dnasei  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    DNase I
    Description:
    DNase I Deoxyribonuclease I digests single and double stranded DNA to oligodeoxyribonucleotides containing a 5 phosphate Ribonuclease has been reduced to non detectable levels ApplicationsDNase I is suitable for removing DNA from protein preparations nick translating DNA and generating random fragments for dideoxy sequencing NOTE for removing DNA from RNA preparations use Amplification Grade DNase I Cat No 18068 015 SourceDNase I is purified from bovine pancreas Specific activityThe specific activity of DNase I is typically in the range of 10 000 25 000 units mg
    Catalog Number:
    18047019
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Buy from Supplier


    Structured Review

    Thermo Fisher dnasei
    DNase I Deoxyribonuclease I digests single and double stranded DNA to oligodeoxyribonucleotides containing a 5 phosphate Ribonuclease has been reduced to non detectable levels ApplicationsDNase I is suitable for removing DNA from protein preparations nick translating DNA and generating random fragments for dideoxy sequencing NOTE for removing DNA from RNA preparations use Amplification Grade DNase I Cat No 18068 015 SourceDNase I is purified from bovine pancreas Specific activityThe specific activity of DNase I is typically in the range of 10 000 25 000 units mg
    https://www.bioz.com/result/dnasei/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dnasei - by Bioz Stars, 2021-04
    99/100 stars

    Images

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The NRG1 gene is frequently silenced by methylation in breast cancers and is a strong candidate for the 8p tumour suppressor gene
    Article Snippet: Purified luminal and myoepithelial cells were prepared from primary cultures initiated from organoids that had been trypsinised and fractionated using antibodies and magnetic bead technology ( ). .. RT-PCR RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA), treated with DNaseI (DNA-free kit, Ambion Division, Applied Biosystems, Foster City, CA) to remove genomic DNA, and was reverse-transcribed using oligo-dT primers and Superscript III (Invitrogen). .. Real-time RT-PCR for NRG1 exons 4 to 6 was performed using primers HrgPCRE4F1 (CATTAACAAAGCATCACTGGCT) and hrg3_6R1 (TGAAGAAGTATTTGCTCCTT); primers for exon 8 were HRGE8F1, CTACATCTACATCCACCACTGG and HRGE8R2, TTGCACAAGTATCTCGAGGGGT (chr8:32705009+32705138).

    Purification:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Transfection:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Plasmid Preparation:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Amplification:

    Article Title: Allele-specific long-distance regulation dictates IL-32 isoform switching and mediates susceptibility to HIV-1
    Article Snippet: cDNA analysis Total cellular RNA was isolated from the different cell lines with TriPure Isolation Reagent according to the manufacturer’s instructions (Roche Diagnostics). .. Subsequent DNase I digestion was performed with amplification grade DNase I (Invitrogen). .. The reverse-transcriptase reaction was performed using SuperScript II RNase H reverse transcriptase (Invitrogen) according to the manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: TRIM17 and TRIM28 antagonistically regulate the ubiquitination and anti-apoptotic activity of BCL2A1
    Article Snippet: Secondary amplification using overhang sequences and Illumina MISeq sequencing was done as previously described [ ]. .. RNA preparation and real-time quantitative RT-PCR Total RNA was extracted using the RNAqueous® kit (Ambion) and treated with DNase I from the DNA-free™ kit (Ambion) according to manufacturer’s instructions. .. RNA was used to perform a two-step reverse-transcription polymerase chain reaction (RT-PCR) as previously described [ ].

    Incubation:

    Article Title: Neisseria Prophage Repressor Implicated in Gonococcal Pathogenesis
    Article Snippet: The footprinting assay was carried out in a 50-μl reaction volume in which the PCR product (2,000 ng) was added to the binding buffer used for EMSA with 1 μg poly(dI-dC) and various concentrations of the Npr. .. After 30 min of incubation at room temperature, 2 U of DNase I (Ambion, Applied Biosystems) was added, and DNA digestion was carried out at 37°C for 2 min or 3 min. ..

    Immunoprecipitation:

    Article Title: SOX2 regulates common and specific stem cell features in the CNS and endoderm derived organs
    Article Snippet: .. To establish DNA dependency of the protein-protein interactions 100U/ml DNase I (Invitrogen) was added to the lysate for 30 min at 4°C before immunoprecipitation. .. SOX2 binding sites are shared more within germ layers than between them. ( A ) Percentage of iI67+ cells that are SOX2+ in the E11.5 cortex, spinal cord, stomach and lung/esophagus. ( B ) FACS plots of SOX2+ cells (encircled) sorted from dissected E11.5 SOX2-GFP cortices, spinal cords, stomachs and lung/esophagus. ( C ) Seqminer heat maps showing raw reads from all SOX2 ChIP-seqs (singlets or merged replicates) within peaks called from cortex, spinal cord, stomach or lung/esophagus SOX2 ChIP-seqs and the corresponding percentage of peaks bound in all tissues based on clustering. ( D ) The average proportion of SOX2 ChIP-seq reads derived from cortex, spinal cord, stomach and lung/esophagus experiments within the different SOX2 peak sets. (TIF) (3.0M, tif)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher alexa fluor 594 conjugated dnasei
    Role of p0071 in Neuro-2a neuroblastoma derived cells. ( A ) Immunofluorescence studies of differentiated Neuro-2a cells showing p0071 localization. F-actin was labeled with <t>Alexa</t> Fluor 594-conjugated Phalloidin. Bar, 20 µm. ( B ) Immunofluorescence
    Alexa Fluor 594 Conjugated Dnasei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alexa fluor 594 conjugated dnasei/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    alexa fluor 594 conjugated dnasei - by Bioz Stars, 2021-04
    94/100 stars
      Buy from Supplier

    97
    Thermo Fisher dnasei treatment
    Expression patterns of Ct PAL and Ct CHS genes after wounding (A) and during salinity stress (B) Samplings were carried out at 0, 3, 6, 12, 24 and 48 hat. <t>RNAs</t> were extracted from all seedlings and treated with <t>DNaseI.</t> Subsequently, RNAs were reverse transcribed to corresponding cDNAs. Different PCR products intensities were referred to as temporal expression level of the genes. 18S rRNA transcription levels were considered as internal house-keeping gene control. Sizes of amplicons: Ct PAL: 267 bp; Ct CHS 559 bp; 18S rRNA: 199 bp.
    Dnasei Treatment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnasei treatment/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dnasei treatment - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    97
    Thermo Fisher total dnasei treated
    Expression of the NAT transcripts is increased in dcl1 - 7 fwf2 and dcl3 - 1 mutants . Expression was examined by quantitative <t>RT-PCR</t> and Actin2 was used as an internal control. Total RNA (5 μg) was treated with <t>DNaseI</t> and then subjected to reverse transcription. Error bars indicate standard deviations derived from three technical replicates. Similar results were obtained from two biological replicates.
    Total Dnasei Treated, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/total dnasei treated/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    total dnasei treated - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    Image Search Results


    Role of p0071 in Neuro-2a neuroblastoma derived cells. ( A ) Immunofluorescence studies of differentiated Neuro-2a cells showing p0071 localization. F-actin was labeled with Alexa Fluor 594-conjugated Phalloidin. Bar, 20 µm. ( B ) Immunofluorescence

    Journal: RNA

    Article Title: FMRP regulates actin filament organization via the armadillo protein p0071

    doi: 10.1261/rna.037945.112

    Figure Lengend Snippet: Role of p0071 in Neuro-2a neuroblastoma derived cells. ( A ) Immunofluorescence studies of differentiated Neuro-2a cells showing p0071 localization. F-actin was labeled with Alexa Fluor 594-conjugated Phalloidin. Bar, 20 µm. ( B ) Immunofluorescence

    Article Snippet: Fmr1+ or Fmr1 − cells (5 × 103 each) were allowed to adhere overnight in 96-well plates, and then fixed and processed for F-actin labeling by Alexa Fluor 594-conjugated Phalloidin (Invitrogen) or for G-actin labeling by Alexa Fluor 594-conjugated DNaseI (Invitrogen).

    Techniques: Derivative Assay, Immunofluorescence, Labeling

    Expression patterns of Ct PAL and Ct CHS genes after wounding (A) and during salinity stress (B) Samplings were carried out at 0, 3, 6, 12, 24 and 48 hat. RNAs were extracted from all seedlings and treated with DNaseI. Subsequently, RNAs were reverse transcribed to corresponding cDNAs. Different PCR products intensities were referred to as temporal expression level of the genes. 18S rRNA transcription levels were considered as internal house-keeping gene control. Sizes of amplicons: Ct PAL: 267 bp; Ct CHS 559 bp; 18S rRNA: 199 bp.

    Journal: Bioscience Reports

    Article Title: Differential inductions of phenylalanine ammonia-lyase and chalcone synthase during wounding, salicylic acid treatment, and salinity stress in safflower, Carthamus tinctorius

    doi: 10.1042/BSR20140026

    Figure Lengend Snippet: Expression patterns of Ct PAL and Ct CHS genes after wounding (A) and during salinity stress (B) Samplings were carried out at 0, 3, 6, 12, 24 and 48 hat. RNAs were extracted from all seedlings and treated with DNaseI. Subsequently, RNAs were reverse transcribed to corresponding cDNAs. Different PCR products intensities were referred to as temporal expression level of the genes. 18S rRNA transcription levels were considered as internal house-keeping gene control. Sizes of amplicons: Ct PAL: 267 bp; Ct CHS 559 bp; 18S rRNA: 199 bp.

    Article Snippet: Next to DNaseI treatment of RNA samples, 1 μg of RNAs, using RevertAid First Strand cDNA Synthesis Kit (Thermo SCIENTIFIC, # K1691), was reverse transcribed to corresponding cDNAs, which were later used as templates for semi-quantitative RT–PCR.

    Techniques: Expressing, HAT Assay, Polymerase Chain Reaction

    Expression patterns of Ct PAL and Ct CHS genes after SA treatment with 0.1 mM (A) and 1 mM (B) concentrations Samplings were done at 0, 3, 6, 12, 24 and 48 hat. RNAs were extracted from all seedlings and treated with DNaseI. Subsequently, RNAs were reverse transcribed to corresponding cDNAs. Different PCR products intensities were referred to as temporal expression level of the genes. 18S rRNA transcription levels were considered as internal house-keeping gene control. Sizes of amplicons: Ct PAL: 267 bp; Ct CHS 559 bp; 18S rRNA: 199 bp.

    Journal: Bioscience Reports

    Article Title: Differential inductions of phenylalanine ammonia-lyase and chalcone synthase during wounding, salicylic acid treatment, and salinity stress in safflower, Carthamus tinctorius

    doi: 10.1042/BSR20140026

    Figure Lengend Snippet: Expression patterns of Ct PAL and Ct CHS genes after SA treatment with 0.1 mM (A) and 1 mM (B) concentrations Samplings were done at 0, 3, 6, 12, 24 and 48 hat. RNAs were extracted from all seedlings and treated with DNaseI. Subsequently, RNAs were reverse transcribed to corresponding cDNAs. Different PCR products intensities were referred to as temporal expression level of the genes. 18S rRNA transcription levels were considered as internal house-keeping gene control. Sizes of amplicons: Ct PAL: 267 bp; Ct CHS 559 bp; 18S rRNA: 199 bp.

    Article Snippet: Next to DNaseI treatment of RNA samples, 1 μg of RNAs, using RevertAid First Strand cDNA Synthesis Kit (Thermo SCIENTIFIC, # K1691), was reverse transcribed to corresponding cDNAs, which were later used as templates for semi-quantitative RT–PCR.

    Techniques: Expressing, HAT Assay, Polymerase Chain Reaction

    Expression of the NAT transcripts is increased in dcl1 - 7 fwf2 and dcl3 - 1 mutants . Expression was examined by quantitative RT-PCR and Actin2 was used as an internal control. Total RNA (5 μg) was treated with DNaseI and then subjected to reverse transcription. Error bars indicate standard deviations derived from three technical replicates. Similar results were obtained from two biological replicates.

    Journal: Genome Biology

    Article Title: Genome-wide analysis of plant nat-siRNAs reveals insights into their distribution, biogenesis and function

    doi: 10.1186/gb-2012-13-3-r20

    Figure Lengend Snippet: Expression of the NAT transcripts is increased in dcl1 - 7 fwf2 and dcl3 - 1 mutants . Expression was examined by quantitative RT-PCR and Actin2 was used as an internal control. Total RNA (5 μg) was treated with DNaseI and then subjected to reverse transcription. Error bars indicate standard deviations derived from three technical replicates. Similar results were obtained from two biological replicates.

    Article Snippet: Quantitative RT-PCR analysis of small RNA targets For QRT-PCR analysis, 5 μg total DNaseI-treated (Invitrogen, Grand Island, NY, USA) RNA was used for synthesizing cDNA using Oligo dT and SuperScript II (Invitrogen).

    Techniques: Expressing, Quantitative RT-PCR, Derivative Assay

    Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Journal: Nucleic Acids Research

    Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7

    doi: 10.1093/nar/gky644

    Figure Lengend Snippet: Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Article Snippet: To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C.

    Techniques: Generated, Polyacrylamide Gel Electrophoresis, Migration, Electrophoretic Mobility Shift Assay, Isolation, Fluorescence, Marker, Ligation