Structured Review

Promega dnaase i
Dnaase I, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dnaase i/product/Promega
Average 92 stars, based on 3 article reviews
Price from $9.99 to $1999.99
dnaase i - by Bioz Stars, 2020-04
92/100 stars

Images

Related Articles

Centrifugation:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction. .. The reaction mixtures were incubated at 65°C for 15 min and then placed on ice for 10 min. After a 10-min centrifugation at 16,000 × g in a microcentrifuge, the supernatants were transferred to new tubes.

Amplification:

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: DNase I footprinting assays Templates for DNase I footprinting were amplified by PCR using a FAM-labeled primer pair (6-FAM-0560-probe-F: GCCCATCACGATGCGCTCCACCGC and 0560-probe-R: CGAACTCAAGATCCAGCGATTCAG). .. After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C.

Binding Assay:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: .. Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 . .. DNase I activity was terminated after 2 min by the addition of stop solution (0.4 M sodium acetate, 0.2% SDS, 10 mM EDTA, 50 μg ml−1 Saccharomyces cerevisiae tRNA, and 10 μg of proteinase K).

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: For each assay, probes (200 g) were incubated with different amounts of Rv2887 in a total volume of 40 µl EMSA binding buffer (Beyotime, China). .. After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C.

Article Title: Purification and In Vitro Characterization of the Serratia marcescens NucC Protein, a Zinc-Binding Transcription Factor Homologous to P2 Ogr
Article Snippet: Binding reaction mixtures were incubated for 2 h at 37°C prior to DNase I digestion. .. Partial DNA digestion was performed by adding 80 μl of DNase footprinting buffer containing 0.03 U of DNase I (Promega, Madison, Wis.) per ml and 0.1 mM CaCl2 and incubating the mixture for 20 s at 37°C.

Polymerase Chain Reaction:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Both DNA fragments were generated by PCR and were 32 P labeled on the 5′ end of the template strand. .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: DNase I footprinting assays Templates for DNase I footprinting were amplified by PCR using a FAM-labeled primer pair (6-FAM-0560-probe-F: GCCCATCACGATGCGCTCCACCGC and 0560-probe-R: CGAACTCAAGATCCAGCGATTCAG). .. After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C.

Footprinting:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: Paragraph title: DNase I footprinting assays. ... Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 .

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Paragraph title: DNase I footprinting. ... Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: Paragraph title: DNase I footprinting assays ... After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C.

Article Title: Purification and In Vitro Characterization of the Serratia marcescens NucC Protein, a Zinc-Binding Transcription Factor Homologous to P2 Ogr
Article Snippet: .. Partial DNA digestion was performed by adding 80 μl of DNase footprinting buffer containing 0.03 U of DNase I (Promega, Madison, Wis.) per ml and 0.1 mM CaCl2 and incubating the mixture for 20 s at 37°C. ..

Autoradiography:

Article Title: NADP, corepressor for the Bacillus catabolite control protein CcpA
Article Snippet: Two units of DNase I (Promega) were added to the 30 μl of reaction at room temperature. .. The DNase I digests were resolved in a 8% sequencing gel and bands were detected by autoradiography ( ).

Incubation:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 . .. After 10 min of incubation at 50°C, the mixtures were extracted with phenol-chloroform and DNA in the aqueous phase was ethanol precipitated and analyzed on 6% polyacrylamide-7 M urea gels.

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: TFIID and TFIIA (in amounts indicated in figure legends) were incubated with promoter DNA (at final concentrations indicated in the figure legends) for 20 min at 30°C under buffer conditions that were identical to those used for transcription in a reaction volume of 10 μl. .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: .. After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C. .. The reaction was stopped by adding 140 µl DNase I stop solution (200 mM unbuffered sodium acetate, 30 mM EDTA and 0.15% SDS).

Article Title: NADP, corepressor for the Bacillus catabolite control protein CcpA
Article Snippet: After CcpA was incubated with combinations of HPr-P (Ser-46) and 45 gylcolytic metabolites, nucleotides and cofactors in TGED buffer (50 mM Tris⋅HCl, pH 8.0/10% glycerol/0.1 mM EDTA/0.1 mM DTT) for 5 min, 1 ng of amyO (0.5 nM final concentration) was added, allowing formation of the amyO –CcpA complex. .. Two units of DNase I (Promega) were added to the 30 μl of reaction at room temperature.

Article Title: Purification and In Vitro Characterization of the Serratia marcescens NucC Protein, a Zinc-Binding Transcription Factor Homologous to P2 Ogr
Article Snippet: Binding reaction mixtures were incubated for 2 h at 37°C prior to DNase I digestion. .. Partial DNA digestion was performed by adding 80 μl of DNase footprinting buffer containing 0.03 U of DNase I (Promega, Madison, Wis.) per ml and 0.1 mM CaCl2 and incubating the mixture for 20 s at 37°C.

Article Title: TetR-Type Regulator SLCG_2919 Is a Negative Regulator of Lincomycin Biosynthesis in Streptomyces lincolnensis
Article Snippet: .. The mixture was incubated at 25°C for 60 s and terminated by addition of DNase I stop solution and heating for 10 min at 65°C. .. DNA samples were analyzed with a 3730XL DNA genetic analyzer (Applied Biosystems) after purification, and data analyses were performed using the GeneMarker software program v2.2.

Labeling:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: For preparation of DNA fragments, plasmids pRD555 (wt) and pRD572 (ΔIR2) were first digested with EcoRI and then end labeled with T4 polynucleotide kinase and [γ-32 P] ATP, followed by digestion with BamHI to release the promoter fragments. .. Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 .

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Both DNA fragments were generated by PCR and were 32 P labeled on the 5′ end of the template strand. .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Article Title: Purification and In Vitro Characterization of the Serratia marcescens NucC Protein, a Zinc-Binding Transcription Factor Homologous to P2 Ogr
Article Snippet: Primer 1212+6n was end labeled with [γ-32 P]ATP and polynucleotide kinase so that the fragment was labeled on the template strand. .. Partial DNA digestion was performed by adding 80 μl of DNase footprinting buffer containing 0.03 U of DNase I (Promega, Madison, Wis.) per ml and 0.1 mM CaCl2 and incubating the mixture for 20 s at 37°C.

Purification:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: The radiolabeled DNA fragments were then separated on 4% polyacrylamide gels, excised from the gel, and purified by electroelution. .. Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 .

Article Title: Effect of Damage Type on Stimulation of Human Excision Nuclease by SWI/SNF Chromatin Remodeling Factor
Article Snippet: T4 DNA ligase was obtained from Roche Applied Science (Indianapolis, Ind.), DNase I from Promega (Madison, Wis.), and N -acetoxy-2-acetyl-aminofluorene from Chemsyn Science Laboratories (Lenexa, Kans.). .. The six core human excision nuclease factors, RPA, XPA, XPC, TFIIH, XPG, and XPF-ERCC1, were purified as described previously ( , , , ).

Electrophoresis:

Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis
Article Snippet: After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C. .. Preparation of the DNA ladder and electrophoresis conditions were the same as described by Wang et al ., except that a GeneScan-LIZ500 size standard (Applied Biosystems) was used.

Article Title: Purification and In Vitro Characterization of the Serratia marcescens NucC Protein, a Zinc-Binding Transcription Factor Homologous to P2 Ogr
Article Snippet: Partial DNA digestion was performed by adding 80 μl of DNase footprinting buffer containing 0.03 U of DNase I (Promega, Madison, Wis.) per ml and 0.1 mM CaCl2 and incubating the mixture for 20 s at 37°C. .. Reaction mixtures were extracted with phenol-chloroform, ethanol precipitated, and resolved by electrophoresis on 6.5% polyacrylamide gels containing 7 M urea.

Concentration Assay:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction. .. SDS was added to each reaction mixture to a final concentration of 0.5%.

Article Title: NADP, corepressor for the Bacillus catabolite control protein CcpA
Article Snippet: After CcpA was incubated with combinations of HPr-P (Ser-46) and 45 gylcolytic metabolites, nucleotides and cofactors in TGED buffer (50 mM Tris⋅HCl, pH 8.0/10% glycerol/0.1 mM EDTA/0.1 mM DTT) for 5 min, 1 ng of amyO (0.5 nM final concentration) was added, allowing formation of the amyO –CcpA complex. .. Two units of DNase I (Promega) were added to the 30 μl of reaction at room temperature.

Generated:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: Both DNA fragments were generated by PCR and were 32 P labeled on the 5′ end of the template strand. .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

other:

Article Title: Regulated chromatin domain comprising cluster of co-expressed genes in Drosophila melanogaster
Article Snippet: Sensitivity to DNase I is a conventional gauge for the compactness of chromatin.

Article Title: Transcriptional Activation of Multiple Operons Involved in para-Nitrophenol Degradation by Pseudomonas sp. Strain WBC-3
Article Snippet: The reaction was stopped by the addition of 140 μl of DNase I stop solution (200 mM unbuffered sodium acetate, 30 mM EDTA, and 0.15% SDS).

Article Title: Regulated chromatin domain comprising cluster of co-expressed genes in Drosophila melanogaster
Article Snippet: The distribution of chromatin resistance to DNase I in brains is also not supported by the linear model (P = 0.77), the best fit was observed for the quadratic (P = 0.06), cubic (P = 0.04) and S-shaped curve (P = 0.05) models.

Article Title: The Malonate Decarboxylase Operon of Acinetobacter calcoaceticus KCCM 40902 Is Regulated by Malonate and the Transcriptional Repressor MdcY
Article Snippet: The reaction was stopped by the addition 36 μl of DNase I stop solution (200 mM NaCl, 30 mM EDTA, 1% sodium dodecyl sulfate [SDS], 100 μl of yeast RNA per ml).

Article Title: Identification of the Replication Origins from Cyanothece ATCC 51142 and Their Interactions with the DnaA Protein: From In Silico to In Vitro Studies
Article Snippet: The reaction was stopped by adding 140 μL of DNase I stop solution (200 mM unbuffered sodium acetate, 30 mM of EDTA, and 0.15% SDS).

Activity Assay:

Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter
Article Snippet: Partial digestion of protein-bound DNA was initiated by the addition of DNase I (Promega Life Sciences) after dilution in 1× binding buffer containing 1 mM CaCl2 . .. DNase I activity was terminated after 2 min by the addition of stop solution (0.4 M sodium acetate, 0.2% SDS, 10 mM EDTA, 50 μg ml−1 Saccharomyces cerevisiae tRNA, and 10 μg of proteinase K).

Sequencing:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: DNase I footprints were performed with either a 287-bp DNA fragment (−212 to +75) containing five GAL4 sites upstream of the adenovirus major late core promoter (−53 to +33) or a 230-bp DNA fragment (−152 to +78) containing plasmid DNA sequence upstream of the adenovirus major late core promoter (−53 to +33). .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Article Title: NADP, corepressor for the Bacillus catabolite control protein CcpA
Article Snippet: Two units of DNase I (Promega) were added to the 30 μl of reaction at room temperature. .. The DNase I digests were resolved in a 8% sequencing gel and bands were detected by autoradiography ( ).

Recombinase Polymerase Amplification:

Article Title: Effect of Damage Type on Stimulation of Human Excision Nuclease by SWI/SNF Chromatin Remodeling Factor
Article Snippet: T4 DNA ligase was obtained from Roche Applied Science (Indianapolis, Ind.), DNase I from Promega (Madison, Wis.), and N -acetoxy-2-acetyl-aminofluorene from Chemsyn Science Laboratories (Lenexa, Kans.). .. The six core human excision nuclease factors, RPA, XPA, XPC, TFIIH, XPG, and XPF-ERCC1, were purified as described previously ( , , , ).

Plasmid Preparation:

Article Title: Acetyl Coenzyme A Stimulates RNA Polymerase II Transcription and Promoter Binding by Transcription Factor IID in the Absence of Histones
Article Snippet: DNase I footprints were performed with either a 287-bp DNA fragment (−212 to +75) containing five GAL4 sites upstream of the adenovirus major late core promoter (−53 to +33) or a 230-bp DNA fragment (−152 to +78) containing plasmid DNA sequence upstream of the adenovirus major late core promoter (−53 to +33). .. Then 1 μl of a solution containing 0.15 U of DNase I (Promega) per μl and 10 mM CaCl2 was added to each reaction.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega dnase i
    MdcY-mediated protection of the  mdc  operator against digestion by DNase I. Lanes 1 to 4, target DNA (0.1 pmol, 2 × 10 5  cpm) was incubated in the absence or in the presence of MdcY (the number above each lane indicates the nanomolar concentration of MdcY protein). In lanes 5 to 7, target DNA and 2.4 nM MdcY were incubated with 50, 100, and 500 μM malonate, respectively. The vertical arrows beside the nucleotide sequence indicate a palindromic structure.
    Dnase I, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 551 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Promega
    Average 99 stars, based on 551 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Promega dnase i footprinting
    RcsAB-dependent expression of hmsT . Primer extension (a), LacZ fusion (b), EMSA (c), <t>DNase</t> I <t>footprinting</t> (d) experiments were performed as described in Fig 2 .
    Dnase I Footprinting, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i footprinting/product/Promega
    Average 91 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    dnase i footprinting - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    Image Search Results


    MdcY-mediated protection of the  mdc  operator against digestion by DNase I. Lanes 1 to 4, target DNA (0.1 pmol, 2 × 10 5  cpm) was incubated in the absence or in the presence of MdcY (the number above each lane indicates the nanomolar concentration of MdcY protein). In lanes 5 to 7, target DNA and 2.4 nM MdcY were incubated with 50, 100, and 500 μM malonate, respectively. The vertical arrows beside the nucleotide sequence indicate a palindromic structure.

    Journal: Journal of Bacteriology

    Article Title: The Malonate Decarboxylase Operon of Acinetobacter calcoaceticus KCCM 40902 Is Regulated by Malonate and the Transcriptional Repressor MdcY

    doi:

    Figure Lengend Snippet: MdcY-mediated protection of the mdc operator against digestion by DNase I. Lanes 1 to 4, target DNA (0.1 pmol, 2 × 10 5 cpm) was incubated in the absence or in the presence of MdcY (the number above each lane indicates the nanomolar concentration of MdcY protein). In lanes 5 to 7, target DNA and 2.4 nM MdcY were incubated with 50, 100, and 500 μM malonate, respectively. The vertical arrows beside the nucleotide sequence indicate a palindromic structure.

    Article Snippet: The reaction was stopped by the addition 36 μl of DNase I stop solution (200 mM NaCl, 30 mM EDTA, 1% sodium dodecyl sulfate [SDS], 100 μl of yeast RNA per ml).

    Techniques: Incubation, Concentration Assay, Sequencing

    Profiles of chromatin DNase I-resistance across the 60D cluster region and surrounding sequences. Chromatin resistance to DNase I [as normalized relative yield (NRY) for each amplicon] is plotted on the vertical axis; the length of 60D1-2 genomic region (in kb) is plotted on the horizontal. Positions of the genes in the region are shown at bottom. Circles (black for the regulated chromatin domain, and white for the rest of the region) indicate average NRY for each amplicon, the grey area corresponds to the calculated 95% confidence interval. Upper panel: in larval testes, the entire region shows nearly uniformal low resistance to DNase I typical for the ‘open’ chromatin. In contrast, in larval brains (middle panel) and in embryos (lower panel) regulated chromatin domain that contains the genes CG13589 through Pros28.1B shows significantly higher resistance to DNase I, indicative of ‘closed’ chromatin configuration.

    Journal: Nucleic Acids Research

    Article Title: Regulated chromatin domain comprising cluster of co-expressed genes in Drosophila melanogaster

    doi: 10.1093/nar/gki281

    Figure Lengend Snippet: Profiles of chromatin DNase I-resistance across the 60D cluster region and surrounding sequences. Chromatin resistance to DNase I [as normalized relative yield (NRY) for each amplicon] is plotted on the vertical axis; the length of 60D1-2 genomic region (in kb) is plotted on the horizontal. Positions of the genes in the region are shown at bottom. Circles (black for the regulated chromatin domain, and white for the rest of the region) indicate average NRY for each amplicon, the grey area corresponds to the calculated 95% confidence interval. Upper panel: in larval testes, the entire region shows nearly uniformal low resistance to DNase I typical for the ‘open’ chromatin. In contrast, in larval brains (middle panel) and in embryos (lower panel) regulated chromatin domain that contains the genes CG13589 through Pros28.1B shows significantly higher resistance to DNase I, indicative of ‘closed’ chromatin configuration.

    Article Snippet: The distribution of chromatin resistance to DNase I in brains is also not supported by the linear model (P = 0.77), the best fit was observed for the quadratic (P = 0.06), cubic (P = 0.04) and S-shaped curve (P = 0.05) models.

    Techniques: Amplification

    RcsAB-dependent expression of hmsT . Primer extension (a), LacZ fusion (b), EMSA (c), DNase I footprinting (d) experiments were performed as described in Fig 2 .

    Journal: Scientific Reports

    Article Title: RcsAB is a major repressor of Yersinia biofilm development through directly acting on hmsCDE, hmsT, and hmsHFRS

    doi: 10.1038/srep09566

    Figure Lengend Snippet: RcsAB-dependent expression of hmsT . Primer extension (a), LacZ fusion (b), EMSA (c), DNase I footprinting (d) experiments were performed as described in Fig 2 .

    Article Snippet: DNase I footprinting For DNase I footprinting , the target DNA fragment with a single 32 P-labeled end was incubated with increasing amounts of purified His-RcsB-p with addition of 24 pmol of purified MBP-RcsA, which was followed by partial digestion of RQ1 RNase-Free DNase I (Promega).

    Techniques: Expressing, Footprinting

    RcsAB-dependent expression of hmsCDE . (a) Primer extension. The relative mRNA levels of hmsC in indicated strains were determined by primer extension. The Sanger sequence ladders (lanes G, C, A, and T) and the primer extension products of hmsC were analyzed with an 8 M urea-6% acrylamide sequencing gel. The transcription start site of hmsC was indicated by arrow with nucleotide A, and the minus number under arrow indicated the nucleotide position upstream of hmsC start codon. (b) LacZ fusion. The hmsC : lacZ transcriptional fusion vector was transformed into in indicated strains, and then hmsC promoter activities (miller units of β-galactosidase activity) were determined in bacterial cellular extracts. (c) EMSA. The radioactively labeled DNA fragments were incubated with indicated purified proteins and then subjected to a native 4% polyacrylamide gel electrophoresis. (d) DNase I footprinting. Labeled coding or non-coding DNA probes were incubated with indicated purified proteins and then subjected to DNase I digestion. The digested DNA samples were analyzed in an 8 M urea-6% polyacrylamide gel. The footprint regions were indicated with vertical bars. Lanes C, T, A, and G represented Sanger sequencing reactions. The DNA-binding of His-RcsB-p in presence of MBP-RcsA (involved in EMSA and DNase I footprinting) and that of His-RcsB-p alone (in EMSA) were tested. (d) Promoter structure. Shown were with translation/transcription starts, core promoter −10 and −35 elements, SD sequences, RcsAB sites, and RcsAB box-like sequences.

    Journal: Scientific Reports

    Article Title: RcsAB is a major repressor of Yersinia biofilm development through directly acting on hmsCDE, hmsT, and hmsHFRS

    doi: 10.1038/srep09566

    Figure Lengend Snippet: RcsAB-dependent expression of hmsCDE . (a) Primer extension. The relative mRNA levels of hmsC in indicated strains were determined by primer extension. The Sanger sequence ladders (lanes G, C, A, and T) and the primer extension products of hmsC were analyzed with an 8 M urea-6% acrylamide sequencing gel. The transcription start site of hmsC was indicated by arrow with nucleotide A, and the minus number under arrow indicated the nucleotide position upstream of hmsC start codon. (b) LacZ fusion. The hmsC : lacZ transcriptional fusion vector was transformed into in indicated strains, and then hmsC promoter activities (miller units of β-galactosidase activity) were determined in bacterial cellular extracts. (c) EMSA. The radioactively labeled DNA fragments were incubated with indicated purified proteins and then subjected to a native 4% polyacrylamide gel electrophoresis. (d) DNase I footprinting. Labeled coding or non-coding DNA probes were incubated with indicated purified proteins and then subjected to DNase I digestion. The digested DNA samples were analyzed in an 8 M urea-6% polyacrylamide gel. The footprint regions were indicated with vertical bars. Lanes C, T, A, and G represented Sanger sequencing reactions. The DNA-binding of His-RcsB-p in presence of MBP-RcsA (involved in EMSA and DNase I footprinting) and that of His-RcsB-p alone (in EMSA) were tested. (d) Promoter structure. Shown were with translation/transcription starts, core promoter −10 and −35 elements, SD sequences, RcsAB sites, and RcsAB box-like sequences.

    Article Snippet: DNase I footprinting For DNase I footprinting , the target DNA fragment with a single 32 P-labeled end was incubated with increasing amounts of purified His-RcsB-p with addition of 24 pmol of purified MBP-RcsA, which was followed by partial digestion of RQ1 RNase-Free DNase I (Promega).

    Techniques: Expressing, Sequencing, Plasmid Preparation, Transformation Assay, Activity Assay, Labeling, Incubation, Purification, Polyacrylamide Gel Electrophoresis, Footprinting, Binding Assay

    RcsAB-dependent expression of hmsHFRS . Primer extension (a), LacZ fusion (b), EMSA (c), and DNase I footprinting (d) experiments were performed as described in Fig 2 .

    Journal: Scientific Reports

    Article Title: RcsAB is a major repressor of Yersinia biofilm development through directly acting on hmsCDE, hmsT, and hmsHFRS

    doi: 10.1038/srep09566

    Figure Lengend Snippet: RcsAB-dependent expression of hmsHFRS . Primer extension (a), LacZ fusion (b), EMSA (c), and DNase I footprinting (d) experiments were performed as described in Fig 2 .

    Article Snippet: DNase I footprinting For DNase I footprinting , the target DNA fragment with a single 32 P-labeled end was incubated with increasing amounts of purified His-RcsB-p with addition of 24 pmol of purified MBP-RcsA, which was followed by partial digestion of RQ1 RNase-Free DNase I (Promega).

    Techniques: Expressing, Footprinting