dneasy blood  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    DNeasy Blood Tissue Kit
    Description:
    For spin column or 96 well purification of total DNA from animal blood and tissues and from cells yeast bacteria or viruses Kit contents Qiagen DNeasy Blood Tissue Kit 50 preps 100L 25mg Sample 100 to 200L Elution Volume Blood Tissue Sample Total DNA Purification Silica Technology Spin Column Format 6g 30g Yield Manual Processing For Purification of Total DNA from Animal Blood and Tissues and from Cells Yeast Bacteria or Viruses Ideal for PCR Real time PCR Genotyping Includes 50 DNeasy Mini Spin Columns Proteinase K Buffers 2mL Collection Tubes Benefits Standardized method for a variety of sample types High yields even from specialized samples High quality DNA Optimized protocols for a range of starting materials Spin column and 96 well high throughput form
    Catalog Number:
    69504
    Price:
    163
    Category:
    DNeasy Blood Tissue Kits
    Buy from Supplier


    Structured Review

    Qiagen dneasy blood
    DNeasy Blood Tissue Kit
    For spin column or 96 well purification of total DNA from animal blood and tissues and from cells yeast bacteria or viruses Kit contents Qiagen DNeasy Blood Tissue Kit 50 preps 100L 25mg Sample 100 to 200L Elution Volume Blood Tissue Sample Total DNA Purification Silica Technology Spin Column Format 6g 30g Yield Manual Processing For Purification of Total DNA from Animal Blood and Tissues and from Cells Yeast Bacteria or Viruses Ideal for PCR Real time PCR Genotyping Includes 50 DNeasy Mini Spin Columns Proteinase K Buffers 2mL Collection Tubes Benefits Standardized method for a variety of sample types High yields even from specialized samples High quality DNA Optimized protocols for a range of starting materials Spin column and 96 well high throughput form
    https://www.bioz.com/result/dneasy blood/product/Qiagen
    Average 95 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    dneasy blood - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: .. Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. Subsequently, the number of vector genomes was normalized to the amount of DNA and thus calculated per ng total DNA.

    Amplification:

    Article Title: Insights into the possible role of IFNG and IFNGR1 in Kala-azar and Post Kala-azar Dermal Leishmaniasis in Sudanese patients
    Article Snippet: Sequencing of IFNGR1 Genomic DNA was extracted from PBMCs using DNeasy Blood & Tissue Kit in accordance with the manufacturer’s instruction (QIAGEN). .. This target region was amplified from 30 PKDL DNA samples using primers: 5′AAACAGTAGGGCGGGGTAAG3′ and 5′AAATCAAATCGGCTTGACCA3′ designed using primer 3 software ( http://frodo.wi.mit.edu/primer3/ ).

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. Conditions for the long-range PCR amplification comprised a pre-denaturation step at 94°C for 2 min, followed by 40 cycles at 94°C for 1 min, annealing at 60°C for 1 min and extension at 68°C for 20 min. At the end a final extension step at 68°C for 30 min was added.

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: Clinical samples were obtained from the Karolinska University Hospital from patients having ≥2 SIRS (systemic inflammatory response syndrome) criteria and were qPCR positive for E. coli based on the amplification and melting curves. .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. .. Briefly, aberrant bands revealed by SSCP analysis were excised from the gel, amplified by PCR, purified, and submitted to the Operon Biotechnologies (Tokyo, Japan) for direct sequencing.

    Article Title: “Genotype-first” approaches on a curious case of idiopathic progressive cognitive decline
    Article Snippet: Genomic DNA was extracted from peripheral blood for all family members by Qiagen DNeasy Blood & Tissue kit (Valencia, CA, USA). .. The captured and amplified library was then loaded onto the Illumina Hiseq2000 sequencer.

    Article Title: Clinical Presentation, Convalescence, and Relapse of Rocky Mountain Spotted Fever in Dogs Experimentally Infected via Tick Bite
    Article Snippet: DNA was extracted from tick and blood samples using the Qiagen DNEasy Blood & Tissue kit and Flexi Gene kit (Qiagen Inc., Valencia, CA) respectively according to manufacturer's protocols. .. Samples demonstrating amplification prior to 40 cycles with appropriate amplicon melting temperature in both replicates were considered positive.

    Real-time Polymerase Chain Reaction:

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: Clinical samples were obtained from the Karolinska University Hospital from patients having ≥2 SIRS (systemic inflammatory response syndrome) criteria and were qPCR positive for E. coli based on the amplification and melting curves. .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: .. Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. Subsequently, the number of vector genomes was normalized to the amount of DNA and thus calculated per ng total DNA.

    Incubation:

    Article Title: Shielding of a Lipooligosaccharide IgM Epitope Allows Evasion of Neutrophil-Mediated Killing of an Invasive Strain of Nontypeable Haemophilus influenzae
    Article Snippet: After challenge, neutrophils were lysed by adding 100 µl 10% saponin in PBS and incubated for 10 min at room temperature. .. Genomic DNA was isolated using a DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s protocol.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: .. DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. ..

    Cell Culture:

    Article Title: Antitumor Activity of Lenvatinib (E7080): An Angiogenesis Inhibitor That Targets Multiple Receptor Tyrosine Kinases in Preclinical Human Thyroid Cancer Models
    Article Snippet: .. After overnight culture, genomic DNA was isolated from the cultured cells (K1, RO82-W-1, FTC-133, FTC-236, and FTC-238) by using the DNeasy Blood & Tissue kit (Qiagen). .. Mutation analysis for 443 mutations among 32 genes [ABL1 , AKT1 , AKT2 , APC , BRAF , CDK4 , CDKN2A , CSF1R , CTNNB1 , EGFR , FGFR1 , FGFR3 , FLT3 , HRAS , JAK2 , JAK3 , KIT , KRAS , MET , MLH1 , NRAS , P53 , PDGFRA , PIK3CA , PTEN , RB1 , RET , SRC , STK11 , VH1 ] was performed by using the MassARRAY System (Sequenom, San Diego, CA) with OncoCarta Panel versions 1.0 and 3.0.

    Modification:

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: Paragraph title: Modified DNA methylation-specific digital karyotyping ... DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol.

    Sequencing:

    Article Title: Three Classes of Plasmid (47–63 kb) Carry the Type B Neurotoxin Gene Cluster of Group II Clostridium botulinum
    Article Snippet: For strains Kapchunka B3, Kapchunka B8, DB2, and Eklund 2B, genomic DNA was prepared using the Qiagen DNEasy Blood & Tissue kit (Qiagen), from a single colony grown on TPYG agar, and libraries were prepared using the Illumina Nextera DNA Sample Prep Kit (Illumina) according to manufacturer instructions. .. All genome sequencing was carried out using the Illumina MiSeq platform.

    Article Title: Deep Sequencing Reveals Low Incidence of Endogenous LINE-1 Retrotransposition in Human Induced Pluripotent Stem Cells
    Article Snippet: L1Hs library construction and 454 pyrosequencing Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN). .. Briefly, a total of 3.2 µg of genomic DNA from each iPSC clone (hiPSC #7 passage 10, hiPSC #11 passage 12, hiPSC #19 passage 18) and HFF were subjected to the PCR protocol as previously described , except that a few modifications were implemented: (1) instead of using the Illumina primers and adapters, 454 primers A and B were used. (2) The library generated from each sample was barcoded differently with a molecular identifier (MID) with the corresponding primers as listed below, to allow the specific marking of the library of each sample before high-throughput sequencing. (3) The 4 libraries were pooled and subjected to 454 high-throughput sequencing using the primer A, which allows reading from the 3′UTR of the L1Hs to the genomic region of insertion, thereby allowing the direct detection of the polyA tail.

    Article Title: Insights into the possible role of IFNG and IFNGR1 in Kala-azar and Post Kala-azar Dermal Leishmaniasis in Sudanese patients
    Article Snippet: .. Sequencing of IFNGR1 Genomic DNA was extracted from PBMCs using DNeasy Blood & Tissue Kit in accordance with the manufacturer’s instruction (QIAGEN). .. The 1029 bp genomic region of the IFNGR1 gene targeted for sequencing included 841 bp of upstream sequence, plus exon1 and intron1 (Ensembl v73; http://browser.1000genomes.org ).

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol. .. Bound DNA was ligated to another adaptor N containing the Mme I restriction enzyme recognition site, and then digested with Mme I (New England Biolabs), which generates short sequence tags (16 to 17 bp, due to enzyme cut floating).

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche.

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. .. Briefly, aberrant bands revealed by SSCP analysis were excised from the gel, amplified by PCR, purified, and submitted to the Operon Biotechnologies (Tokyo, Japan) for direct sequencing.

    Article Title: Estimating the Population Mutation Rate from a de novo Assembled Bactrian Camel Genome and Cross-Species Comparison with Dromedary ESTs
    Article Snippet: Material and Methods We performed whole-genome shotgun sequencing of a single male Bactrian camel for the identification of heterozygous SNPs and the estimation of populations parameters and sequencing error rate. .. Genomic DNA (5–10 µg) was extracted from two ethylene diamine tetra-acetic acid blood samples of a single male Bactrian camel originating from the Austrian Zoo Herberstein using the DNeasy blood & tissue kit (Qiagen; Vienna, Austria).

    Article Title: “Genotype-first” approaches on a curious case of idiopathic progressive cognitive decline
    Article Snippet: Paragraph title: Exome sequencing ... Genomic DNA was extracted from peripheral blood for all family members by Qiagen DNeasy Blood & Tissue kit (Valencia, CA, USA).

    Ligation:

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol. .. Genomic DNA was digested with Bss HII followed by ligation to biotinylated adaptors and fragmented by Nla III (New England BioLabs) cleavage.

    Methylation:

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: Paragraph title: Modified DNA methylation-specific digital karyotyping ... DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol.

    Infection:

    Article Title: Shielding of a Lipooligosaccharide IgM Epitope Allows Evasion of Neutrophil-Mediated Killing of an Invasive Strain of Nontypeable Haemophilus influenzae
    Article Snippet: The NTHI R2866 marinerT7- MmeI transposon mutant library was diluted to 2 × 106 CFU/ml in HEPES-buffered RPMI containing 1 µg/ml hemin and 2 µg/ml β-NAD and incubated for 2 h in the presence of 10% normal human serum (control) or 10% normal human serum with 2 × 107 neutrophils/ml (multiplicity of infection [MOI], 0.1) in quadruplicate at 37°C (end volume, 1 ml). .. Genomic DNA was isolated using a DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s protocol.

    Generated:

    Article Title: Deep Sequencing Reveals Low Incidence of Endogenous LINE-1 Retrotransposition in Human Induced Pluripotent Stem Cells
    Article Snippet: L1Hs library construction and 454 pyrosequencing Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN). .. Briefly, a total of 3.2 µg of genomic DNA from each iPSC clone (hiPSC #7 passage 10, hiPSC #11 passage 12, hiPSC #19 passage 18) and HFF were subjected to the PCR protocol as previously described , except that a few modifications were implemented: (1) instead of using the Illumina primers and adapters, 454 primers A and B were used. (2) The library generated from each sample was barcoded differently with a molecular identifier (MID) with the corresponding primers as listed below, to allow the specific marking of the library of each sample before high-throughput sequencing. (3) The 4 libraries were pooled and subjected to 454 high-throughput sequencing using the primer A, which allows reading from the 3′UTR of the L1Hs to the genomic region of insertion, thereby allowing the direct detection of the polyA tail.

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: MMSDK libraries using Bss HII/Nla III were generated from the parental tamoxifen-sensitive cell line MCF-7/S0.5 and the four TAMR cell lines TAMR -1, TAMR -4, TAMR -7 and TAMR -8. .. DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol.

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche.

    Article Title: Shielding of a Lipooligosaccharide IgM Epitope Allows Evasion of Neutrophil-Mediated Killing of an Invasive Strain of Nontypeable Haemophilus influenzae
    Article Snippet: The NTHi R2866 marinerT7- MmeI transposon mutant library was generated as described previously for NTHi 86-028NP ( ). .. Genomic DNA was isolated using a DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s protocol.

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: DNA samples Amplicons were generated in a classical PCR reaction, containing 1 U Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), 1× Platinum Taq PCR buffer (Invitrogen), 0.2 mM dNTPs, 1.5 mM MgCl2 , 200 nM each of a forward primer and reverse primer, and 1 ul extracted sample DNA in 50 ul PCR solution. .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Article Title: Evaluation of a New Recombinant Oncolytic Vaccinia Virus Strain GLV-5b451 for Feline Mammary Carcinoma Therapy
    Article Snippet: For this purpose, DT09/06 cells or DT09/06 primary tumors were processed by DNeasy Blood & Tissue Kit (50) (Qiagen, Hilden Germany) to isolate total DNA and then analyzed by PCR, using DNA Polymerase (Phusion, Finnzymes, Espoo, Finland) and the primers for feline 12S rRNA gene (for the identification of DT09/06 cells, forward: 5′-AATTGAATCGGGCCATGAA-3′ and reverse: 5′-CGACTTATCTCCTCTTGTGGGTGT-3′ ); for murine 12S rRNA gene (as control, forward: 5′-AAATCCAACTTATATGTGAAAATTCATTGT-3′ and reverse: 5′-TGGGTCTTTAGCTATCGTCGATCAT-3′ ) . .. The designed primers generated specific fragments of 108 or 96 bp in length for cat or mouse tissues, respectively.

    DNA Sequencing:

    Article Title: Three Classes of Plasmid (47–63 kb) Carry the Type B Neurotoxin Gene Cluster of Group II Clostridium botulinum
    Article Snippet: Paragraph title: DNA Sequencing ... For strains Kapchunka B3, Kapchunka B8, DB2, and Eklund 2B, genomic DNA was prepared using the Qiagen DNEasy Blood & Tissue kit (Qiagen), from a single colony grown on TPYG agar, and libraries were prepared using the Illumina Nextera DNA Sample Prep Kit (Illumina) according to manufacturer instructions.

    Polymerase Chain Reaction:

    Article Title: Deep Sequencing Reveals Low Incidence of Endogenous LINE-1 Retrotransposition in Human Induced Pluripotent Stem Cells
    Article Snippet: L1Hs library construction and 454 pyrosequencing Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN). .. Briefly, a total of 3.2 µg of genomic DNA from each iPSC clone (hiPSC #7 passage 10, hiPSC #11 passage 12, hiPSC #19 passage 18) and HFF were subjected to the PCR protocol as previously described , except that a few modifications were implemented: (1) instead of using the Illumina primers and adapters, 454 primers A and B were used. (2) The library generated from each sample was barcoded differently with a molecular identifier (MID) with the corresponding primers as listed below, to allow the specific marking of the library of each sample before high-throughput sequencing. (3) The 4 libraries were pooled and subjected to 454 high-throughput sequencing using the primer A, which allows reading from the 3′UTR of the L1Hs to the genomic region of insertion, thereby allowing the direct detection of the polyA tail.

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche.

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: PCR reactions were performed at 94°C for 5 min, and cycled 45 times through 94°C for 30 s, 58–61°C for 40 s, and 72°C for 60 s, and elongation step of 72°C for 10 min was processed following the cyclic amplification, then size was controlled on a 2% agarose gel and with a 2100 Bioanalyzer, using Agilent DNA 1000 chips. .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. .. Briefly, aberrant bands revealed by SSCP analysis were excised from the gel, amplified by PCR, purified, and submitted to the Operon Biotechnologies (Tokyo, Japan) for direct sequencing.

    Article Title: Evaluation of a New Recombinant Oncolytic Vaccinia Virus Strain GLV-5b451 for Feline Mammary Carcinoma Therapy
    Article Snippet: .. For this purpose, DT09/06 cells or DT09/06 primary tumors were processed by DNeasy Blood & Tissue Kit (50) (Qiagen, Hilden Germany) to isolate total DNA and then analyzed by PCR, using DNA Polymerase (Phusion, Finnzymes, Espoo, Finland) and the primers for feline 12S rRNA gene (for the identification of DT09/06 cells, forward: 5′-AATTGAATCGGGCCATGAA-3′ and reverse: 5′-CGACTTATCTCCTCTTGTGGGTGT-3′ ); for murine 12S rRNA gene (as control, forward: 5′-AAATCCAACTTATATGTGAAAATTCATTGT-3′ and reverse: 5′-TGGGTCTTTAGCTATCGTCGATCAT-3′ ) . .. The PCR reaction was run in a T-Gradient Thermoblock PCR machine (Biometra, Göttingen, Germany) under the following cycling conditions: initial heat-denaturation step at 93°C for 2 min, followed by 35 cycles of 93°C/30 sec, 60°C (cat) or 55°C (mouse)/30 sec, and 72°C/45 sec.

    Article Title: Clinical Presentation, Convalescence, and Relapse of Rocky Mountain Spotted Fever in Dogs Experimentally Infected via Tick Bite
    Article Snippet: Paragraph title: PCR and Serology ... DNA was extracted from tick and blood samples using the Qiagen DNEasy Blood & Tissue kit and Flexi Gene kit (Qiagen Inc., Valencia, CA) respectively according to manufacturer's protocols.

    Binding Assay:

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol. .. Because Bss HII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allows separation of unmethylated and methylated fragments.

    DNA Extraction:

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: .. DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. ..

    Article Title: Clinical Presentation, Convalescence, and Relapse of Rocky Mountain Spotted Fever in Dogs Experimentally Infected via Tick Bite
    Article Snippet: DNA extraction and PCR procedures were carried out in separate facilities. .. DNA was extracted from tick and blood samples using the Qiagen DNEasy Blood & Tissue kit and Flexi Gene kit (Qiagen Inc., Valencia, CA) respectively according to manufacturer's protocols.

    In Vivo:

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: .. Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. Subsequently, the number of vector genomes was normalized to the amount of DNA and thus calculated per ng total DNA.

    Magnetic Beads:

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol. .. Because Bss HII only cuts unmethylated regions, binding of DNA fragments to streptavidin-conjugated magnetic beads allows separation of unmethylated and methylated fragments.

    Mutagenesis:

    Article Title: Antitumor Activity of Lenvatinib (E7080): An Angiogenesis Inhibitor That Targets Multiple Receptor Tyrosine Kinases in Preclinical Human Thyroid Cancer Models
    Article Snippet: Paragraph title: 2.11. Gene Mutation Analysis ... After overnight culture, genomic DNA was isolated from the cultured cells (K1, RO82-W-1, FTC-133, FTC-236, and FTC-238) by using the DNeasy Blood & Tissue kit (Qiagen).

    Article Title: Shielding of a Lipooligosaccharide IgM Epitope Allows Evasion of Neutrophil-Mediated Killing of an Invasive Strain of Nontypeable Haemophilus influenzae
    Article Snippet: Subsequently, 4 ml sBHI was added, and the mutant library was grown to an optical density at 620 nm (OD620 ) of ~0.2 (~4 h), and chromosomal DNA was isolated for Tn-seq analysis. .. Genomic DNA was isolated using a DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s protocol.

    Isolation:

    Article Title: Antitumor Activity of Lenvatinib (E7080): An Angiogenesis Inhibitor That Targets Multiple Receptor Tyrosine Kinases in Preclinical Human Thyroid Cancer Models
    Article Snippet: .. After overnight culture, genomic DNA was isolated from the cultured cells (K1, RO82-W-1, FTC-133, FTC-236, and FTC-238) by using the DNeasy Blood & Tissue kit (Qiagen). .. Mutation analysis for 443 mutations among 32 genes [ABL1 , AKT1 , AKT2 , APC , BRAF , CDK4 , CDKN2A , CSF1R , CTNNB1 , EGFR , FGFR1 , FGFR3 , FLT3 , HRAS , JAK2 , JAK3 , KIT , KRAS , MET , MLH1 , NRAS , P53 , PDGFRA , PIK3CA , PTEN , RB1 , RET , SRC , STK11 , VH1 ] was performed by using the MassARRAY System (Sequenom, San Diego, CA) with OncoCarta Panel versions 1.0 and 3.0.

    Article Title: Deep Sequencing Reveals Low Incidence of Endogenous LINE-1 Retrotransposition in Human Induced Pluripotent Stem Cells
    Article Snippet: .. L1Hs library construction and 454 pyrosequencing Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN). ..

    Article Title: Integrative analyses of gene expression and DNA methylation profiles in breast cancer cell line models of tamoxifen-resistance indicate a potential role of cells with stem-like properties
    Article Snippet: .. DNA was isolated from the cell lines using a DNeasy® Blood & Tissue Kit (Qiagen, Manchester, UK) according to the manufacturer’s protocol. .. Genomic DNA was digested with Bss HII followed by ligation to biotinylated adaptors and fragmented by Nla III (New England BioLabs) cleavage.

    Article Title: Shielding of a Lipooligosaccharide IgM Epitope Allows Evasion of Neutrophil-Mediated Killing of an Invasive Strain of Nontypeable Haemophilus influenzae
    Article Snippet: .. Genomic DNA was isolated using a DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s protocol. ..

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: .. Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. Subsequently, the number of vector genomes was normalized to the amount of DNA and thus calculated per ng total DNA.

    Size-exclusion Chromatography:

    Article Title: Evaluation of a New Recombinant Oncolytic Vaccinia Virus Strain GLV-5b451 for Feline Mammary Carcinoma Therapy
    Article Snippet: For this purpose, DT09/06 cells or DT09/06 primary tumors were processed by DNeasy Blood & Tissue Kit (50) (Qiagen, Hilden Germany) to isolate total DNA and then analyzed by PCR, using DNA Polymerase (Phusion, Finnzymes, Espoo, Finland) and the primers for feline 12S rRNA gene (for the identification of DT09/06 cells, forward: 5′-AATTGAATCGGGCCATGAA-3′ and reverse: 5′-CGACTTATCTCCTCTTGTGGGTGT-3′ ); for murine 12S rRNA gene (as control, forward: 5′-AAATCCAACTTATATGTGAAAATTCATTGT-3′ and reverse: 5′-TGGGTCTTTAGCTATCGTCGATCAT-3′ ) . .. The PCR reaction was run in a T-Gradient Thermoblock PCR machine (Biometra, Göttingen, Germany) under the following cycling conditions: initial heat-denaturation step at 93°C for 2 min, followed by 35 cycles of 93°C/30 sec, 60°C (cat) or 55°C (mouse)/30 sec, and 72°C/45 sec.

    Purification:

    Article Title: Three Classes of Plasmid (47–63 kb) Carry the Type B Neurotoxin Gene Cluster of Group II Clostridium botulinum
    Article Snippet: DNA Sequencing For strains CDC 3875, IFR 05/025, Colworth BL151, Kapchunka B2, CDC 5900, and CDC 3897, genomic DNA was extracted from 10-ml TPYG broth cultures using standard Gram positive cell lysis procedures followed by phenol–chloroform purification ( ). .. For strains Kapchunka B3, Kapchunka B8, DB2, and Eklund 2B, genomic DNA was prepared using the Qiagen DNEasy Blood & Tissue kit (Qiagen), from a single colony grown on TPYG agar, and libraries were prepared using the Illumina Nextera DNA Sample Prep Kit (Illumina) according to manufacturer instructions.

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. PCR products were visualized on 1% agarose gel and extracted with the Qiagen PCR purification Kit.

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: Amplicons were purified by using Qiagen QIAquick Gel Extraction Kit (Qiagen, Venlo, Netherlands). .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Article Title: Loss of PTEN expression is an independent predictor of favourable survival in endometrial carcinomas
    Article Snippet: DNA extraction and PTEN mutational analysis Genomic DNA was extracted from tumour areas of formalin-fixed, paraffin-embedded archival tissues with a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. .. Briefly, aberrant bands revealed by SSCP analysis were excised from the gel, amplified by PCR, purified, and submitted to the Operon Biotechnologies (Tokyo, Japan) for direct sequencing.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Sensitive Real-Time PCR Detection of Pathogenic Leptospira spp. and a Comparison of Nucleic Acid Amplification Methods for the Diagnosis of Leptospirosis
    Article Snippet: DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD) according to the manufacturer's recommendations. .. Samples were tested using the UFI assay, pathogenic rtPCR, and the reference 16S rtPCR during a single freeze-thaw cycle.

    Gel Extraction:

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: Amplicons were purified by using Qiagen QIAquick Gel Extraction Kit (Qiagen, Venlo, Netherlands). .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Agarose Gel Electrophoresis:

    Article Title: Mitogenomics of the Old World monkey tribe Papionini
    Article Snippet: Laboratory methods Genomic DNA from blood and tissue samples was extracted using the Qiagen DNeasy Blood & Tissue Kit following the supplier’s recommendations. .. PCR products were visualized on 1% agarose gel and extracted with the Qiagen PCR purification Kit.

    Article Title: Nuclease-Assisted Suppression of Human DNA Background in Sepsis
    Article Snippet: PCR reactions were performed at 94°C for 5 min, and cycled 45 times through 94°C for 30 s, 58–61°C for 40 s, and 72°C for 60 s, and elongation step of 72°C for 10 min was processed following the cyclic amplification, then size was controlled on a 2% agarose gel and with a 2100 Bioanalyzer, using Agilent DNA 1000 chips. .. DNA has been extracted using the Qiagen DNeasy Blood & Tissue Kit.

    Shotgun Sequencing:

    Article Title: Estimating the Population Mutation Rate from a de novo Assembled Bactrian Camel Genome and Cross-Species Comparison with Dromedary ESTs
    Article Snippet: Material and Methods We performed whole-genome shotgun sequencing of a single male Bactrian camel for the identification of heterozygous SNPs and the estimation of populations parameters and sequencing error rate. .. Genomic DNA (5–10 µg) was extracted from two ethylene diamine tetra-acetic acid blood samples of a single male Bactrian camel originating from the Austrian Zoo Herberstein using the DNeasy blood & tissue kit (Qiagen; Vienna, Austria).

    Plasmid Preparation:

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. Subsequently, the number of vector genomes was normalized to the amount of DNA and thus calculated per ng total DNA.

    Software:

    Article Title: Insights into the possible role of IFNG and IFNGR1 in Kala-azar and Post Kala-azar Dermal Leishmaniasis in Sudanese patients
    Article Snippet: Sequencing of IFNGR1 Genomic DNA was extracted from PBMCs using DNeasy Blood & Tissue Kit in accordance with the manufacturer’s instruction (QIAGEN). .. This target region was amplified from 30 PKDL DNA samples using primers: 5′AAACAGTAGGGCGGGGTAAG3′ and 5′AAATCAAATCGGCTTGACCA3′ designed using primer 3 software ( http://frodo.wi.mit.edu/primer3/ ).

    Article Title: Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors
    Article Snippet: Evaluation of transduction efficiency by qPCR To determine transduction efficiency in vivo , DNA was isolated from tissue samples (DNeasy Blood & Tissue Kit, Qiagen), followed by qPCR analysis using egfp - or mAP2.2-promoter-specific TaqMan primer-probe sets ( ). .. All reactions were performed in triplicates and analyzed using SDS2.4 software (Applied Biosystems).

    Sample Prep:

    Article Title: Three Classes of Plasmid (47–63 kb) Carry the Type B Neurotoxin Gene Cluster of Group II Clostridium botulinum
    Article Snippet: .. For strains Kapchunka B3, Kapchunka B8, DB2, and Eklund 2B, genomic DNA was prepared using the Qiagen DNEasy Blood & Tissue kit (Qiagen), from a single colony grown on TPYG agar, and libraries were prepared using the Illumina Nextera DNA Sample Prep Kit (Illumina) according to manufacturer instructions. .. All genome sequencing was carried out using the Illumina MiSeq platform.

    Article Title: Estimating the Population Mutation Rate from a de novo Assembled Bactrian Camel Genome and Cross-Species Comparison with Dromedary ESTs
    Article Snippet: Genomic DNA (5–10 µg) was extracted from two ethylene diamine tetra-acetic acid blood samples of a single male Bactrian camel originating from the Austrian Zoo Herberstein using the DNeasy blood & tissue kit (Qiagen; Vienna, Austria). .. Sequencing library preparation (Genomic DNA Sample Prep Kit; Illumina) was performed according to the manufacturer’s protocol.

    Lysis:

    Article Title: Three Classes of Plasmid (47–63 kb) Carry the Type B Neurotoxin Gene Cluster of Group II Clostridium botulinum
    Article Snippet: DNA Sequencing For strains CDC 3875, IFR 05/025, Colworth BL151, Kapchunka B2, CDC 5900, and CDC 3897, genomic DNA was extracted from 10-ml TPYG broth cultures using standard Gram positive cell lysis procedures followed by phenol–chloroform purification ( ). .. For strains Kapchunka B3, Kapchunka B8, DB2, and Eklund 2B, genomic DNA was prepared using the Qiagen DNEasy Blood & Tissue kit (Qiagen), from a single colony grown on TPYG agar, and libraries were prepared using the Illumina Nextera DNA Sample Prep Kit (Illumina) according to manufacturer instructions.

    High Throughput Screening Assay:

    Article Title: Deep Sequencing Reveals Low Incidence of Endogenous LINE-1 Retrotransposition in Human Induced Pluripotent Stem Cells
    Article Snippet: L1Hs library construction and 454 pyrosequencing Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN). .. Briefly, a total of 3.2 µg of genomic DNA from each iPSC clone (hiPSC #7 passage 10, hiPSC #11 passage 12, hiPSC #19 passage 18) and HFF were subjected to the PCR protocol as previously described , except that a few modifications were implemented: (1) instead of using the Illumina primers and adapters, 454 primers A and B were used. (2) The library generated from each sample was barcoded differently with a molecular identifier (MID) with the corresponding primers as listed below, to allow the specific marking of the library of each sample before high-throughput sequencing. (3) The 4 libraries were pooled and subjected to 454 high-throughput sequencing using the primer A, which allows reading from the 3′UTR of the L1Hs to the genomic region of insertion, thereby allowing the direct detection of the polyA tail.

    Staining:

    Article Title: Evaluation of a New Recombinant Oncolytic Vaccinia Virus Strain GLV-5b451 for Feline Mammary Carcinoma Therapy
    Article Snippet: Portions of the tissues were paraffin-embedded, sectioned and stained with hematoxylin and eosin (H & E) to identify the tumor type. .. For this purpose, DT09/06 cells or DT09/06 primary tumors were processed by DNeasy Blood & Tissue Kit (50) (Qiagen, Hilden Germany) to isolate total DNA and then analyzed by PCR, using DNA Polymerase (Phusion, Finnzymes, Espoo, Finland) and the primers for feline 12S rRNA gene (for the identification of DT09/06 cells, forward: 5′-AATTGAATCGGGCCATGAA-3′ and reverse: 5′-CGACTTATCTCCTCTTGTGGGTGT-3′ ); for murine 12S rRNA gene (as control, forward: 5′-AAATCCAACTTATATGTGAAAATTCATTGT-3′ and reverse: 5′-TGGGTCTTTAGCTATCGTCGATCAT-3′ ) .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Qiagen dneasy blood and tissue extraction kit
    Sensitivity of recombinase polymerase amplification–lateral flow (RPA-LF) to detect Leishmania infantum compared with real-time polymerase chain reaction (PCR) used as gold standard. Tenfold serial dilutions of L. infantum promastigotes in dog blood were extracted using <t>Qiagen</t> ® <t>DNeasy</t> blood and tissue kit and detected by real-time quantitative PCR (SYBRgreen) or RPA-LF. Parasite dilutions: 1 = 10 5 , 2 = 10 4 , 3 = 10 3 , 4 = 10 2 , 5 = 10, 6 = 1, and 7 = 0.1 parasites and Bl = uninfected dog blood. The top band is the control band; the lower band is the test band. This is a representative figure of two similar assays.
    Dneasy Blood And Tissue Extraction Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 2918 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dneasy blood and tissue extraction kit/product/Qiagen
    Average 95 stars, based on 2918 article reviews
    Price from $9.99 to $1999.99
    dneasy blood and tissue extraction kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Sensitivity of recombinase polymerase amplification–lateral flow (RPA-LF) to detect Leishmania infantum compared with real-time polymerase chain reaction (PCR) used as gold standard. Tenfold serial dilutions of L. infantum promastigotes in dog blood were extracted using Qiagen ® DNeasy blood and tissue kit and detected by real-time quantitative PCR (SYBRgreen) or RPA-LF. Parasite dilutions: 1 = 10 5 , 2 = 10 4 , 3 = 10 3 , 4 = 10 2 , 5 = 10, 6 = 1, and 7 = 0.1 parasites and Bl = uninfected dog blood. The top band is the control band; the lower band is the test band. This is a representative figure of two similar assays.

    Journal: The American Journal of Tropical Medicine and Hygiene

    Article Title: A Novel Molecular Test to Diagnose Canine Visceral Leishmaniasis at the Point of Care

    doi: 10.4269/ajtmh.15-0145

    Figure Lengend Snippet: Sensitivity of recombinase polymerase amplification–lateral flow (RPA-LF) to detect Leishmania infantum compared with real-time polymerase chain reaction (PCR) used as gold standard. Tenfold serial dilutions of L. infantum promastigotes in dog blood were extracted using Qiagen ® DNeasy blood and tissue kit and detected by real-time quantitative PCR (SYBRgreen) or RPA-LF. Parasite dilutions: 1 = 10 5 , 2 = 10 4 , 3 = 10 3 , 4 = 10 2 , 5 = 10, 6 = 1, and 7 = 0.1 parasites and Bl = uninfected dog blood. The top band is the control band; the lower band is the test band. This is a representative figure of two similar assays.

    Article Snippet: DNA was isolated from blood or tissue samples using the QIAGEN DNeasy blood and tissue extraction kit (Qiagen, Valencia, CA) following the instructions of the vendor.

    Techniques: Recombinase Polymerase Amplification, Flow Cytometry, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Agarose gel electrophoresis of DNA isolated from cadaver tissues using the DNeasy Blood Tissue Kit. MW = Quick-load 1 kb DNA Ladder (New England BioLabs). Lane 1: Liver without RNAse treatment. Lane 2: Heart without RNAse treatment. Lane 3: Liver with RNAse treatment. Lane 4: Heart with RNAse treatment. Lane 5: Skeletal Muscle with RNAse treatment. Lane 6: Skin with RNAse treatment

    Journal: BMC Medical Genomics

    Article Title: The Anatomy to Genomics (ATG) Start Genetics medical school initiative: incorporating exome sequencing data from cadavers used for Anatomy instruction into the first year curriculum

    doi: 10.1186/s12920-016-0223-4

    Figure Lengend Snippet: Agarose gel electrophoresis of DNA isolated from cadaver tissues using the DNeasy Blood Tissue Kit. MW = Quick-load 1 kb DNA Ladder (New England BioLabs). Lane 1: Liver without RNAse treatment. Lane 2: Heart without RNAse treatment. Lane 3: Liver with RNAse treatment. Lane 4: Heart with RNAse treatment. Lane 5: Skeletal Muscle with RNAse treatment. Lane 6: Skin with RNAse treatment

    Article Snippet: Samples of tissue (1 cm3 ) were finely minced using a scalpel blade and then subjected to DNA isolation using either the QIAamp DNA FFPE Tissue Kit or the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Inc.).

    Techniques: Agarose Gel Electrophoresis, Isolation

    Agarose gel electrophoresis of DNA isolated from cadaver tissues. MW = GeneRuler 1 kb Plus DNA Ladder (Thermo Fisher Scientific). Lane 1: Heart DNA extracted with DNeasy Blood Tissue Kit. Lane 2: Liver DNA extracted with DNeasy Blood Tissue Kit. Lane 3: Heart DNA extracted with FFPE kit. Lane 4: Liver DNA extracted with FFPE kit

    Journal: BMC Medical Genomics

    Article Title: The Anatomy to Genomics (ATG) Start Genetics medical school initiative: incorporating exome sequencing data from cadavers used for Anatomy instruction into the first year curriculum

    doi: 10.1186/s12920-016-0223-4

    Figure Lengend Snippet: Agarose gel electrophoresis of DNA isolated from cadaver tissues. MW = GeneRuler 1 kb Plus DNA Ladder (Thermo Fisher Scientific). Lane 1: Heart DNA extracted with DNeasy Blood Tissue Kit. Lane 2: Liver DNA extracted with DNeasy Blood Tissue Kit. Lane 3: Heart DNA extracted with FFPE kit. Lane 4: Liver DNA extracted with FFPE kit

    Article Snippet: Samples of tissue (1 cm3 ) were finely minced using a scalpel blade and then subjected to DNA isolation using either the QIAamp DNA FFPE Tissue Kit or the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Inc.).

    Techniques: Agarose Gel Electrophoresis, Isolation, Formalin-fixed Paraffin-Embedded

    DNeasy treated samples. (a) Two LightCycler PCR runs, first one with standard dilution series of human Hep2 DNA before (flat negative curves) and after DNeasy (indicated with squares and triangles), showed on the left and second with DNA free water before (marked with squares) and after DNeasy (triangles) on the right. (b) Melting curve analysis of DNeasy treated H 2 O (triangles), Hep2 DNA (squares) and clinical sample.

    Journal: BMC Microbiology

    Article Title: Development of real-time PCR for detection of Mycoplasma hominis

    doi: 10.1186/1471-2180-4-35

    Figure Lengend Snippet: DNeasy treated samples. (a) Two LightCycler PCR runs, first one with standard dilution series of human Hep2 DNA before (flat negative curves) and after DNeasy (indicated with squares and triangles), showed on the left and second with DNA free water before (marked with squares) and after DNeasy (triangles) on the right. (b) Melting curve analysis of DNeasy treated H 2 O (triangles), Hep2 DNA (squares) and clinical sample.

    Article Snippet: Twenty-five μl of each dilution and DNA free double distilled water were then treated with DNeasy™ Tissue Kit (QIAGEN GmbH, Hilden, Germany) procedure.

    Techniques: Polymerase Chain Reaction

    Recovery of nucleic acids and polyphosphate (polyP) using various purification methods. Known quantities of bacteriophage lambda DNA (DNA, striped bars), polyG (RNA, white bars), or long-chain polyP (black bars) were processed for nucleic acid purification using Qiaquick, DNeasy, or TRIzol kits, following the manufacturer’s instructions, or with phenol/chloroform extraction. Nucleic acid recovery was quantified using A 260 and polyP recovery by digestion with PPX1 and PiBlue assay. Results are plotted as percent of the input amount in each experiment. For all experiments except the Qiaquick kits, the three samples were: (A) DNA alone (5 µg lambda DNA); (B) RNA alone (5 µg polyG); (C) 5 µg polyP alone; (D) a mixture of 5 µg polyP plus 5 µg of DNA; or (E) 5 µg polyP plus 5 µg of RNA (E) . Experiments with the Qiaquick kit employed 2.5 µg of polyP and/or nucleic acid. Data are mean ± SEM ( n = 3).

    Journal: Frontiers in Medicine

    Article Title: Ability of Polyphosphate and Nucleic Acids to Trigger Blood Clotting: Some Observations and Caveats

    doi: 10.3389/fmed.2018.00107

    Figure Lengend Snippet: Recovery of nucleic acids and polyphosphate (polyP) using various purification methods. Known quantities of bacteriophage lambda DNA (DNA, striped bars), polyG (RNA, white bars), or long-chain polyP (black bars) were processed for nucleic acid purification using Qiaquick, DNeasy, or TRIzol kits, following the manufacturer’s instructions, or with phenol/chloroform extraction. Nucleic acid recovery was quantified using A 260 and polyP recovery by digestion with PPX1 and PiBlue assay. Results are plotted as percent of the input amount in each experiment. For all experiments except the Qiaquick kits, the three samples were: (A) DNA alone (5 µg lambda DNA); (B) RNA alone (5 µg polyG); (C) 5 µg polyP alone; (D) a mixture of 5 µg polyP plus 5 µg of DNA; or (E) 5 µg polyP plus 5 µg of RNA (E) . Experiments with the Qiaquick kit employed 2.5 µg of polyP and/or nucleic acid. Data are mean ± SEM ( n = 3).

    Article Snippet: Comparison of PolyP Recovery Rates Using Nucleic Acid Purification Kits DNeasy Blood and Tissue kit (Qiagen), RNeasy Mini kit (Qiagen), Qiaquick PCR Purification kit (Qiagen), TRIzol Reagent (Invitrogen), and phenol/chloroform extraction were evaluated for their recovery rates when used to “purify” samples consisting of nucleic acid alone (either phage lambda DNA or polyG), or nucleic acid mixed with long-chain polyP.

    Techniques: Purification, Lambda DNA Preparation, Nucleic Acid Purification