from 1,000 ml technical replicates filtered through 1.2‐µm cellulose‐nitrate filters. Error bars show 95% confidence intervals. Letters indicate significant differences among groups based on Tukey–Kramer's test (α = 0.05)

    Techniques Used: DNA Extraction, Magnetic Beads

    The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p
    Figure Legend Snippet: The average (a) OTU and (b) taxon richness obtained per replicate for each of the four assays between the optimal (blue; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) and low‐performance (gold; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) protocol. Error bars show 95% confidence intervals. T test significance is depicted by: *** p

    Techniques Used:

    Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay
    Figure Legend Snippet: Observed taxa in each of the four assays. Filled and unfilled rectangles indicate taxon presence or absence. Taxa show a pair of rectangles per assay, representing the low‐performance (PCPMS; 1.2‐µm polycarbonate filter and MO BIO's PowerMax Soil) and the optimal (CNQ; 1.2‐µm cellulose‐nitrate filter and Qiagen's DNeasy Blood Tissue Kit) treatment. Rectangular presence indicates the amplification range of each assay

    Techniques Used: Amplification

    19) Product Images from "Conventional and PCR Detection of Aphelenchoides fragariae in Diverse Ornamental Host Plant Species"

    Article Title: Conventional and PCR Detection of Aphelenchoides fragariae in Diverse Ornamental Host Plant Species

    Journal:

    doi:

    Comparison of DNA extraction methods for detection of Aphelenchoides fragariae in naturally infected Asplenium nidus (Bird's nest fern) plant tissue using species-specific PCR primers. Lane 1: healthy A. nidus extracted with Qiagen Dneasy Plant Mini Kit;
    Figure Legend Snippet: Comparison of DNA extraction methods for detection of Aphelenchoides fragariae in naturally infected Asplenium nidus (Bird's nest fern) plant tissue using species-specific PCR primers. Lane 1: healthy A. nidus extracted with Qiagen Dneasy Plant Mini Kit;

    Techniques Used: DNA Extraction, Infection, Polymerase Chain Reaction

    20) Product Images from "A Novel Molecular Test to Diagnose Canine Visceral Leishmaniasis at the Point of Care"

    Article Title: A Novel Molecular Test to Diagnose Canine Visceral Leishmaniasis at the Point of Care

    Journal:

    doi: 10.4269/ajtmh.15-0145

    Sensitivity of recombinase polymerase amplification–lateral flow (RPA-LF) to detect Leishmania infantum compared with real-time polymerase chain reaction (PCR) used as gold standard. Tenfold serial dilutions of L. infantum promastigotes in dog blood were extracted using Qiagen® DNeasy blood and tissue kit and detected by real-time quantitative PCR (SYBRgreen) or RPA-LF. Parasite dilutions: 1 = 105 , 2 = 104 , 3 = 103 , 4 = 102 , 5 = 10, 6 = 1, and 7 = 0.1 parasites and Bl = uninfected dog blood. The top band is the control band; the lower band is the test band. This is a representative figure of two similar assays.
    Figure Legend Snippet: Sensitivity of recombinase polymerase amplification–lateral flow (RPA-LF) to detect Leishmania infantum compared with real-time polymerase chain reaction (PCR) used as gold standard. Tenfold serial dilutions of L. infantum promastigotes in dog blood were extracted using Qiagen® DNeasy blood and tissue kit and detected by real-time quantitative PCR (SYBRgreen) or RPA-LF. Parasite dilutions: 1 = 105 , 2 = 104 , 3 = 103 , 4 = 102 , 5 = 10, 6 = 1, and 7 = 0.1 parasites and Bl = uninfected dog blood. The top band is the control band; the lower band is the test band. This is a representative figure of two similar assays.

    Techniques Used: Recombinase Polymerase Amplification, Flow Cytometry, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Related Articles

    Methylation Sequencing:

    Article Title: Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands
    Article Snippet: SVs called by CREST are incorporated to improve genome segmentation. .. Whole genome bisulfite sequencing DNA from AciCC tumors were isolated from fresh-frozen tissue using DNeasy Tissue kits and from blood of the same patients using the DNeasy Blood Kit (all Qiagen, Hilden, Germany). .. DNA-quality and quantity were assessed using a 2200 TapeStation (Agilent, Waldbronn, Germany).

    Clone Assay:

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites). .. The TuaDV inoculated to plant leaves was assessed by PCR, as described above, while viral loads in mites and leaves was achieved by qPCR with a reaction mixture containing 15–20 ng and 100 ng of mites or plant DNA, respectively, and a pair of TuaDV specific primers (1125F and 1230R, ) using the Sensifast PCR kit (Bioline, UK). qPCR was run on a Roche LC480 cycler (qPHD facility, Univ Montpellier) using the following conditions: 95 °C for 2 min, 25 cycles of 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 50 sec, and then 72 °C for 5 min, which resulted in a 78 bp amplicon from ORF2 (NS).

    Article Title: Assessment of the Diversity of Fungal Community Composition Associated With Vachellia pachyceras and Its Rhizosphere Soil From Kuwait Desert
    Article Snippet: DNA extractions were performed using the Plant DNeasy kits (Qiagen, ON) from roots stored in CTAB. .. The expected 750–800 bp PCR fragment was obtained with the nested PCR with LR1-FLR 4.

    Amplification:

    Article Title: Phylogeography of Bellamya (Mollusca: Gastropoda: Viviparidae) snails on different continents: contrasting patterns of diversification in China and East Africa
    Article Snippet: Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China). .. Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China).

    Expressing:

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Paragraph title: Allelic expression imbalance (AEI) ... Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions.

    Construct:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: HCT116-19 test samples were electroporated at a concentration of 5 x 105 cells/100ul in 4mm gap cuvette (BioExpress, Kaysville, UT) with 2ug of CRISPR/Cas9 constructs 2C and 3C as well as 2ug 2C + 1.35ug 72NT PM and 2ug 3C + 1.35ug 72NT PM. .. DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    Real-time Polymerase Chain Reaction:

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Paragraph title: Quantitative PCR for viral cDNA ... Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen).

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions. .. Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions.

    Incubation:

    Article Title: Genetic variability of the Aedes aegypti (Diptera: Culicidae) mosquito in El Salvador, vector of dengue, yellow fever, chikungunya and Zika
    Article Snippet: Adult females were used for DNA extraction, with at least 30 adult females individually extracted from each of the six regions. .. DNA extraction was completed with the Qiagen DNEasy® Blood and Tissue Extraction Kit (Qiagen, Venlo, Netherlands) following standard protocols [ ], using an overnight incubation of the samples at 65 °C. .. The quantity of DNA in each sample was measured using the Qubit 2.0 fluorimeter Hs DNA kit (ThermoFisher, Waltham, MA, USA) and averaged 50 ng/μl.

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed. .. Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Enhanced astrocyte responses are driven by a genetic risk allele associated with multiple sclerosis
    Article Snippet: Since most cases from the PI’s MS tissue bank came to autopsy in the 1980s/1990s, prior to the era of effective MS therapies, the majority of patients did not receive standard disease-modifying treatments. .. CNS tissue was genotyped by isolating DNA using the DNeasy Blood and Tissue Kit and QIAamp DNA FFPE Tissue Kit (both Qiagen). .. Pre-amplification of DNA and genotyping for rs7665090 was performed with the TaqMan PreAmp Master Mix Kit and a TaqMan genotyping assay (Applied Biosystems).

    Activity Assay:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: Paragraph title: RFLP Analysis of CRISPR/Cas9 Cleavage Activity ... DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    Mass Spectrometry:

    Article Title: Enhanced astrocyte responses are driven by a genetic risk allele associated with multiple sclerosis
    Article Snippet: Since most cases from the PI’s MS tissue bank came to autopsy in the 1980s/1990s, prior to the era of effective MS therapies, the majority of patients did not receive standard disease-modifying treatments. .. CNS tissue was genotyped by isolating DNA using the DNeasy Blood and Tissue Kit and QIAamp DNA FFPE Tissue Kit (both Qiagen).

    Modification:

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization
    Article Snippet: Factoring in the cost per sample, one might prefer the modified phenol–chloroform extraction method (Renshaw et al., ), which retained the second‐highest DNA yield and significantly outperformed the remaining extraction methods. .. However, the necessity of a fume hood for phenol–chloroform extractions and the development of automated sample preparation (QIAcube) to enable high‐volume sample processing might increase the suitability of Qiagen's DNeasy Blood & Tissue Kit in processing eDNA samples in certain cases (Table ).

    Article Title: Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes
    Article Snippet: We followed a modified procedure of the AFLP technique . .. Digestion and ligation were performed simultaneously for two hours at 37°C in 25 µl 1×T4 ligase buffer containing 1.2 units of both Mse I and Eco RI (NEB, Ipswich, MA, USA), 0.612 µM Mse-adapter ( 5′-GACGATGAGTCCTGAG-3′ + 5′-TACTCAGGACTCAT-3′ ), 0.068 µM Eco-adapter ( 5′-CTCGTAGACTGCGTACC-3′ + 5-AATTGGTACGCAGTCTAC-3′ ), 0.6 Weiss units T4 Ligase, 2.5 µg BSA and 5 µl DNA extract from the 2nd Qiagen DNeasy tissue kit elution (corresponding to approximately 125 ng DNA).

    Countercurrent Chromatography:

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen).

    Ligation:

    Article Title: Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes
    Article Snippet: We followed a modified procedure of the AFLP technique . .. Digestion and ligation were performed simultaneously for two hours at 37°C in 25 µl 1×T4 ligase buffer containing 1.2 units of both Mse I and Eco RI (NEB, Ipswich, MA, USA), 0.612 µM Mse-adapter ( 5′-GACGATGAGTCCTGAG-3′ + 5′-TACTCAGGACTCAT-3′ ), 0.068 µM Eco-adapter ( 5′-CTCGTAGACTGCGTACC-3′ + 5-AATTGGTACGCAGTCTAC-3′ ), 0.6 Weiss units T4 Ligase, 2.5 µg BSA and 5 µl DNA extract from the 2nd Qiagen DNeasy tissue kit elution (corresponding to approximately 125 ng DNA). .. Preamplification was performed in 15 µl 1×AFLP Amplification Core Mix Module (Applied Biosystems, Foster City, CA, USA) supplied with 0.12 µM Eco+A primer ( 5′-GACTGCGTACCAATTCA-3′ ), 0.92 µM Mse+C primer ( 5′-GATGAGTCCTGAGTAAC-3′ ), and 2 µl undiluted restriction-ligation product as template.

    Serial Dilution:

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites). .. The TuaDV inoculated to plant leaves was assessed by PCR, as described above, while viral loads in mites and leaves was achieved by qPCR with a reaction mixture containing 15–20 ng and 100 ng of mites or plant DNA, respectively, and a pair of TuaDV specific primers (1125F and 1230R, ) using the Sensifast PCR kit (Bioline, UK). qPCR was run on a Roche LC480 cycler (qPHD facility, Univ Montpellier) using the following conditions: 95 °C for 2 min, 25 cycles of 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 50 sec, and then 72 °C for 5 min, which resulted in a 78 bp amplicon from ORF2 (NS).

    SNP Genotyping Assay:

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions. .. The PCR cycling conditions were as follows: an initial denaturation at 95 °C for 10 min, followed by 50 cycles of 95 °C for 10 sec and 60 °C for 45 sec. AEI was determined using the TaqMan SNP genotyping probe for rs2820312 ( ) and expressed as the normalized allelic ratio of cDNA/gDNA.

    Infection:

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Five days later, the mites were carefully removed from the infected leaf (named L0) and two uninfected leaves from the same plant, one ~8 cm and the other ~20 cm away from the infected leaf, were collected (named L8 and L20, respectively). .. Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites).

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Primer pairs were: Actin (GGACTTCGAGCAAGAGATGG, GGACTTCGAGCAAGAGATGG), RRM2 (CAAGCGATGGCATAGTAA, TGTAAGTGTCAATAAGAAGACT), SNAT2 (AAGACCGCAGCCGTAGAAG, CAGCCATTAACACAGCCAGAC), LAT1 (GTGCCGTCCCTCGTGTTC, GCAGAGCCAGTTGAAGAAGC), PLD1 (TGTCGTGATACCACTTCTGCCA, AGCATTTCGAGCTGCTGTTGAA), c-Myc (TCCAGCTTGTACCTGCAGGATCTGA, CCTCCAGCAGAAGGTGATCCAGACT), ASCT2 (ATCGTGGAGATGGAGGA, AAGAGGTCCCAAAGGCAG), SNAT1 (GGCAGTGGGATTTTGGGACT, TGACCAAGGAGAACAACACCC). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Real time PCR was performed using iQSYBR Green (Bio-Rad) detection (Bio Rad CFX96).

    Article Title: Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM
    Article Snippet: Tissue samples for DNA extraction were collected from F2 plants at the 3 – 4 leaf stage after scoring infection types and removing infected leaves. .. High quality DNA was extracted from the freeze dried leaf tissues using the DNeasy Plant DNA extraction kit (Qiagen, Toronto, Canada).

    Generated:

    Article Title: Population history provides foundational knowledge for utilizing and developing native plant restoration materials. Population history provides foundational knowledge for utilizing and developing native plant restoration materials
    Article Snippet: Approximately 15 mg of leaf tissue was ground using a bead mill, and DNA was extracted following the DNeasy plant extraction kit protocol (Qiagen, Germantown, MD, USA). .. Approximately 15 mg of leaf tissue was ground using a bead mill, and DNA was extracted following the DNeasy plant extraction kit protocol (Qiagen, Germantown, MD, USA).

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization
    Article Snippet: Overall, Qiagen's DNeasy Blood & Tissue Kit generated the highest DNA yield. .. However, the necessity of a fume hood for phenol–chloroform extractions and the development of automated sample preparation (QIAcube) to enable high‐volume sample processing might increase the suitability of Qiagen's DNeasy Blood & Tissue Kit in processing eDNA samples in certain cases (Table ).

    DNA Sequencing:

    Article Title: Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands
    Article Snippet: Whole genome bisulfite sequencing DNA from AciCC tumors were isolated from fresh-frozen tissue using DNeasy Tissue kits and from blood of the same patients using the DNeasy Blood Kit (all Qiagen, Hilden, Germany). .. Whole genome bisulfite sequencing DNA from AciCC tumors were isolated from fresh-frozen tissue using DNeasy Tissue kits and from blood of the same patients using the DNeasy Blood Kit (all Qiagen, Hilden, Germany).

    Transmission Assay:

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Paragraph title: 2.6. Densovirus Presence and Transmission ... Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites).

    Sequencing:

    Article Title: Phylogeography of Bellamya (Mollusca: Gastropoda: Viviparidae) snails on different continents: contrasting patterns of diversification in China and East Africa
    Article Snippet: Paragraph title: DNA extraction, sequencing and molecular analyses ... Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China).

    Article Title: Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands
    Article Snippet: Whole genome bisulfite sequencing DNA from AciCC tumors were isolated from fresh-frozen tissue using DNeasy Tissue kits and from blood of the same patients using the DNeasy Blood Kit (all Qiagen, Hilden, Germany). .. DNA sequencing libraries were prepared using the Accel-NGS® Methyl-Seq DNA Library Kit (Swift Biosciences, Ann Arbor, MI, USA) following the manufacturer’s instructions.

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen).

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Allelic expression imbalance (AEI) Genomic DNA and RNA were prepared from individual HCASMC donor lots determined to be either heterozygous or homozygous genotypes at proxy SNP rs2820312 (determined by whole genome sequencing). .. Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions.

    Article Title: Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes
    Article Snippet: Digestion and ligation were performed simultaneously for two hours at 37°C in 25 µl 1×T4 ligase buffer containing 1.2 units of both Mse I and Eco RI (NEB, Ipswich, MA, USA), 0.612 µM Mse-adapter ( 5′-GACGATGAGTCCTGAG-3′ + 5′-TACTCAGGACTCAT-3′ ), 0.068 µM Eco-adapter ( 5′-CTCGTAGACTGCGTACC-3′ + 5-AATTGGTACGCAGTCTAC-3′ ), 0.6 Weiss units T4 Ligase, 2.5 µg BSA and 5 µl DNA extract from the 2nd Qiagen DNeasy tissue kit elution (corresponding to approximately 125 ng DNA). .. Selective amplifications with 33 different primer combinations were processed in 10 µl 1×Core Mix with 0.05 µM fluorescently labeled Eco+ANN primer, 0.25 µM Mse+CNN primer and 1 µl 10×diluted preamplified product as template.

    Article Title: Long-term balancing selection drives evolution of immunity genes in Capsella
    Article Snippet: See for a listing of DNA preparation, library construction, and sequencing technology by sample. .. In brief, DNA was extracted following an abbreviated nuclei enrichment protocol ( ) or using the Qiagen Plant DNeasy Extraction kit.

    Cellular Antioxidant Activity Assay:

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen).

    DNA Extraction:

    Article Title: Population history provides foundational knowledge for utilizing and developing native plant restoration materials. Population history provides foundational knowledge for utilizing and developing native plant restoration materials
    Article Snippet: Paragraph title: Field sampling and DNA extraction ... Approximately 15 mg of leaf tissue was ground using a bead mill, and DNA was extracted following the DNeasy plant extraction kit protocol (Qiagen, Germantown, MD, USA).

    Article Title: The Quality of DNA Isolated from Processed Food and Feed via Different Extraction Procedures
    Article Snippet: Some of these were designed for the extraction of DNA even from highly processed food products, including canned products and other complex food and feed matrices. .. Seven commercial kits (DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), DNeasy mericon Food kit (Qiagen, Hilden, Germany), Food DNA Isolation Kit (Norgen Biotek, Thorold, ON, Canada), UltraPrep Genomic DNA Food Mini Prep kit (AHN-Bio, Nordhausen, Germany), High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) and NucleoSpin Food (Machery-Nagel, Düren, Germany), chemagic DNA Tissue 10 kit (PerkinElmer, MA, USA), and one in-house extraction method (phenol-chloroform extraction) were used. .. The extraction procedures were performed according to the protocols supplied by the manufacturers or, in the case of the in-house extraction method, according to the validated laboratory protocol.

    Article Title: Mitochondrial Dysfunction and Adipogenic Reduction by Prohibitin Silencing in 3T3-L1 Cells
    Article Snippet: To obtain a more purified fraction of mitochondria with more than 50% reduction of lysosomal and peroxisomal contaminants, the last step for pelleting mitochondria was performed using centrifugation for 15 minutes at 3,000× g rather than at standard 12,000× g . .. Total DNA in 3T3-L1 cells was isolated with the DNeasy DNA isolation kit (Qiagen). .. The DNA levels of mitochondrial Complex I and nuclear 18S rRNA were determined by real-time PCR quantification.

    Article Title: Phylogeography of Bellamya (Mollusca: Gastropoda: Viviparidae) snails on different continents: contrasting patterns of diversification in China and East Africa
    Article Snippet: Paragraph title: DNA extraction, sequencing and molecular analyses ... Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China).

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization
    Article Snippet: A DNA extraction method should ideally retain high DNA yields while successfully removing PCR inhibitors. .. However, the necessity of a fume hood for phenol–chloroform extractions and the development of automated sample preparation (QIAcube) to enable high‐volume sample processing might increase the suitability of Qiagen's DNeasy Blood & Tissue Kit in processing eDNA samples in certain cases (Table ).

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Primer pairs were: Actin (GGACTTCGAGCAAGAGATGG, GGACTTCGAGCAAGAGATGG), RRM2 (CAAGCGATGGCATAGTAA, TGTAAGTGTCAATAAGAAGACT), SNAT2 (AAGACCGCAGCCGTAGAAG, CAGCCATTAACACAGCCAGAC), LAT1 (GTGCCGTCCCTCGTGTTC, GCAGAGCCAGTTGAAGAAGC), PLD1 (TGTCGTGATACCACTTCTGCCA, AGCATTTCGAGCTGCTGTTGAA), c-Myc (TCCAGCTTGTACCTGCAGGATCTGA, CCTCCAGCAGAAGGTGATCCAGACT), ASCT2 (ATCGTGGAGATGGAGGA, AAGAGGTCCCAAAGGCAG), SNAT1 (GGCAGTGGGATTTTGGGACT, TGACCAAGGAGAACAACACCC). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Real time PCR was performed using iQSYBR Green (Bio-Rad) detection (Bio Rad CFX96).

    Article Title: The effectiveness of colostral antibodies for preventing bovine leukemia virus (BLV) infection in vitro
    Article Snippet: PBL was isolated from 5 ml EDTA-treated blood according to the method previously described by Asfaw et al. [ ]. .. DNA was extracted from SCs and PBL using a commercial DNA extraction kit (DNeasy Blood & Tissue Kit; Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. To detect and quantify BLV proviral DNA, real-time PCR was performed using a TaqMan probe.

    Article Title: Genetic variability of the Aedes aegypti (Diptera: Culicidae) mosquito in El Salvador, vector of dengue, yellow fever, chikungunya and Zika
    Article Snippet: Adult females were used for DNA extraction, with at least 30 adult females individually extracted from each of the six regions. .. DNA extraction was completed with the Qiagen DNEasy® Blood and Tissue Extraction Kit (Qiagen, Venlo, Netherlands) following standard protocols [ ], using an overnight incubation of the samples at 65 °C. .. The quantity of DNA in each sample was measured using the Qubit 2.0 fluorimeter Hs DNA kit (ThermoFisher, Waltham, MA, USA) and averaged 50 ng/μl.

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Paragraph title: DNA Extraction and PCR ... Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed.

    Article Title: Long-term balancing selection drives evolution of immunity genes in Capsella
    Article Snippet: Paragraph title: Plant material and DNA extraction ... In brief, DNA was extracted following an abbreviated nuclei enrichment protocol ( ) or using the Qiagen Plant DNeasy Extraction kit.

    Article Title: Foliar-feeding insects acquire microbiomes from the soil rather than the host plant
    Article Snippet: For root, leaf and caterpillar samples, bead beating and DNA extraction were performed with the MP Biomedical FastDNA™ Spin Kit. .. For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit.

    Article Title: Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM
    Article Snippet: The youngest leaf (the uppermost 3rd or 4th leaf) tissues were collected in tubes, lyophilized (approximately 10 grams dry weight) and stored at -80° until used. .. High quality DNA was extracted from the freeze dried leaf tissues using the DNeasy Plant DNA extraction kit (Qiagen, Toronto, Canada). .. DNA was quantified using the blue fluorescent dye Hoechst 33258 and read using a Tecan Infinite F500 (Tecan Group Ltd. Männedorf, Switzerland).

    RNA Sequencing Assay:

    Article Title: Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non–small cell lung cancer
    Article Snippet: Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively. .. Following mRNA purification, the RNA is chemically fragmented before reverse transcription and cDNA generation.

    Magnetic Beads:

    Article Title: Foliar-feeding insects acquire microbiomes from the soil rather than the host plant
    Article Snippet: For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit. .. For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit.

    Isolation:

    Article Title: The Quality of DNA Isolated from Processed Food and Feed via Different Extraction Procedures
    Article Snippet: DNA was isolated in duplicate using eight extraction protocols. .. Seven commercial kits (DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), DNeasy mericon Food kit (Qiagen, Hilden, Germany), Food DNA Isolation Kit (Norgen Biotek, Thorold, ON, Canada), UltraPrep Genomic DNA Food Mini Prep kit (AHN-Bio, Nordhausen, Germany), High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) and NucleoSpin Food (Machery-Nagel, Düren, Germany), chemagic DNA Tissue 10 kit (PerkinElmer, MA, USA), and one in-house extraction method (phenol-chloroform extraction) were used.

    Article Title: Mitochondrial Dysfunction and Adipogenic Reduction by Prohibitin Silencing in 3T3-L1 Cells
    Article Snippet: To obtain a more purified fraction of mitochondria with more than 50% reduction of lysosomal and peroxisomal contaminants, the last step for pelleting mitochondria was performed using centrifugation for 15 minutes at 3,000× g rather than at standard 12,000× g . .. Total DNA in 3T3-L1 cells was isolated with the DNeasy DNA isolation kit (Qiagen). .. The DNA levels of mitochondrial Complex I and nuclear 18S rRNA were determined by real-time PCR quantification.

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: Cells were then recovered in 6-well plates with complete growth media at 37°C for 72 hours. .. DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. RFLP analysis was performed on 181bp amplicons that were created using forward primer, 5’GAGGGCGATGCCACCTACGGC and reverse primer, 5’GGACGTAGCCTTCGGGCATGGC.

    Article Title: Phylogeography of Bellamya (Mollusca: Gastropoda: Viviparidae) snails on different continents: contrasting patterns of diversification in China and East Africa
    Article Snippet: The stubs were then coated with gold and observed using a scanning electron microscope (AMRAY-1000B). .. Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China). .. DNA was subsequently quantified with a spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific, America).

    Article Title: Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands
    Article Snippet: SVs called by CREST are incorporated to improve genome segmentation. .. Whole genome bisulfite sequencing DNA from AciCC tumors were isolated from fresh-frozen tissue using DNeasy Tissue kits and from blood of the same patients using the DNeasy Blood Kit (all Qiagen, Hilden, Germany). .. DNA-quality and quantity were assessed using a 2200 TapeStation (Agilent, Waldbronn, Germany).

    Article Title: Phospholipase D1 Couples CD4+ T Cell Activation to c-Myc-Dependent Deoxyribonucleotide Pool Expansion and HIV-1 Replication
    Article Snippet: Primer pairs were: Actin (GGACTTCGAGCAAGAGATGG, GGACTTCGAGCAAGAGATGG), RRM2 (CAAGCGATGGCATAGTAA, TGTAAGTGTCAATAAGAAGACT), SNAT2 (AAGACCGCAGCCGTAGAAG, CAGCCATTAACACAGCCAGAC), LAT1 (GTGCCGTCCCTCGTGTTC, GCAGAGCCAGTTGAAGAAGC), PLD1 (TGTCGTGATACCACTTCTGCCA, AGCATTTCGAGCTGCTGTTGAA), c-Myc (TCCAGCTTGTACCTGCAGGATCTGA, CCTCCAGCAGAAGGTGATCCAGACT), ASCT2 (ATCGTGGAGATGGAGGA, AAGAGGTCCCAAAGGCAG), SNAT1 (GGCAGTGGGATTTTGGGACT, TGACCAAGGAGAACAACACCC). .. Total cellular DNA was isolated from HIV-1 infected cells (DNeasy DNA isolation kit, Qiagen). .. Real time PCR was performed using iQSYBR Green (Bio-Rad) detection (Bio Rad CFX96).

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Allelic expression imbalance (AEI) Genomic DNA and RNA were prepared from individual HCASMC donor lots determined to be either heterozygous or homozygous genotypes at proxy SNP rs2820312 (determined by whole genome sequencing). .. Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions. .. Total cDNA was prepared from 1 μg RNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems).

    Size-exclusion Chromatography:

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions. .. Each qPCR reaction contained 20ng Genomic DNA or 20ng cDNA, 40x rs2820312 TaqMan SNP genotyping probe (Applied Biosystems), and 2x Universal Master Mix (Applied Biosystems).

    Labeling:

    Article Title: Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes
    Article Snippet: Digestion and ligation were performed simultaneously for two hours at 37°C in 25 µl 1×T4 ligase buffer containing 1.2 units of both Mse I and Eco RI (NEB, Ipswich, MA, USA), 0.612 µM Mse-adapter ( 5′-GACGATGAGTCCTGAG-3′ + 5′-TACTCAGGACTCAT-3′ ), 0.068 µM Eco-adapter ( 5′-CTCGTAGACTGCGTACC-3′ + 5-AATTGGTACGCAGTCTAC-3′ ), 0.6 Weiss units T4 Ligase, 2.5 µg BSA and 5 µl DNA extract from the 2nd Qiagen DNeasy tissue kit elution (corresponding to approximately 125 ng DNA). .. Preamplification PCR cycle was 120s 72°C, 120s 94°C, followed by 20 cycles of 10 s 94°C, 30 s 56°C, 120 s 72°C.

    Purification:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    Article Title: Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non–small cell lung cancer
    Article Snippet: Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively. .. Briefly, the kit converts the poly-A containing mRNA from total RNA (1,000 ng engaged in the process) into a cDNA library using poly-T oligo-attached magnetic bead selection.

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed. .. Samples were incubated in a 70°C water bath for 10 min. All samples were purified spin columns from a DNeasy Tissue Kit (Qiagen; following ).

    Article Title: Foliar-feeding insects acquire microbiomes from the soil rather than the host plant
    Article Snippet: For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit. .. For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit.

    Polymerase Chain Reaction:

    Article Title: The Quality of DNA Isolated from Processed Food and Feed via Different Extraction Procedures
    Article Snippet: Some of these were designed for the extraction of DNA even from highly processed food products, including canned products and other complex food and feed matrices. .. Seven commercial kits (DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), DNeasy mericon Food kit (Qiagen, Hilden, Germany), Food DNA Isolation Kit (Norgen Biotek, Thorold, ON, Canada), UltraPrep Genomic DNA Food Mini Prep kit (AHN-Bio, Nordhausen, Germany), High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) and NucleoSpin Food (Machery-Nagel, Düren, Germany), chemagic DNA Tissue 10 kit (PerkinElmer, MA, USA), and one in-house extraction method (phenol-chloroform extraction) were used. .. The extraction procedures were performed according to the protocols supplied by the manufacturers or, in the case of the in-house extraction method, according to the validated laboratory protocol.

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites). .. The TuaDV inoculated to plant leaves was assessed by PCR, as described above, while viral loads in mites and leaves was achieved by qPCR with a reaction mixture containing 15–20 ng and 100 ng of mites or plant DNA, respectively, and a pair of TuaDV specific primers (1125F and 1230R, ) using the Sensifast PCR kit (Bioline, UK). qPCR was run on a Roche LC480 cycler (qPHD facility, Univ Montpellier) using the following conditions: 95 °C for 2 min, 25 cycles of 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 50 sec, and then 72 °C for 5 min, which resulted in a 78 bp amplicon from ORF2 (NS).

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    Article Title: Phylogeography of Bellamya (Mollusca: Gastropoda: Viviparidae) snails on different continents: contrasting patterns of diversification in China and East Africa
    Article Snippet: Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China). .. Total genomic DNA was isolated from foot muscle tissue using the DNeasy kit following the manufacturer’s protocol (QIAGEN DNeasy® Blood and Tissue Kit, Shanghai, China).

    Article Title: Functional regulatory mechanism of smooth muscle cell-restricted LMOD1 coronary artery disease locus
    Article Snippet: Genomic DNA and total RNA were isolated using the Qiagen DNeasy Blood and Tissue kit and the Qiagen miRNeasy Mini kit, respectively, according to the manufacturer’s instructions. .. Each qPCR reaction contained 20ng Genomic DNA or 20ng cDNA, 40x rs2820312 TaqMan SNP genotyping probe (Applied Biosystems), and 2x Universal Master Mix (Applied Biosystems).

    Article Title: Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes
    Article Snippet: Digestion and ligation were performed simultaneously for two hours at 37°C in 25 µl 1×T4 ligase buffer containing 1.2 units of both Mse I and Eco RI (NEB, Ipswich, MA, USA), 0.612 µM Mse-adapter ( 5′-GACGATGAGTCCTGAG-3′ + 5′-TACTCAGGACTCAT-3′ ), 0.068 µM Eco-adapter ( 5′-CTCGTAGACTGCGTACC-3′ + 5-AATTGGTACGCAGTCTAC-3′ ), 0.6 Weiss units T4 Ligase, 2.5 µg BSA and 5 µl DNA extract from the 2nd Qiagen DNeasy tissue kit elution (corresponding to approximately 125 ng DNA). .. Preamplification was performed in 15 µl 1×AFLP Amplification Core Mix Module (Applied Biosystems, Foster City, CA, USA) supplied with 0.12 µM Eco+A primer ( 5′-GACTGCGTACCAATTCA-3′ ), 0.92 µM Mse+C primer ( 5′-GATGAGTCCTGAGTAAC-3′ ), and 2 µl undiluted restriction-ligation product as template.

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Paragraph title: DNA Extraction and PCR ... Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed.

    Article Title: Foliar-feeding insects acquire microbiomes from the soil rather than the host plant
    Article Snippet: For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit. .. For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit.

    Article Title: Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM
    Article Snippet: High quality DNA was extracted from the freeze dried leaf tissues using the DNeasy Plant DNA extraction kit (Qiagen, Toronto, Canada). .. High quality DNA was extracted from the freeze dried leaf tissues using the DNeasy Plant DNA extraction kit (Qiagen, Toronto, Canada).

    CRISPR:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: Paragraph title: RFLP Analysis of CRISPR/Cas9 Cleavage Activity ... DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    cDNA Library Assay:

    Article Title: Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non–small cell lung cancer
    Article Snippet: Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively. .. Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively.

    Agarose Gel Electrophoresis:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. PCR samples were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with the AvrII restriction enzyme following the manufactures protocol.

    Article Title: Foliar-feeding insects acquire microbiomes from the soil rather than the host plant
    Article Snippet: For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit. .. For the soil samples, DNA was extracted using Qiagen DNeasy PowerSoil Kit.

    Software:

    Article Title: A New Prevalent Densovirus Discovered in Acari. Insight from Metagenomics in Viral Communities Associated with Two-Spotted Mite (Tetranychus urticae) Populations
    Article Snippet: Total DNA was extracted from infested plants and negative controls using DNeasy blood and tissue kit (Qiagen) and recovered in 100 µL (40–60 ng/µL for leaves) and 25 µL (15–25 ng/µL for mites). .. As the viral genome of TuaDV remains to be cloned, PCR Standardization was achieved with a standard curve that was made with the serial dilution of DNA of the Junonia coenia ambidensovirus (JcDV) as a proxy.

    Selection:

    Article Title: Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non–small cell lung cancer
    Article Snippet: Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively. .. Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively.

    Sample Prep:

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization
    Article Snippet: Factoring in the cost per sample, one might prefer the modified phenol–chloroform extraction method (Renshaw et al., ), which retained the second‐highest DNA yield and significantly outperformed the remaining extraction methods. .. However, the necessity of a fume hood for phenol–chloroform extractions and the development of automated sample preparation (QIAcube) to enable high‐volume sample processing might increase the suitability of Qiagen's DNeasy Blood & Tissue Kit in processing eDNA samples in certain cases (Table ). .. 4.3 Optimizing the capture and extraction step in our marine eDNA protocol resulted in a ninefold difference in total DNA yield compared to the poorest performing methods.

    Next-Generation Sequencing:

    Article Title: Secreted PD-L1 variants mediate resistance to PD-L1 blockade therapy in non–small cell lung cancer
    Article Snippet: Paragraph title: Next generation sequencing ... Genomic DNA and total RNA were extracted with a DNeasy Blood and Tissue Kit and RNeasy Mini Kit (Qiagen), respectively.

    Spectrophotometry:

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed. .. Samples were incubated in a 70°C water bath for 10 min. All samples were purified spin columns from a DNeasy Tissue Kit (Qiagen; following ).

    Sampling:

    Article Title: Population history provides foundational knowledge for utilizing and developing native plant restoration materials. Population history provides foundational knowledge for utilizing and developing native plant restoration materials
    Article Snippet: Paragraph title: Field sampling and DNA extraction ... Approximately 15 mg of leaf tissue was ground using a bead mill, and DNA was extracted following the DNeasy plant extraction kit protocol (Qiagen, Germantown, MD, USA).

    Produced:

    Article Title: Assessment of the Diversity of Fungal Community Composition Associated With Vachellia pachyceras and Its Rhizosphere Soil From Kuwait Desert
    Article Snippet: DNA extractions were performed using the Plant DNeasy kits (Qiagen, ON) from roots stored in CTAB. .. The expected 750–800 bp PCR fragment was obtained with the nested PCR with LR1-FLR 4.

    Concentration Assay:

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: HCT116-19 test samples were electroporated at a concentration of 5 x 105 cells/100ul in 4mm gap cuvette (BioExpress, Kaysville, UT) with 2ug of CRISPR/Cas9 constructs 2C and 3C as well as 2ug 2C + 1.35ug 72NT PM and 2ug 3C + 1.35ug 72NT PM. .. DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany).

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: The reaction mixture had a total volume of 200 µl and included the following final concentration: 20 mM Tris, 2 mM EDTA (pH 8.0), 1.2% NP-40 detergent, 20 mg ml−1 lysozyme, and 0.2 µm filtered sterile water (Sigma Chemical Co., St. Louis, MO). .. Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed.

    Cell Counting:

    Article Title: Office Space Bacterial Abundance and Diversity in Three Metropolitan Areas
    Article Snippet: Next, Proteinase K (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) and AL Buffer (DNeasy Tissue Kit, Qiagen Corporation, Valencia, CA) were added to the tubes and gently mixed. .. After purification, the DNA was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Willmington, DE).

    Marker:

    Article Title: Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM
    Article Snippet: Paragraph title: DNA extraction and marker development ... High quality DNA was extracted from the freeze dried leaf tissues using the DNeasy Plant DNA extraction kit (Qiagen, Toronto, Canada).

    Staining:

    Article Title: Population history provides foundational knowledge for utilizing and developing native plant restoration materials. Population history provides foundational knowledge for utilizing and developing native plant restoration materials
    Article Snippet: Approximately 15 mg of leaf tissue was ground using a bead mill, and DNA was extracted following the DNeasy plant extraction kit protocol (Qiagen, Germantown, MD, USA). .. Genome size and ploidy were determined for wildland‐collected individuals using a Partec Cyflow Space flow cytometer under UV fluorescence with an Atriplex canescens (Pursh) Nutt. internal standard.

    Article Title: Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems
    Article Snippet: DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis.

    Hood:

    Article Title: Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization, et al. Species‐level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization
    Article Snippet: Factoring in the cost per sample, one might prefer the modified phenol–chloroform extraction method (Renshaw et al., ), which retained the second‐highest DNA yield and significantly outperformed the remaining extraction methods. .. However, the necessity of a fume hood for phenol–chloroform extractions and the development of automated sample preparation (QIAcube) to enable high‐volume sample processing might increase the suitability of Qiagen's DNeasy Blood & Tissue Kit in processing eDNA samples in certain cases (Table ). .. 4.3 Optimizing the capture and extraction step in our marine eDNA protocol resulted in a ninefold difference in total DNA yield compared to the poorest performing methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen dneasy blood
    Experimental design for Experiment 2A to investigate which <t>DNA</t> extraction kit-filter paper combination would give the best DNA yield. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas <t>DNeasy</t> and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.
    Dneasy Blood, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2793 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dneasy blood/product/Qiagen
    Average 99 stars, based on 2793 article reviews
    Price from $9.99 to $1999.99
    dneasy blood - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Qiagen fun025 mice
    Increased ROS and superoxide in <t>FUN025</t> and Tg-Tmem135 MFs. Representative flow cytometry data of ROS and superoxide levels in MFs derived from WT ( A , D , G ), FUN025 ( B , C , H ), and Tg-Tmem135 ( C , F , I ) mice. Panels A–C show unstained controls for each condition. WT MFs treated with pyocyanin were used as a positive control for ROS and superoxide detection ( D – F ). Both FUN025 ( H ) and Tg-Tmem135 ( I ) MFs showed increased levels of ROS and superoxide when compared with WT MFs ( G ). DOI: http://dx.doi.org/10.7554/eLife.19264.017
    Fun025 Mice, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fun025 mice/product/Qiagen
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fun025 mice - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Experimental design for Experiment 2A to investigate which DNA extraction kit-filter paper combination would give the best DNA yield. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Journal: PLoS ONE

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    doi: 10.1371/journal.pone.0179251

    Figure Lengend Snippet: Experimental design for Experiment 2A to investigate which DNA extraction kit-filter paper combination would give the best DNA yield. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Article Snippet: Four days after sample collection, DNA extraction was conducted on samples using either Qiagen’s DNeasy Blood and Tissue kit (Qiagen GmbH, Hilden, Germany) or PowerWater DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA).

    Techniques: DNA Extraction

    DNA yield from eight DNA extraction kit-filter paper combinations from samples in aquaria with UV-sterilized water. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. CN = Cellulose Nitrate, MCE = Mixed Cellulose Ester, PES = Polyethersulfone, PCTE = Polycarbonate track-etched. Error bars show the ±2 standard deviation of the mean.

    Journal: PLoS ONE

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    doi: 10.1371/journal.pone.0179251

    Figure Lengend Snippet: DNA yield from eight DNA extraction kit-filter paper combinations from samples in aquaria with UV-sterilized water. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. CN = Cellulose Nitrate, MCE = Mixed Cellulose Ester, PES = Polyethersulfone, PCTE = Polycarbonate track-etched. Error bars show the ±2 standard deviation of the mean.

    Article Snippet: Four days after sample collection, DNA extraction was conducted on samples using either Qiagen’s DNeasy Blood and Tissue kit (Qiagen GmbH, Hilden, Germany) or PowerWater DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA).

    Techniques: DNA Extraction, Standard Deviation

    Experimental design for Experiment 2B investigating DNA yields in five different DNA extraction kit-filter paper combination from stream water. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Journal: PLoS ONE

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    doi: 10.1371/journal.pone.0179251

    Figure Lengend Snippet: Experimental design for Experiment 2B investigating DNA yields in five different DNA extraction kit-filter paper combination from stream water. N refers to number of technical replicates. CN, MCE, PES, PCTE and GF refer to the types of filter papers whereas DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Article Snippet: Four days after sample collection, DNA extraction was conducted on samples using either Qiagen’s DNeasy Blood and Tissue kit (Qiagen GmbH, Hilden, Germany) or PowerWater DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA).

    Techniques: DNA Extraction

    Experimental design used to compare five different combinations of capture, preservation and DNA extraction methods. N is the number of technical replicates and each replicate represents one 250 ml water sample. DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Journal: PLoS ONE

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    doi: 10.1371/journal.pone.0179251

    Figure Lengend Snippet: Experimental design used to compare five different combinations of capture, preservation and DNA extraction methods. N is the number of technical replicates and each replicate represents one 250 ml water sample. DNeasy and PowerWater (PW) refer to the two DNA extraction kits used in the experiment.

    Article Snippet: Four days after sample collection, DNA extraction was conducted on samples using either Qiagen’s DNeasy Blood and Tissue kit (Qiagen GmbH, Hilden, Germany) or PowerWater DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA).

    Techniques: Preserving, DNA Extraction

    DNA yield from five different extraction kit-filter paper combinations from stream water samples. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. Error bars show the ±2 standard deviation of the mean.

    Journal: PLoS ONE

    Article Title: Methods to maximise recovery of environmental DNA from water samples

    doi: 10.1371/journal.pone.0179251

    Figure Lengend Snippet: DNA yield from five different extraction kit-filter paper combinations from stream water samples. Clear bars used DNeasy extraction kit while shaded grey bars used the PowerWater kit. Error bars show the ±2 standard deviation of the mean.

    Article Snippet: Four days after sample collection, DNA extraction was conducted on samples using either Qiagen’s DNeasy Blood and Tissue kit (Qiagen GmbH, Hilden, Germany) or PowerWater DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA).

    Techniques: Standard Deviation

    Increased ROS and superoxide in FUN025 and Tg-Tmem135 MFs. Representative flow cytometry data of ROS and superoxide levels in MFs derived from WT ( A , D , G ), FUN025 ( B , C , H ), and Tg-Tmem135 ( C , F , I ) mice. Panels A–C show unstained controls for each condition. WT MFs treated with pyocyanin were used as a positive control for ROS and superoxide detection ( D – F ). Both FUN025 ( H ) and Tg-Tmem135 ( I ) MFs showed increased levels of ROS and superoxide when compared with WT MFs ( G ). DOI: http://dx.doi.org/10.7554/eLife.19264.017

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Increased ROS and superoxide in FUN025 and Tg-Tmem135 MFs. Representative flow cytometry data of ROS and superoxide levels in MFs derived from WT ( A , D , G ), FUN025 ( B , C , H ), and Tg-Tmem135 ( C , F , I ) mice. Panels A–C show unstained controls for each condition. WT MFs treated with pyocyanin were used as a positive control for ROS and superoxide detection ( D – F ). Both FUN025 ( H ) and Tg-Tmem135 ( I ) MFs showed increased levels of ROS and superoxide when compared with WT MFs ( G ). DOI: http://dx.doi.org/10.7554/eLife.19264.017

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Flow Cytometry, Cytometry, Derivative Assay, Mouse Assay, Positive Control

    TMEM135 does not inhibit mitochondrial fusion. ( A ) WT and Tg-Tmem135 MFs were transfected with expression vectors encoding MFNs-YFP (green) at low and high levels and immunostained with TMEM135 antibody (red). Mitochondria were highlighted by MitoTracker (blue). Nuclei were labeled by DAPI (cyan). Scale bar = 10 μm. ( B ) Western blot analysis of OPA1, MFN1, and MFN2 in WT, FUN025 and Tg-TMEM135 (TG) fibroblasts. GAPDH was used as a loading control. ( C – E ) Quantification of western blotting results from ( B ). Protein levels were normalized using GAPDH expression levels. DOI: http://dx.doi.org/10.7554/eLife.19264.011

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: TMEM135 does not inhibit mitochondrial fusion. ( A ) WT and Tg-Tmem135 MFs were transfected with expression vectors encoding MFNs-YFP (green) at low and high levels and immunostained with TMEM135 antibody (red). Mitochondria were highlighted by MitoTracker (blue). Nuclei were labeled by DAPI (cyan). Scale bar = 10 μm. ( B ) Western blot analysis of OPA1, MFN1, and MFN2 in WT, FUN025 and Tg-TMEM135 (TG) fibroblasts. GAPDH was used as a loading control. ( C – E ) Quantification of western blotting results from ( B ). Protein levels were normalized using GAPDH expression levels. DOI: http://dx.doi.org/10.7554/eLife.19264.011

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Transfection, Expressing, Labeling, Western Blot

    FUN025 mice show AMD-like pathologies. ( A ) Punctate light deposits were found in the fundus photography of the eyes from WT and FUN025 mice. ( B ) Autofluorescent cells/aggregates (indicated by arrows) and lipofuscin-like autofluorescence were observed in proximity to the apical surface of the RPE in FUN025 mice. Scale bar = 60 μm. ( C ) Iba1 (microglia/ macrophage marker) and F4/80 (macrophage marker) positive cells were found in the FUN025 retina at seven months, whereas very few Iba1 positive cells were found in the WT retina at seven months. Scale bar = 20 μm. ( D ) Signals for inflammasome markers, NLRP3 and caspase1, increased in the RPE in both peripheral and central retina from FUN025 mice compared to WT control. ( E ) At seven months of age, the RPE (highlighted by CRALBP staining) thickness is significantly increased in both central and peripheral retina of FUN025 mice compared to control mice. The RPE nuclei were highlighted with Otx1+Otx2. Data from n = 4 mice per genotype. ( F ) Transcorneal electroretinograms (ERG) recordings from seven-month-old FUN025 mice and their WT littermates. Both scotopic (dark-adapted) ERG a- and b-waves from the rod pathway were markedly reduced in FUN025 mice. A reduction was also observed in photopic (light-adapted) ERG b-wave from the cone pathway with higher flash intensity, while no difference between FUN025 and WT was observed in the photopic a-wave, majority of which is postreceptoral in origin. Data from n = 5 mice per genotype. *p

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: FUN025 mice show AMD-like pathologies. ( A ) Punctate light deposits were found in the fundus photography of the eyes from WT and FUN025 mice. ( B ) Autofluorescent cells/aggregates (indicated by arrows) and lipofuscin-like autofluorescence were observed in proximity to the apical surface of the RPE in FUN025 mice. Scale bar = 60 μm. ( C ) Iba1 (microglia/ macrophage marker) and F4/80 (macrophage marker) positive cells were found in the FUN025 retina at seven months, whereas very few Iba1 positive cells were found in the WT retina at seven months. Scale bar = 20 μm. ( D ) Signals for inflammasome markers, NLRP3 and caspase1, increased in the RPE in both peripheral and central retina from FUN025 mice compared to WT control. ( E ) At seven months of age, the RPE (highlighted by CRALBP staining) thickness is significantly increased in both central and peripheral retina of FUN025 mice compared to control mice. The RPE nuclei were highlighted with Otx1+Otx2. Data from n = 4 mice per genotype. ( F ) Transcorneal electroretinograms (ERG) recordings from seven-month-old FUN025 mice and their WT littermates. Both scotopic (dark-adapted) ERG a- and b-waves from the rod pathway were markedly reduced in FUN025 mice. A reduction was also observed in photopic (light-adapted) ERG b-wave from the cone pathway with higher flash intensity, while no difference between FUN025 and WT was observed in the photopic a-wave, majority of which is postreceptoral in origin. Data from n = 5 mice per genotype. *p

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Mouse Assay, Marker, Staining

    Tmem135 FUN025/FUN025 mice are more sensitive to hyperoxic condition. ( A – B ) Tmem135 FUN025/FUN025 (FUN025) mice raised in 75% O 2 for two weeks show significant decrease of ONLT and increase of TUNEL positive cells, indicating accelerated photoreceptor cell death by apoptosis. Data from n = 4 WT mice in control air, n = 3 WT mice in 75% O 2 , n = 3 FUN025 mice in control air, and n = 3 FUN025 mice in 75% O 2 . Scale bar = 20 μm. ( C ) Upregulation of GFAP (green) indicating retinal stress is observed in FUN025 mice raised in the normal air, as well as WT mice and FUN025 mice raised in 75% O 2 for two weeks. FUN025 mice raised in 75% O 2 have the highest increase of GFAP signals in the retina. Scale bar = 20 μm. ( D ) Western blotting showing that hyperoxia results in upregulation of 4-HNE in both WT and FUN025 retina, and an increase of TMEM135 in FUN025 retina but not in WT retina. Data from n = 3 WT mice in control air, n = 3 WT mice in 75% O 2 , n = 3 FUN025 mice in control air, and n = 3 FUN025 mice in 75% O 2 . *p

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Tmem135 FUN025/FUN025 mice are more sensitive to hyperoxic condition. ( A – B ) Tmem135 FUN025/FUN025 (FUN025) mice raised in 75% O 2 for two weeks show significant decrease of ONLT and increase of TUNEL positive cells, indicating accelerated photoreceptor cell death by apoptosis. Data from n = 4 WT mice in control air, n = 3 WT mice in 75% O 2 , n = 3 FUN025 mice in control air, and n = 3 FUN025 mice in 75% O 2 . Scale bar = 20 μm. ( C ) Upregulation of GFAP (green) indicating retinal stress is observed in FUN025 mice raised in the normal air, as well as WT mice and FUN025 mice raised in 75% O 2 for two weeks. FUN025 mice raised in 75% O 2 have the highest increase of GFAP signals in the retina. Scale bar = 20 μm. ( D ) Western blotting showing that hyperoxia results in upregulation of 4-HNE in both WT and FUN025 retina, and an increase of TMEM135 in FUN025 retina but not in WT retina. Data from n = 3 WT mice in control air, n = 3 WT mice in 75% O 2 , n = 3 FUN025 mice in control air, and n = 3 FUN025 mice in 75% O 2 . *p

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Mouse Assay, TUNEL Assay, Western Blot

    Mitochondrial membrane potential in FUN025 and Tg-Tmem135 MFs. ( A – D ) Representative flow cytometry data showing ΔΨM differences between MFs derived from WT ( A ), FUN025 (B), and Tg-Tmem135 ( C ) mice. CCCP treatment caused decrease of fibroblast ΔΨM and therefore serves as the negative control for fibroblast ΔΨM ( D ). Unstained fibroblasts were used to gate the quadrants 1–4 (Q1-Q4) which Q4 represents background fluorescence intensity. ( D ) Population with detectable ΔΨM was gated according to CCCP treated WT MFs. DOI: http://dx.doi.org/10.7554/eLife.19264.016

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Mitochondrial membrane potential in FUN025 and Tg-Tmem135 MFs. ( A – D ) Representative flow cytometry data showing ΔΨM differences between MFs derived from WT ( A ), FUN025 (B), and Tg-Tmem135 ( C ) mice. CCCP treatment caused decrease of fibroblast ΔΨM and therefore serves as the negative control for fibroblast ΔΨM ( D ). Unstained fibroblasts were used to gate the quadrants 1–4 (Q1-Q4) which Q4 represents background fluorescence intensity. ( D ) Population with detectable ΔΨM was gated according to CCCP treated WT MFs. DOI: http://dx.doi.org/10.7554/eLife.19264.016

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Flow Cytometry, Cytometry, Derivative Assay, Mouse Assay, Negative Control, Fluorescence

    Localization of TMEM135 to the mitochondria. ( A ) Mitochondrial localization of TMEM135 in MFs co-transfected with GFP tagged TMEM135 vector (green) and DsRed2 tagged mitochondria vector (red). GFP-TMEM135 signals were detected as puncta to the mitochondria as well as in the cytoplasm. Colocalization of TMEM135 and mitochondria in MFs transfected with AcGFP1 tagged mitochondria vector (green) and immunostained with anti-TMEM135 antibody (red). Scale bar = 10 μm. ( B ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondira (MitoTracker, red) in wild-type and FUN025 mouse fibroblasts. Scale bar = 10 μm. ( C ) Immuno-EM revealed localization of GFP-tagged TMEM135 to the mitochondria. ( D – E ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondria (MitoTracker and TOMM20, red) in Cos-7 cells and primary mouse hippocampal neuron. Scale bar = 10 μm. ( F ) The mitochondrial fraction isolated from the WT mouse brain show TMEM135 signals by immunoblotting. Following proteins were used as organelle markers: MFN2–mitochondria; LAMP2–lysosome; Lamin B1– nucleus; PDI– endoplasmic reticulum (ER). ( G ) Strong TMEM135 signals (green) in GCL, IPL, OPL, inner segments of photoreceptor cells, and RPE from wild-type and FUN025 mouse retina. Throughout the retina, TMEM135 is colocalized with mitochondria (anti-TOMM20 antibody, red). Scale bar = 10 μm. ( H ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondria (MitoTracker, red) in wild-type and FUN025 primary mouse RPE cell culture. Scale bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.19264.008

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Localization of TMEM135 to the mitochondria. ( A ) Mitochondrial localization of TMEM135 in MFs co-transfected with GFP tagged TMEM135 vector (green) and DsRed2 tagged mitochondria vector (red). GFP-TMEM135 signals were detected as puncta to the mitochondria as well as in the cytoplasm. Colocalization of TMEM135 and mitochondria in MFs transfected with AcGFP1 tagged mitochondria vector (green) and immunostained with anti-TMEM135 antibody (red). Scale bar = 10 μm. ( B ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondira (MitoTracker, red) in wild-type and FUN025 mouse fibroblasts. Scale bar = 10 μm. ( C ) Immuno-EM revealed localization of GFP-tagged TMEM135 to the mitochondria. ( D – E ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondria (MitoTracker and TOMM20, red) in Cos-7 cells and primary mouse hippocampal neuron. Scale bar = 10 μm. ( F ) The mitochondrial fraction isolated from the WT mouse brain show TMEM135 signals by immunoblotting. Following proteins were used as organelle markers: MFN2–mitochondria; LAMP2–lysosome; Lamin B1– nucleus; PDI– endoplasmic reticulum (ER). ( G ) Strong TMEM135 signals (green) in GCL, IPL, OPL, inner segments of photoreceptor cells, and RPE from wild-type and FUN025 mouse retina. Throughout the retina, TMEM135 is colocalized with mitochondria (anti-TOMM20 antibody, red). Scale bar = 10 μm. ( H ) Colocalization of TMEM135 (anti-TMEM135 antibody, green) and mitochondria (MitoTracker, red) in wild-type and FUN025 primary mouse RPE cell culture. Scale bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.19264.008

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Transfection, Plasmid Preparation, Electron Microscopy, Isolation, Cell Culture

    Identification of the causative gene, Tmem135 , for the FUN025 mutation. Wild-type TMEM135 protein is predicted to form five transmembrane helices by the program TMHMM (v.1.0) ( http://www.cbs.dtu.dk/ ). The FUN025 mutation decreases the probability of forming the 4th and 5th transmembrane helix. DOI: http://dx.doi.org/10.7554/eLife.19264.006

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Identification of the causative gene, Tmem135 , for the FUN025 mutation. Wild-type TMEM135 protein is predicted to form five transmembrane helices by the program TMHMM (v.1.0) ( http://www.cbs.dtu.dk/ ). The FUN025 mutation decreases the probability of forming the 4th and 5th transmembrane helix. DOI: http://dx.doi.org/10.7554/eLife.19264.006

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Mutagenesis

    A T > C mutation in Tmem135 fails to complement FUN025 . Using the CRISPR/Cas9/sgRNA system, we generated C57BL/6J mice that carry a point mutation (T > C) in intron 12 of Tmem135 that is the same as observed in FUN025 mice (see Materials and methods). We refer to these mice as T > C /+ mice. The T > C heterozygous mice were crossed with the FUN025 homozygous mice to produce F1 (T > C/ FUN025 compound heterozygous) mice, which were analyzed for retinal phenotypes. At 11 weeks, T > C/ FUN025 mice showed increased ectopic synapses (upper panel), increased Iba1 + cells (middle panel), and increased GFAP immunoreactivity (lower panel) in peripheral retina compared to the age-matched FUN025 heterozygous control mice, which are similar to those observed in FUN025 homozygous mice. These results indicate non-complementation between FUN025 and T > C mutations, demonstrating that the point mutation (T > C) in Tmem135 is the FUN025 causative mutation. Scale bar = 20 μm. DOI: http://dx.doi.org/10.7554/eLife.19264.007

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: A T > C mutation in Tmem135 fails to complement FUN025 . Using the CRISPR/Cas9/sgRNA system, we generated C57BL/6J mice that carry a point mutation (T > C) in intron 12 of Tmem135 that is the same as observed in FUN025 mice (see Materials and methods). We refer to these mice as T > C /+ mice. The T > C heterozygous mice were crossed with the FUN025 homozygous mice to produce F1 (T > C/ FUN025 compound heterozygous) mice, which were analyzed for retinal phenotypes. At 11 weeks, T > C/ FUN025 mice showed increased ectopic synapses (upper panel), increased Iba1 + cells (middle panel), and increased GFAP immunoreactivity (lower panel) in peripheral retina compared to the age-matched FUN025 heterozygous control mice, which are similar to those observed in FUN025 homozygous mice. These results indicate non-complementation between FUN025 and T > C mutations, demonstrating that the point mutation (T > C) in Tmem135 is the FUN025 causative mutation. Scale bar = 20 μm. DOI: http://dx.doi.org/10.7554/eLife.19264.007

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Mutagenesis, CRISPR, Generated, Mouse Assay

    Age-dependent retinal abnormalities in FUN025 mice. ( A – B ) A significant decrease of the ONLT index occurred by two months of age in FUN025 retina. Mo = months. Data from n = 10 WT (2 Mo), n = 4 FUN025 (2 Mo), n = 20 WT (7 Mo), n = 8 FUN025 (7 Mo) mice. Scale bar = 20 μm. ( C – D ) Ectopic synapses were observed as bipolar cell neurites (PKC, red) and photoreceptor synaptic terminals (PSD95, green) extending into the ONL indicated by asterisks ( C ). Scale bar = 10 μm. Significant increase of ectopic synapses were found earlier in the peripheral retina, and later in the central retina of FUN025 compared to WT mice. Data for central retina from n = 3 WT (2 Mo), n = 3 FUN025 (2 Mo), n = 3 WT (7 Mo), n = 3 FUN025 (7 Mo) mice; data for peripheral retina from n = 5 WT (2 Mo), n = 6 FUN025 (2 Mo), n = 6 WT (7 Mo), n = 6 FUN025 (7 Mo) mice. ( E ) GFAP (green) upregulation was progressively observed in the FUN025 retina. ONL: outer nuclear layer. INL: inner nuclear layer. Outer nuclear layer thickness (ONLT) index = ONL thickness/INL thickness. *p

    Journal: eLife

    Article Title: Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies

    doi: 10.7554/eLife.19264

    Figure Lengend Snippet: Age-dependent retinal abnormalities in FUN025 mice. ( A – B ) A significant decrease of the ONLT index occurred by two months of age in FUN025 retina. Mo = months. Data from n = 10 WT (2 Mo), n = 4 FUN025 (2 Mo), n = 20 WT (7 Mo), n = 8 FUN025 (7 Mo) mice. Scale bar = 20 μm. ( C – D ) Ectopic synapses were observed as bipolar cell neurites (PKC, red) and photoreceptor synaptic terminals (PSD95, green) extending into the ONL indicated by asterisks ( C ). Scale bar = 10 μm. Significant increase of ectopic synapses were found earlier in the peripheral retina, and later in the central retina of FUN025 compared to WT mice. Data for central retina from n = 3 WT (2 Mo), n = 3 FUN025 (2 Mo), n = 3 WT (7 Mo), n = 3 FUN025 (7 Mo) mice; data for peripheral retina from n = 5 WT (2 Mo), n = 6 FUN025 (2 Mo), n = 6 WT (7 Mo), n = 6 FUN025 (7 Mo) mice. ( E ) GFAP (green) upregulation was progressively observed in the FUN025 retina. ONL: outer nuclear layer. INL: inner nuclear layer. Outer nuclear layer thickness (ONLT) index = ONL thickness/INL thickness. *p

    Article Snippet: Using a SureSelect custom DNA bait library representing the FUN025 region (Chr 7: 86,816,656 – 98,732,541) created by Agilent Technologies, sequence capture was performed on genomic DNA isolated from the spleen of FUN025 mice (Qiagen DNEasy Blood and Tissue Kit, QIAGEN, Valencia, CA) followed by paired end sequencing on the Illumina HiSeq platform at DNA Sequencing Facility of University of Wisconsin-Madison Biotechnology Center.

    Techniques: Mouse Assay

    Mutations in  ichor  ( ich ) disrupt seamless tube integrity and shape in larval terminal cells. (A,A’) In a genetic mosaic third instar larva, GFP-labeled  ich 206/206  terminal cells (green) are visualized next to GFP-negative control terminal cells ( ich 206/+ , asterisk). All tracheal nuclei are labeled (blue). Fluorescent images are superimposed on brightfield. Gas-filled tubes appear as dark lines; the  ich 206/206  terminal cells lack gas-filled tubes (arrow marks intercellular junction between ich terminal cell and wild type stalk cell). (B-B”) In control terminal cells, ChtVis-TdTomato (red) labels cuticle-lined gas-filled tracheal tubes (B’, B”) as well as fluid-filled lumens found at the tips of terminal branches (arrowheads in B’, B”). In  ich 206/206  terminal cells (C), ChtVis-TdTomato accumulates in discontinuous, fluid-filled tubes (C’C”). (D-F) The apical membranes in wild-type (D,D’) and  ich  (E-F’) seamless tubes is visualized by an antiserum raised against a Whacked peptide [  69 ]. In contrast to the continuous apical membranes in control (D,D’),  ich  terminal cell tubes display numerous apical membrane discontinuities and regions of cystic apical membrane (arrowheads in E’, F’). (Scale Bars: A, A’, B, and C 50 μm; B’-B”, C’-C” 10 μm; D-F’ 5 μm).

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: Mutations in ichor ( ich ) disrupt seamless tube integrity and shape in larval terminal cells. (A,A’) In a genetic mosaic third instar larva, GFP-labeled ich 206/206 terminal cells (green) are visualized next to GFP-negative control terminal cells ( ich 206/+ , asterisk). All tracheal nuclei are labeled (blue). Fluorescent images are superimposed on brightfield. Gas-filled tubes appear as dark lines; the ich 206/206 terminal cells lack gas-filled tubes (arrow marks intercellular junction between ich terminal cell and wild type stalk cell). (B-B”) In control terminal cells, ChtVis-TdTomato (red) labels cuticle-lined gas-filled tracheal tubes (B’, B”) as well as fluid-filled lumens found at the tips of terminal branches (arrowheads in B’, B”). In ich 206/206 terminal cells (C), ChtVis-TdTomato accumulates in discontinuous, fluid-filled tubes (C’C”). (D-F) The apical membranes in wild-type (D,D’) and ich (E-F’) seamless tubes is visualized by an antiserum raised against a Whacked peptide [ 69 ]. In contrast to the continuous apical membranes in control (D,D’), ich terminal cell tubes display numerous apical membrane discontinuities and regions of cystic apical membrane (arrowheads in E’, F’). (Scale Bars: A, A’, B, and C 50 μm; B’-B”, C’-C” 10 μm; D-F’ 5 μm).

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Labeling, Negative Control

    ichor  encodes a zinc finger protein. (A) Domain map of Ichor polypeptide and position of EMS-induced lesions. (B-B’) In contrast to internal control ( Df(3R)osk/+ ) seamless tubes (arrowheads in B’), GFP-labeled  Df(3R)osk  terminal cell clones exhibit  ich- like apical membrane discontinuities. Apical membrane in B-D is detected using anti-Wkdpep sera. Outline of Df(3R)osk/Df(3R)osk terminal cell shown as green dotted line. (C-D’)  SRF > eGFP  wild-type control terminal cells exhibit a patent seamless tube (C-C’), whereas  SRF > eGFP ,  CG11966  RNAi terminal cells (D-D’) contain discontinuous blind-ended tube fragments. Terminal cell outline shown as green dotted line. (E-F) Restoring expression of full-length CG11966 cDNA in  ich  terminal cells rescues the  ich 206  discontinuous tube defect, as observed by visualizing apical membranes with aPKC staining (E, E’). (F) Quantification of rescue experiments using Ich transgenes ( P  = 8.82 x 10 −17  for UAS- ich ,  P =  1.83 x 10 −12  for UAS-flag- ich ,  P  = 2.01 x 10 −18 , using one-sided Fisher’s exact probability test). (Scale Bars: B,C,D,E 20μm; B’, C’,D’, E’ 5 μm).

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: ichor encodes a zinc finger protein. (A) Domain map of Ichor polypeptide and position of EMS-induced lesions. (B-B’) In contrast to internal control ( Df(3R)osk/+ ) seamless tubes (arrowheads in B’), GFP-labeled Df(3R)osk terminal cell clones exhibit ich- like apical membrane discontinuities. Apical membrane in B-D is detected using anti-Wkdpep sera. Outline of Df(3R)osk/Df(3R)osk terminal cell shown as green dotted line. (C-D’) SRF > eGFP wild-type control terminal cells exhibit a patent seamless tube (C-C’), whereas SRF > eGFP , CG11966 RNAi terminal cells (D-D’) contain discontinuous blind-ended tube fragments. Terminal cell outline shown as green dotted line. (E-F) Restoring expression of full-length CG11966 cDNA in ich terminal cells rescues the ich 206 discontinuous tube defect, as observed by visualizing apical membranes with aPKC staining (E, E’). (F) Quantification of rescue experiments using Ich transgenes ( P = 8.82 x 10 −17 for UAS- ich , P = 1.83 x 10 −12 for UAS-flag- ich , P = 2.01 x 10 −18 , using one-sided Fisher’s exact probability test). (Scale Bars: B,C,D,E 20μm; B’, C’,D’, E’ 5 μm).

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Labeling, Clone Assay, Expressing, Staining

    Ichor is required for the pan-tracheal expression of  osi18  and  osi19 . Expression of  osi18  mRNA (A-F) was examined in sibling (WT; A-C) and  ich 206 /Df(3R) osk  embryos (D-F) by in situ hybridization. Expression of  osi19  mRNA (G-N) was examined in siblings (G-I) and  ich 206 /Df(3R) osk  embryos (J-L) by in situ hybridization. In contrast to the wild type control heterozygous siblings (A-C and G-I),  ich 206  hemizygotes (D-F, J-L) lacked  osi18  and  osi19  expression throughout the trachea. However, by late Stage 16 (F, L)  osi18  and  osi19  mRNA became detectable in the multicellular dorsal trunks branches of the tracheal system. Stage 16 control (2X btl > GFP ) embryos (M) detected the expected pattern of  osi19  mRNA expression in contrast to embryos (N) expressing a transcriptional repressor domain (EnR) fused to the Ich DNA binding domain (IchDBD). The embryos expressing the Ich chimera (2X btl > GFP , EnR-IchDBD) exhibited pan-tracheal reduction of osi19 mRNA.

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: Ichor is required for the pan-tracheal expression of osi18 and osi19 . Expression of osi18 mRNA (A-F) was examined in sibling (WT; A-C) and ich 206 /Df(3R) osk embryos (D-F) by in situ hybridization. Expression of osi19 mRNA (G-N) was examined in siblings (G-I) and ich 206 /Df(3R) osk embryos (J-L) by in situ hybridization. In contrast to the wild type control heterozygous siblings (A-C and G-I), ich 206 hemizygotes (D-F, J-L) lacked osi18 and osi19 expression throughout the trachea. However, by late Stage 16 (F, L) osi18 and osi19 mRNA became detectable in the multicellular dorsal trunks branches of the tracheal system. Stage 16 control (2X btl > GFP ) embryos (M) detected the expected pattern of osi19 mRNA expression in contrast to embryos (N) expressing a transcriptional repressor domain (EnR) fused to the Ich DNA binding domain (IchDBD). The embryos expressing the Ich chimera (2X btl > GFP , EnR-IchDBD) exhibited pan-tracheal reduction of osi19 mRNA.

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Expressing, In Situ Hybridization, Binding Assay

    Ichor functions as a transcriptional activator in terminal cells. (A-A”)  tubGAL80 ts ; SRF > eGFP ,  FLAG-Ich  larvae were upshifted to the restrictive temperature around the start of the third larval instar to induce GAL4-dependent FLAG-Ich expression. FLAG-Ich accumulates at steady-state in the nucleus of terminal cells (A’, A”). (B) Domain organization of FLAG-VP16AD-IchDBD and EnR-IchDBD-FLAG chimeras is schematized. VP16AD (orange) is a potent transcriptional transactivating domain from a viral protein, while EnR (purple) is the transcriptional repressor domain of the Engrailed transcription factor. IchDBD (blue) is the C-terminal portion of the Ich protein that includes the zinc finger domains (red) presumed to confer DNA binding. (C-C”)  ich 206  MARCM terminal cell clones expressing UAS-FLAG-VP16AD-IchDBD transgene. By virtue of an exogenous nuclear targeting sequence (see B, green), FLAG-VP16AD-IchDBD chimera accumulates in the nucleus (C, C’), restoring seamless tube integrity (C”), as observed by staining for the apical marker aPKC. (D-E’) Wild-type control  SRF > eGFP  (D-D’) and  SRF > eGFP ,  EnR-IchDBD-FLAG  (E, E’) terminal cells. The EnR-IchDBD-FLAG chimera behaves like an Ich dominant negative, inducing the  ich  loss of function phenotype. In contrast to the fully patent lumens of control terminal cells (D’),  SRF > eGFP ,  EnR-IchDBD-FLAG  terminal cells exhibited blind-ended, discontinuous lumens similar to  ich  mutant terminal cells. (Scale Bars: A, C, D, E 20 μm; A’ and A”, C’ and C”, D’, E’ 5 μm).

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: Ichor functions as a transcriptional activator in terminal cells. (A-A”) tubGAL80 ts ; SRF > eGFP , FLAG-Ich larvae were upshifted to the restrictive temperature around the start of the third larval instar to induce GAL4-dependent FLAG-Ich expression. FLAG-Ich accumulates at steady-state in the nucleus of terminal cells (A’, A”). (B) Domain organization of FLAG-VP16AD-IchDBD and EnR-IchDBD-FLAG chimeras is schematized. VP16AD (orange) is a potent transcriptional transactivating domain from a viral protein, while EnR (purple) is the transcriptional repressor domain of the Engrailed transcription factor. IchDBD (blue) is the C-terminal portion of the Ich protein that includes the zinc finger domains (red) presumed to confer DNA binding. (C-C”) ich 206 MARCM terminal cell clones expressing UAS-FLAG-VP16AD-IchDBD transgene. By virtue of an exogenous nuclear targeting sequence (see B, green), FLAG-VP16AD-IchDBD chimera accumulates in the nucleus (C, C’), restoring seamless tube integrity (C”), as observed by staining for the apical marker aPKC. (D-E’) Wild-type control SRF > eGFP (D-D’) and SRF > eGFP , EnR-IchDBD-FLAG (E, E’) terminal cells. The EnR-IchDBD-FLAG chimera behaves like an Ich dominant negative, inducing the ich loss of function phenotype. In contrast to the fully patent lumens of control terminal cells (D’), SRF > eGFP , EnR-IchDBD-FLAG terminal cells exhibited blind-ended, discontinuous lumens similar to ich mutant terminal cells. (Scale Bars: A, C, D, E 20 μm; A’ and A”, C’ and C”, D’, E’ 5 μm).

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Expressing, Binding Assay, Clone Assay, Sequencing, Staining, Marker, Dominant Negative Mutation, Mutagenesis

    Ichor is required for assembly of the mature aECM. Cuticle preparations of heterozygous control (A-C) and homozygous mutant  kkv sob483  (A’),  ich 206  (B’), and  ich 543  (C’) St.17 embryos or first instar larvae. Chitin-deficient embryos (A’) exhibited a bloated cuticle and degenerated head skeleton (arrowhead in A’). The  ich  embryos exhibited a mild bloated phenotype as well as cuticle defects distinct from chitin-deficient embryos. The head skeleton (arrowheads in B’, C’) appeared intact but poorly pigmented. Other cuticular structures, such as the epidermal denticles (arrows in B’, C’) and spiracular chambers (white arrows in B’, C’), were also poorly pigmented in  ich  mutants. By contrast, chitin synthesis is not absolutely required for pigmentation of the head skeleton remnants (arrowhead in A’), denticle belts (black arrow in A’), or spiracular chambers (white arrow in A’). (D, E) Longitudinal sections of control ( btl > GFP , D) and ich RNAi ( SRF > eGFP ,  ich  RNAi; E) first instar (L1) terminal cell tubes visualized by transmission electron microscopy (TEM). Control terminal cell branches contain tubes (*) of locally uniform dimensions lined by an electron-dense aECM (cuticle). The arrowhead in D points to a clearly defined taenidium with an electron-luscent chitinous core. By contrast, the lumens (*) of  ich  RNAi terminal branches adopt a highly irregular morphology (red dashed line). These lumens are devoid of taenidiae and instead are occluded with disorganized electron-dense material. (Scale Bars: D, E = 500 nm).

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: Ichor is required for assembly of the mature aECM. Cuticle preparations of heterozygous control (A-C) and homozygous mutant kkv sob483 (A’), ich 206 (B’), and ich 543 (C’) St.17 embryos or first instar larvae. Chitin-deficient embryos (A’) exhibited a bloated cuticle and degenerated head skeleton (arrowhead in A’). The ich embryos exhibited a mild bloated phenotype as well as cuticle defects distinct from chitin-deficient embryos. The head skeleton (arrowheads in B’, C’) appeared intact but poorly pigmented. Other cuticular structures, such as the epidermal denticles (arrows in B’, C’) and spiracular chambers (white arrows in B’, C’), were also poorly pigmented in ich mutants. By contrast, chitin synthesis is not absolutely required for pigmentation of the head skeleton remnants (arrowhead in A’), denticle belts (black arrow in A’), or spiracular chambers (white arrow in A’). (D, E) Longitudinal sections of control ( btl > GFP , D) and ich RNAi ( SRF > eGFP , ich RNAi; E) first instar (L1) terminal cell tubes visualized by transmission electron microscopy (TEM). Control terminal cell branches contain tubes (*) of locally uniform dimensions lined by an electron-dense aECM (cuticle). The arrowhead in D points to a clearly defined taenidium with an electron-luscent chitinous core. By contrast, the lumens (*) of ich RNAi terminal branches adopt a highly irregular morphology (red dashed line). These lumens are devoid of taenidiae and instead are occluded with disorganized electron-dense material. (Scale Bars: D, E = 500 nm).

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Mutagenesis, Transmission Assay, Electron Microscopy, Transmission Electron Microscopy

    Ichor is required for CG8213 expression in the trachea  (A-D) Wild-type  w 1118  embryos hybridized with DIG-labeled antisense (A-C’) and sense (D)  CG8213  RNA probes. CG8213 expression is first detected at St. 13 in the posterior spiracles (arrowhead in A, A’) and foregut primordium (arrow in B). By St. 15, CG8213 is expressed specifically in cuticle-secreting epithelia, including the trachea (black arrowheads in C), foregut (arrow in C’), hindgut (white arrowhead in C’), and epidermis (see asterisks in F’, I). This signal is specific since a sense probe (D) shows no such pattern. (E) Transcripts and polypeptide encoded by CG8213 locus. Black bar denotes position of RNA probes, designed to detect all spliceoforms. (F-G’)  ich 206 /ich 543  mutant (G, G’) and control siblings (F,F’) hybridized with antisense CG8213 RNA probe. Whereas control siblings show a WT  CG8213  expression pattern,  ich  mutant embryos exhibited a significant reduction or loss of CG8213 expression in the trachea. Only a subset of cells in the posterior spiracles (black arrowhead in G) retain  CG8213  expression. Hindgut expression (white arrowhead in G’) is also reduced. (H-I) 2X btl > GFP  (H) and 2X btl > GFP ,  EnR-IchDBD  embryos hybridized with antisense  CG8213  probe. Whereas control embryos (H) expressed  CG8213  prominently in the major dorsal trunk (black arrowhead in H) of the trachea, tracheal-autonomous expression of the dominant-negative Ich transgene caused a loss of tracheal expression; only cells in the posterior spiracles retain  CG8213  message, similar to  ich  loss-of-function phenotype.  CG8213  expression in the epidermis (asterisk in I), foregut (arrow in I), and hindgut (white arrowhead in I) is unaffected, indicating a tracheal-autonomous loss of expression.

    Journal: PLoS Genetics

    Article Title: An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity

    doi: 10.1371/journal.pgen.1007146

    Figure Lengend Snippet: Ichor is required for CG8213 expression in the trachea (A-D) Wild-type w 1118 embryos hybridized with DIG-labeled antisense (A-C’) and sense (D) CG8213 RNA probes. CG8213 expression is first detected at St. 13 in the posterior spiracles (arrowhead in A, A’) and foregut primordium (arrow in B). By St. 15, CG8213 is expressed specifically in cuticle-secreting epithelia, including the trachea (black arrowheads in C), foregut (arrow in C’), hindgut (white arrowhead in C’), and epidermis (see asterisks in F’, I). This signal is specific since a sense probe (D) shows no such pattern. (E) Transcripts and polypeptide encoded by CG8213 locus. Black bar denotes position of RNA probes, designed to detect all spliceoforms. (F-G’) ich 206 /ich 543 mutant (G, G’) and control siblings (F,F’) hybridized with antisense CG8213 RNA probe. Whereas control siblings show a WT CG8213 expression pattern, ich mutant embryos exhibited a significant reduction or loss of CG8213 expression in the trachea. Only a subset of cells in the posterior spiracles (black arrowhead in G) retain CG8213 expression. Hindgut expression (white arrowhead in G’) is also reduced. (H-I) 2X btl > GFP (H) and 2X btl > GFP , EnR-IchDBD embryos hybridized with antisense CG8213 probe. Whereas control embryos (H) expressed CG8213 prominently in the major dorsal trunk (black arrowhead in H) of the trachea, tracheal-autonomous expression of the dominant-negative Ich transgene caused a loss of tracheal expression; only cells in the posterior spiracles retain CG8213 message, similar to ich loss-of-function phenotype. CG8213 expression in the epidermis (asterisk in I), foregut (arrow in I), and hindgut (white arrowhead in I) is unaffected, indicating a tracheal-autonomous loss of expression.

    Article Snippet: Genomic DNA was isolated from ich 206 mutant embryos (Qiagen DNeasy Blood and Tissue Kit) and subjected to whole-genome sequencing (Otogenetics, Atlanta, GA).

    Techniques: Expressing, Labeling, Mutagenesis, Dominant Negative Mutation

    Non-Gustatory GPCRs are not inhibited by probenecid. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated GPCR receptors. In the case of the endogenously expressed βAR receptor, only Gα16gust44 was transfected. 22 hours post-transfection, calcium influx was measured for cells that were challenged with the indicated ligands in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Probenecid treatment did not attenuate calcium influx upon challenge of (A) CCR5 with 10 nM RANTES, (B) CXCR4 with 10 nM SDF-1α, or (C) βAR with 10 µM isoproterenol.

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Non-Gustatory GPCRs are not inhibited by probenecid. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated GPCR receptors. In the case of the endogenously expressed βAR receptor, only Gα16gust44 was transfected. 22 hours post-transfection, calcium influx was measured for cells that were challenged with the indicated ligands in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Probenecid treatment did not attenuate calcium influx upon challenge of (A) CCR5 with 10 nM RANTES, (B) CXCR4 with 10 nM SDF-1α, or (C) βAR with 10 µM isoproterenol.

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Transfection, Incubation

    Inhibition of hTAS2R16, hTAS2R38, and hTAS2R43 by probenecid. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated TAS2R receptors in a 384-well microplate. 22 hours post-transfection, calcium influx was measured in cells challenged with the indicated ligands in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Probenecid treatment completely attenuated (A) salicin-dependent (3 mM) calcium influx by the hTAS2R16 receptor and (B) PTC- (100 µM) and (C) PROP-dependent (30 µM) calcium influx by the hTAS2R38 receptor. (D) Probenecid treatment similarly attenuated aloin-induced (3 mM) hTAS2R43 signaling. (E) Probenecid treatment did not inhibit saccharin induced signaling of hTAS2R31. (F) hTAS2R38 transfected cells challenged with probenecid or buffer alone (1 mM) did not result in calcium influx, but do flux with the PTC control.

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Inhibition of hTAS2R16, hTAS2R38, and hTAS2R43 by probenecid. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated TAS2R receptors in a 384-well microplate. 22 hours post-transfection, calcium influx was measured in cells challenged with the indicated ligands in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Probenecid treatment completely attenuated (A) salicin-dependent (3 mM) calcium influx by the hTAS2R16 receptor and (B) PTC- (100 µM) and (C) PROP-dependent (30 µM) calcium influx by the hTAS2R38 receptor. (D) Probenecid treatment similarly attenuated aloin-induced (3 mM) hTAS2R43 signaling. (E) Probenecid treatment did not inhibit saccharin induced signaling of hTAS2R31. (F) hTAS2R38 transfected cells challenged with probenecid or buffer alone (1 mM) did not result in calcium influx, but do flux with the PTC control.

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Inhibition, Transfection, Incubation

    Differential effect of probenecid analogs on the activation of hTAS2R16 and hTAS2R38 receptors. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated TAS2R receptor. 22 hours post-transfection, calcium influx was measured after challenge with (A) 3 mM salicin or (B) 100 µM PTC in the presence or absence of the indicated compounds (1 mM, pretreatment for 60 minutes). Error bars represent standard deviations (n = 6 for hTAS2R16; n = 12 for hTAS2R38).

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Differential effect of probenecid analogs on the activation of hTAS2R16 and hTAS2R38 receptors. HEK-293T cells were transiently transfected with Gα16gust44 and the indicated TAS2R receptor. 22 hours post-transfection, calcium influx was measured after challenge with (A) 3 mM salicin or (B) 100 µM PTC in the presence or absence of the indicated compounds (1 mM, pretreatment for 60 minutes). Error bars represent standard deviations (n = 6 for hTAS2R16; n = 12 for hTAS2R38).

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Activation Assay, Transfection

    Identification of hTAS2R16 residues required for probenecid inhibition. (A) HEK-293T cells were transiently transfected with wild type hTAS2R16 and Gα16gust44. 22 hours post-transfection, calcium flux was measured for cells that were challenged with 3 mM salicin in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Salicin response to mock transfected (vector alone) HEK-293T cells is shown for comparison. (B, C) HEK-293T cells were similarly transfected with hTAS2R16 variants containing the mutations N96T or P44T/H113R, and challenged with 3 mM salicin in the presence or absence of probenecid (1 mM; 1 hour pre-incubation). N96T and P44T/H113R mutants showed decreased sensitivity to probenecid. A separate clone containing the single point mutant H113R was also tested to rule out this residue ( Figure S1 ). Error bars represent standard deviations (n = 4).

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Identification of hTAS2R16 residues required for probenecid inhibition. (A) HEK-293T cells were transiently transfected with wild type hTAS2R16 and Gα16gust44. 22 hours post-transfection, calcium flux was measured for cells that were challenged with 3 mM salicin in the presence (closed triangles) or absence (open diamonds) of probenecid (1 mM; 1 hour pre-incubation). Salicin response to mock transfected (vector alone) HEK-293T cells is shown for comparison. (B, C) HEK-293T cells were similarly transfected with hTAS2R16 variants containing the mutations N96T or P44T/H113R, and challenged with 3 mM salicin in the presence or absence of probenecid (1 mM; 1 hour pre-incubation). N96T and P44T/H113R mutants showed decreased sensitivity to probenecid. A separate clone containing the single point mutant H113R was also tested to rule out this residue ( Figure S1 ). Error bars represent standard deviations (n = 4).

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Inhibition, Transfection, Incubation, Plasmid Preparation, Mutagenesis

    Probenecid inhibition of hTAS2R16 occurs rapidly and is not dependent on the MRP1 transporter. (A) HEK-293T cells were transiently transfected with hTAS2R16 and Gα16gust44. 22 hours post-transfection, calcium influx was measured for cells that were challenged with 3 mM salicin in the presence of 1 mM probenecid pretreatment for the indicated amount of time (0 min indicates co-injection of salicin with probenecid). hTAS2R16 was completely inactivated by 5 minutes of probenecid pretreatment. (B) HEK-293T cells were transiently transfected with hTAS2R16 and Gα16gust44 followed by challenge with 3 mM salicin in the presence or absence of the indicated compounds (1 mM, pretreatment for 60 minutes). The MRP1 transporter inhibitor indomethacin did not inhibit hTAS2R16 function. Error bars represent standard errors (n = 3).

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Probenecid inhibition of hTAS2R16 occurs rapidly and is not dependent on the MRP1 transporter. (A) HEK-293T cells were transiently transfected with hTAS2R16 and Gα16gust44. 22 hours post-transfection, calcium influx was measured for cells that were challenged with 3 mM salicin in the presence of 1 mM probenecid pretreatment for the indicated amount of time (0 min indicates co-injection of salicin with probenecid). hTAS2R16 was completely inactivated by 5 minutes of probenecid pretreatment. (B) HEK-293T cells were transiently transfected with hTAS2R16 and Gα16gust44 followed by challenge with 3 mM salicin in the presence or absence of the indicated compounds (1 mM, pretreatment for 60 minutes). The MRP1 transporter inhibitor indomethacin did not inhibit hTAS2R16 function. Error bars represent standard errors (n = 3).

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Inhibition, Transfection, Injection

    Pharmacological mechanism of action of probenecid inhibition. (A) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R16 or hTAS2R38. 22 hours post-transfection, cells were pre-treated with increasing amounts of probenecid for 1 hour followed by challenge with 3 mM salicin or 300 µM PTC. (B) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R16, pre-treated with increasing amounts of probenecid for 1 hour, and then challenged with different concentrations of salicin. Error bars represent standard errors (n = 4). (C) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R38, pre-treated with increasing amounts of probenecid for 1 hour, and then challenged with different concentrations of PTC. Error bars represent standard errors (n = 4).

    Journal: PLoS ONE

    Article Title: Probenecid Inhibits the Human Bitter Taste Receptor TAS2R16 and Suppresses Bitter Perception of Salicin

    doi: 10.1371/journal.pone.0020123

    Figure Lengend Snippet: Pharmacological mechanism of action of probenecid inhibition. (A) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R16 or hTAS2R38. 22 hours post-transfection, cells were pre-treated with increasing amounts of probenecid for 1 hour followed by challenge with 3 mM salicin or 300 µM PTC. (B) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R16, pre-treated with increasing amounts of probenecid for 1 hour, and then challenged with different concentrations of salicin. Error bars represent standard errors (n = 4). (C) HEK-293T cells were transiently transfected with Gα16gust44 and hTAS2R38, pre-treated with increasing amounts of probenecid for 1 hour, and then challenged with different concentrations of PTC. Error bars represent standard errors (n = 4).

    Article Snippet: hTAS2R16 (N172/H222 variant) , hTAS2R38 (PAV) , hTAS2R43 (W35/H212) and hTAS2R31 (W35/M162/V227/I240) were cloned by PCR directly from genomic DNA isolated from HEK-293T cells (DNeasy blood and tissue kit, Qiagen) and TOPO cloned into pcDNA3.1D-V5His (Invitrogen) and pCAGGS vectors.

    Techniques: Inhibition, Transfection