dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    100 bp DNA Ladder
    Description:
    100 bp DNA Ladder 500 gel lanes
    Catalog Number:
    N3231L
    Price:
    230
    Size:
    500 gel lanes
    Category:
    DNA Ladders
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs dna
    100 bp DNA Ladder
    100 bp DNA Ladder 500 gel lanes
    https://www.bioz.com/result/dna/product/New England Biolabs
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    dna - by Bioz Stars, 2019-10
    99/100 stars

    Related Products / Commonly Used Together

    sodium l-ascorbate
    biotin-peg3 -

    Images

    1) Product Images from "Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues"

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003866

    Quantitative and enzymatic analysis of patient DNA. ( A ) Quantitative competitive PCR revealed a significant increase in the amount IP'd/input from heart compared to cerebellum DNA of the same DM1 patient (unpaired two-tailed t-test, p = 0.03, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations). No significant difference was found between matched tissues of a non-DM1 individual. Details of quantitative competitive PCR and examples of the raw data are presented in Fig. S4 . ( B ) Sensitivity of DM1 patient DNAs to structure-specific enzymes. For enzyme location specificity, see Fig. S4D TP-PCR analysis of samples +/−digestions assessed by GeneScan or ( C ) agarose electrophoresis, show decreased signal of the expanded allele after T7endoI or MBN digestion, with control DNA showing no difference. ( D ) Quantification of MBN and T7endoI digestion. Untreated heart DNA compared to MBN-treated, paired t-test, p = 0.0015, and compared to T7endoI-treated, paired t-test, p = 0.0015, n = at least 5 experimental replicates per treatment, on at least two genomic isolations. For analysis of additional tissues see Fig. S4 . All errors bars indicate SEM, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations.
    Figure Legend Snippet: Quantitative and enzymatic analysis of patient DNA. ( A ) Quantitative competitive PCR revealed a significant increase in the amount IP'd/input from heart compared to cerebellum DNA of the same DM1 patient (unpaired two-tailed t-test, p = 0.03, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations). No significant difference was found between matched tissues of a non-DM1 individual. Details of quantitative competitive PCR and examples of the raw data are presented in Fig. S4 . ( B ) Sensitivity of DM1 patient DNAs to structure-specific enzymes. For enzyme location specificity, see Fig. S4D TP-PCR analysis of samples +/−digestions assessed by GeneScan or ( C ) agarose electrophoresis, show decreased signal of the expanded allele after T7endoI or MBN digestion, with control DNA showing no difference. ( D ) Quantification of MBN and T7endoI digestion. Untreated heart DNA compared to MBN-treated, paired t-test, p = 0.0015, and compared to T7endoI-treated, paired t-test, p = 0.0015, n = at least 5 experimental replicates per treatment, on at least two genomic isolations. For analysis of additional tissues see Fig. S4 . All errors bars indicate SEM, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations.

    Techniques Used: Polymerase Chain Reaction, Two Tailed Test, Electrophoresis

    Analysis of slipped-DNA in native chromatin, and EM of IP'd DNA. ( A ) Tissues were treated in their native chromatin state with MBN and T7EndoI or Alu I enzymes, DNAs extracted and analyzed by TP-PCR. Agarose electrophoretic analysis of native-chromatin context digested DNA, run out after TP-PCR, showing a decrease in the expanded allele signal from patient muscle, but not cerebellum. See Figure S5A for representative GeneScan analyses of patient DNA treated in its native chromatin context with MBN and T7EndoI or Alu I enzyme (see Text S1 for Nuclease accessibility protocol). Also, see Figure S5C for a comparison of areas under each peak of the GeneScans before and after treatment. ( B ) The graph shows the significant difference in the reduction of the expanded allele after MBN and T7 treatment, compared to both untreated and Alu I treatment (p = 0.0038), n = 3 experiments. There is no significant difference between untreated and MBN+T7 treated ADM9 cerebellum digested in the native chromatin context. All error bars indicate SEM. ( C ) Electron microscopic imaging shows structured DNA. Electron microscopic (EM) images of immunoprecipitated DM1 DNAs and a control fully-duplexed DNA. IP'd DM1 tissue DNA shows multiple sized and clustered structures by EM. For EM analysis of additional tissue DNA as well as wider field views, see Supplementary Fig. S7 . ( D ) Analysis of slip-out sizes and the distance between slip-outs on immunoprecipitated slipped DNAs. The size of the slip-outs presented a bimodal distribution ranging from 1–100 repeats with peaks at ∼30 and
    Figure Legend Snippet: Analysis of slipped-DNA in native chromatin, and EM of IP'd DNA. ( A ) Tissues were treated in their native chromatin state with MBN and T7EndoI or Alu I enzymes, DNAs extracted and analyzed by TP-PCR. Agarose electrophoretic analysis of native-chromatin context digested DNA, run out after TP-PCR, showing a decrease in the expanded allele signal from patient muscle, but not cerebellum. See Figure S5A for representative GeneScan analyses of patient DNA treated in its native chromatin context with MBN and T7EndoI or Alu I enzyme (see Text S1 for Nuclease accessibility protocol). Also, see Figure S5C for a comparison of areas under each peak of the GeneScans before and after treatment. ( B ) The graph shows the significant difference in the reduction of the expanded allele after MBN and T7 treatment, compared to both untreated and Alu I treatment (p = 0.0038), n = 3 experiments. There is no significant difference between untreated and MBN+T7 treated ADM9 cerebellum digested in the native chromatin context. All error bars indicate SEM. ( C ) Electron microscopic imaging shows structured DNA. Electron microscopic (EM) images of immunoprecipitated DM1 DNAs and a control fully-duplexed DNA. IP'd DM1 tissue DNA shows multiple sized and clustered structures by EM. For EM analysis of additional tissue DNA as well as wider field views, see Supplementary Fig. S7 . ( D ) Analysis of slip-out sizes and the distance between slip-outs on immunoprecipitated slipped DNAs. The size of the slip-outs presented a bimodal distribution ranging from 1–100 repeats with peaks at ∼30 and

    Techniques Used: Electron Microscopy, Polymerase Chain Reaction, Imaging, Immunoprecipitation

    Immunoprecipitated DNA is enriched for the expanded DM1 allele. ( A ) Multiplex PCR protocol to determine the DM1 allele specificity of IP'd DNA, where “n” and “N” are the non-expanded and expanded alleles. Two primer pairs, indicated by arrow-heads are used in the same PCR reaction in order to differentiate between the expanded and non-expanded allele in genomic and IP'd DNA. Expected products are shown in the schematic gels for each case, sizes are based upon a non-expanded allele of (CTG) 4 . ( B ) Multiplex PCR analysis of ADM5 patient tissue DNAs shows only the lower two products in IP'd DNAs, indicating a strong enrichment of the expanded but not the non-expanded allele. DM1 individual, ADM5, has varying expanded repeat sizes between tissues – too large to be amplified across ( Fig. 2B ) and (CTG) 4 in the non-expanded allele. Sizes of PCR products are indicated. The products in the IP lanes appear brighter because more DNA was loaded in these lanes in order to show that apparent loss of the larger PCR products that are unique to the non-expanded allele was not due to decreased sample loading. ( C ) Triplet-primed PCR protocol for IP'd DNAs (see text and Methods for full explanation of protocol). Briefly, an enrichment of the smeared PCR product (expanded allele) is expected over the smaller discrete product (non-expanded allele) after IP. ( D ) TP-PCR reveals predominantly the expanded allele in IP'd DNA (black arrowhead), and an absence of the non-expanded allele (blue arrowhead), confirming the specific immunoprecipitation of the expanded allele. The supernatant (SN) is depleted of the expanded but not the non-expanded allele. NB, this image is best viewed directly on the original electronic image. Neither Figure 3B nor Figure 3D are quantitative in nature; they are loaded in such a way that the differences between genomic and IP'd DNA are visually apparent.
    Figure Legend Snippet: Immunoprecipitated DNA is enriched for the expanded DM1 allele. ( A ) Multiplex PCR protocol to determine the DM1 allele specificity of IP'd DNA, where “n” and “N” are the non-expanded and expanded alleles. Two primer pairs, indicated by arrow-heads are used in the same PCR reaction in order to differentiate between the expanded and non-expanded allele in genomic and IP'd DNA. Expected products are shown in the schematic gels for each case, sizes are based upon a non-expanded allele of (CTG) 4 . ( B ) Multiplex PCR analysis of ADM5 patient tissue DNAs shows only the lower two products in IP'd DNAs, indicating a strong enrichment of the expanded but not the non-expanded allele. DM1 individual, ADM5, has varying expanded repeat sizes between tissues – too large to be amplified across ( Fig. 2B ) and (CTG) 4 in the non-expanded allele. Sizes of PCR products are indicated. The products in the IP lanes appear brighter because more DNA was loaded in these lanes in order to show that apparent loss of the larger PCR products that are unique to the non-expanded allele was not due to decreased sample loading. ( C ) Triplet-primed PCR protocol for IP'd DNAs (see text and Methods for full explanation of protocol). Briefly, an enrichment of the smeared PCR product (expanded allele) is expected over the smaller discrete product (non-expanded allele) after IP. ( D ) TP-PCR reveals predominantly the expanded allele in IP'd DNA (black arrowhead), and an absence of the non-expanded allele (blue arrowhead), confirming the specific immunoprecipitation of the expanded allele. The supernatant (SN) is depleted of the expanded but not the non-expanded allele. NB, this image is best viewed directly on the original electronic image. Neither Figure 3B nor Figure 3D are quantitative in nature; they are loaded in such a way that the differences between genomic and IP'd DNA are visually apparent.

    Techniques Used: Immunoprecipitation, Multiplex Assay, Polymerase Chain Reaction, CTG Assay, Amplification

    Slipped-DNAs are bound by anti-DNA junction antibody. ( A ) The anti-DNA junction antibody 2D3 bound slip-outs of 1-, 3- and 20-excess repeats as well as homoduplex slipped-DNAs with multiple clustered slip-outs/molecule by electrophoretic mobility shift assay. DNA substrates were 59 bp+(CT/AG)n+54 bp radiolabeled, gel-purified and used in binding experiments. Arrowheads indicate non-specific, specific and competition-resistant specific complexes. Line for lanes of S-DNA indicates a non-specific DNA. Triangles indicate increased antibody; + indicates addition of non-specific (plasmid) competitor DNA. All samples of the band-shift experiment were resolved on a single gel with panels separated for clarity. See Fig. S2 for control IgG 1 Ab binding. ( B ) DM1 post-mortem patient and control, tissue, and DM1 CTG tract sizes (for the non-expanded and expanded allele for the patients, and both non-expanded alleles for the control). See Text S1 for post-mortem details. ( C ) Protocol to isolate slipped-DNAs from genomic DNA. Tissue DNA is isolated using a non-denaturing protocol (see Text S1 ). DNA is then digested to release the repeat-containing fragment at the DM1 locus from the rest of the genome (slipped-DNAs are not super-coil dependent), incubated with the anti-DNA junction antibody 2D3, pulled down using protein G beads, released from the beads, and then characterized. The Bbs I-(CTG)n- Bam HI restriction fragment size will vary depending upon the repeat size. NB, this image is best viewed directly on the original electronic image.
    Figure Legend Snippet: Slipped-DNAs are bound by anti-DNA junction antibody. ( A ) The anti-DNA junction antibody 2D3 bound slip-outs of 1-, 3- and 20-excess repeats as well as homoduplex slipped-DNAs with multiple clustered slip-outs/molecule by electrophoretic mobility shift assay. DNA substrates were 59 bp+(CT/AG)n+54 bp radiolabeled, gel-purified and used in binding experiments. Arrowheads indicate non-specific, specific and competition-resistant specific complexes. Line for lanes of S-DNA indicates a non-specific DNA. Triangles indicate increased antibody; + indicates addition of non-specific (plasmid) competitor DNA. All samples of the band-shift experiment were resolved on a single gel with panels separated for clarity. See Fig. S2 for control IgG 1 Ab binding. ( B ) DM1 post-mortem patient and control, tissue, and DM1 CTG tract sizes (for the non-expanded and expanded allele for the patients, and both non-expanded alleles for the control). See Text S1 for post-mortem details. ( C ) Protocol to isolate slipped-DNAs from genomic DNA. Tissue DNA is isolated using a non-denaturing protocol (see Text S1 ). DNA is then digested to release the repeat-containing fragment at the DM1 locus from the rest of the genome (slipped-DNAs are not super-coil dependent), incubated with the anti-DNA junction antibody 2D3, pulled down using protein G beads, released from the beads, and then characterized. The Bbs I-(CTG)n- Bam HI restriction fragment size will vary depending upon the repeat size. NB, this image is best viewed directly on the original electronic image.

    Techniques Used: Electrophoretic Mobility Shift Assay, Purification, Binding Assay, Plasmid Preparation, CTG Assay, Isolation, Incubation

    2) Product Images from "A Promiscuous DNA Packaging Machine from Bacteriophage T4"

    Article Title: A Promiscuous DNA Packaging Machine from Bacteriophage T4

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.1000592

    Full heads can package DNA. (A) The phage heads were isolated from 10am13am infected E. coli P301 cells (500 ml culture) by lysis in the presence of DNAse I followed by differential centrifugation (see Materials and Methods for details). The phage head pellet containing a mixture of partial heads and full heads was resuspended in 200 µl of 50 mM Tris-HCl (pH 7.5) and 5 mM MgCl 2 . The sample was split into two halves, and larger scale packaging assays were conducted immediately. The 500-µl packaging reactions contained 100 µl of phage heads, 4.75 µM GFP-gp17, 43 µg of ladder DNA (50–766 bp; NEB), 5% PEG buffer, and 1 mM ATP [30] . gp17 and ATP were omitted in the control reaction. After 30 min of incubation at room temperature, 40 µl (1,000 units) of Benzonase nuclease (EMD Biosciences) was added to digest unpackaged DNA, and the samples were separated by CsCl density gradient centrifugation. (B) The partial and full head samples from the gradient were electrophoresed on 10% SDS polyacrylamide gel to analyze for proteins and to estimate the concentration of particles used in the packaging reactions. Since the concentration of full heads is very low compared to that of partial heads (roughly 1/10 th that of partial heads), the full heads were concentrated by high-speed centrifugation such that the number of particles per lane are approximately the same for both full heads and partial heads. (C and D) The full (C) and partial (D) head bands from the gradient were treated with proteinase K (18.5 µg; Fermentas) and electrophoresed on 4%–20% polyacrylamide gel in Tris-borate buffer (pH 8) to analyze for packaged DNA.
    Figure Legend Snippet: Full heads can package DNA. (A) The phage heads were isolated from 10am13am infected E. coli P301 cells (500 ml culture) by lysis in the presence of DNAse I followed by differential centrifugation (see Materials and Methods for details). The phage head pellet containing a mixture of partial heads and full heads was resuspended in 200 µl of 50 mM Tris-HCl (pH 7.5) and 5 mM MgCl 2 . The sample was split into two halves, and larger scale packaging assays were conducted immediately. The 500-µl packaging reactions contained 100 µl of phage heads, 4.75 µM GFP-gp17, 43 µg of ladder DNA (50–766 bp; NEB), 5% PEG buffer, and 1 mM ATP [30] . gp17 and ATP were omitted in the control reaction. After 30 min of incubation at room temperature, 40 µl (1,000 units) of Benzonase nuclease (EMD Biosciences) was added to digest unpackaged DNA, and the samples were separated by CsCl density gradient centrifugation. (B) The partial and full head samples from the gradient were electrophoresed on 10% SDS polyacrylamide gel to analyze for proteins and to estimate the concentration of particles used in the packaging reactions. Since the concentration of full heads is very low compared to that of partial heads (roughly 1/10 th that of partial heads), the full heads were concentrated by high-speed centrifugation such that the number of particles per lane are approximately the same for both full heads and partial heads. (C and D) The full (C) and partial (D) head bands from the gradient were treated with proteinase K (18.5 µg; Fermentas) and electrophoresed on 4%–20% polyacrylamide gel in Tris-borate buffer (pH 8) to analyze for packaged DNA.

    Techniques Used: Isolation, Infection, Lysis, Centrifugation, Incubation, Gradient Centrifugation, Concentration Assay

    Purification and characterization of phage heads. (A) The 10am13am heads were isolated by differential centrifugation followed by CsCl gradient centrifugation (see Materials and Methods for details). The two closely spaced bands at the top of the gradient contained partial heads that had ejected most of their packaged DNA, save an ∼8-kb piece. The band at the bottom of the gradient contained full heads in which the packaged T4 genome was stabilized (see Figure 3 legend for additional details). (B) Purification of partial heads by DEAE-Sepharose column chromatography. The two closely spaced head bands at the top of the CsCl gradient were pooled, dialyzed against 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 5 mM MgCl 2 , and purified by ion-exchange chromatography (AKTA Prime, GE Healthcare). The column was pre-equilibrated with 50 mM Tris-HCl (pH 7.5) and 5 mM MgCl 2 , and a linear gradient of 0–300 mM NaCl was applied to elute the bound heads. The peak fractions were pooled, concentrated by filtration, and stored at 4°C. (C) The partial and full heads are fully expanded. The purified proheads, partial heads, and full heads were mixed with SDS gel loading buffer and kept at room temperature (“−”) or boiling temperature (“+”) for 5 min. The samples were then separated by 10% SDS-PAGE, stained with Coomassie blue R, and destained. Note that the major capsid protein, gp23* (position marked with arrow), was not seen in the room temperature samples because the expanded heads could not be dissociated into gp23* subunits. (D) Partial and full heads reassemble with the exogenous gp17. About 5×10 11 proheads, partial heads, or full heads were incubated with purified gp17-K577 (0.3 µM; 50:1 ratio of gp17 molecules to gp20 subunits) in a buffer containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 5 mM MgCl 2 , at room temperature for 30 min. The head-gp17 complexes were sedimented by centrifugation at 18,000 rpm for 45 min, and the pellet was washed several times to remove any unbound gp17. The proteins were transferred to PVDF membrane, and Western blotting was performed using polyclonal gp17 antibodies. The results were confirmed by doing the same experiment with full-length gp17 and a GFP-gp17 fusion protein. Only the gp17-K577 (C-terminal 33 amino acids of gp17 were deleted) data are shown because gp17-K577 is protease resistant and migrates as a single band as opposed to three bands with the full-length gp17 and GFP-gp17, and also because there is no background overlapping band at the same position. The gp17 band in the full head lane (lane 4) is faint because some of these heads released the packaged DNA during the procedure, which resulted in poor recovery of the heads during the centrifugation and washing steps.
    Figure Legend Snippet: Purification and characterization of phage heads. (A) The 10am13am heads were isolated by differential centrifugation followed by CsCl gradient centrifugation (see Materials and Methods for details). The two closely spaced bands at the top of the gradient contained partial heads that had ejected most of their packaged DNA, save an ∼8-kb piece. The band at the bottom of the gradient contained full heads in which the packaged T4 genome was stabilized (see Figure 3 legend for additional details). (B) Purification of partial heads by DEAE-Sepharose column chromatography. The two closely spaced head bands at the top of the CsCl gradient were pooled, dialyzed against 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 5 mM MgCl 2 , and purified by ion-exchange chromatography (AKTA Prime, GE Healthcare). The column was pre-equilibrated with 50 mM Tris-HCl (pH 7.5) and 5 mM MgCl 2 , and a linear gradient of 0–300 mM NaCl was applied to elute the bound heads. The peak fractions were pooled, concentrated by filtration, and stored at 4°C. (C) The partial and full heads are fully expanded. The purified proheads, partial heads, and full heads were mixed with SDS gel loading buffer and kept at room temperature (“−”) or boiling temperature (“+”) for 5 min. The samples were then separated by 10% SDS-PAGE, stained with Coomassie blue R, and destained. Note that the major capsid protein, gp23* (position marked with arrow), was not seen in the room temperature samples because the expanded heads could not be dissociated into gp23* subunits. (D) Partial and full heads reassemble with the exogenous gp17. About 5×10 11 proheads, partial heads, or full heads were incubated with purified gp17-K577 (0.3 µM; 50:1 ratio of gp17 molecules to gp20 subunits) in a buffer containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 5 mM MgCl 2 , at room temperature for 30 min. The head-gp17 complexes were sedimented by centrifugation at 18,000 rpm for 45 min, and the pellet was washed several times to remove any unbound gp17. The proteins were transferred to PVDF membrane, and Western blotting was performed using polyclonal gp17 antibodies. The results were confirmed by doing the same experiment with full-length gp17 and a GFP-gp17 fusion protein. Only the gp17-K577 (C-terminal 33 amino acids of gp17 were deleted) data are shown because gp17-K577 is protease resistant and migrates as a single band as opposed to three bands with the full-length gp17 and GFP-gp17, and also because there is no background overlapping band at the same position. The gp17 band in the full head lane (lane 4) is faint because some of these heads released the packaged DNA during the procedure, which resulted in poor recovery of the heads during the centrifugation and washing steps.

    Techniques Used: Purification, Isolation, Centrifugation, Gradient Centrifugation, Column Chromatography, Ion Exchange Chromatography, Filtration, SDS-Gel, SDS Page, Staining, Incubation, Western Blot

    3) Product Images from "Ultrasensitive single-genome sequencing: accurate, targeted, next generation sequencing of HIV-1 RNA"

    Article Title: Ultrasensitive single-genome sequencing: accurate, targeted, next generation sequencing of HIV-1 RNA

    Journal: Retrovirology

    doi: 10.1186/s12977-016-0321-6

    Schematic representation of the methods used for NGS library construction. A cDNA library labeled with Primer IDs ( top ) is divided and used for each method. a uSGS. Short PCR primers (25 and 31 bases) containing 5′ dU in place of dT residues ( dots in the primers) are used to amplify the cDNA. Products are cleaved at the dU sites creating dsDNA with 17-nt 3′-overhangs at both ends. The ends are then ligated to the essential NGS adapters and filled out using Klenow Fragment DNA polymerase to generate a fully double-stranded NGS library. b Long primer PCR-1. Long primers (90 and 93nt) containing NGS adapter sequences are used to amplify the cDNA library. c Long primer PCR-2. Relatively long primers (50–61nt) are used in 2 rounds of flanking PCR to amplify the cDNA and attach the adaptors. d Long primer PCR-3 involves 3 rounds of PCR. The cDNA is amplified with short primers (25 and 31 bases) followed by 2 rounds of flanking PCR using long primers (50–61nt) to attach the adaptors
    Figure Legend Snippet: Schematic representation of the methods used for NGS library construction. A cDNA library labeled with Primer IDs ( top ) is divided and used for each method. a uSGS. Short PCR primers (25 and 31 bases) containing 5′ dU in place of dT residues ( dots in the primers) are used to amplify the cDNA. Products are cleaved at the dU sites creating dsDNA with 17-nt 3′-overhangs at both ends. The ends are then ligated to the essential NGS adapters and filled out using Klenow Fragment DNA polymerase to generate a fully double-stranded NGS library. b Long primer PCR-1. Long primers (90 and 93nt) containing NGS adapter sequences are used to amplify the cDNA library. c Long primer PCR-2. Relatively long primers (50–61nt) are used in 2 rounds of flanking PCR to amplify the cDNA and attach the adaptors. d Long primer PCR-3 involves 3 rounds of PCR. The cDNA is amplified with short primers (25 and 31 bases) followed by 2 rounds of flanking PCR using long primers (50–61nt) to attach the adaptors

    Techniques Used: Next-Generation Sequencing, cDNA Library Assay, Labeling, Polymerase Chain Reaction, Amplification

    4) Product Images from "TRIM28-Regulated Transposon Repression Is Required for Human Germline Competency and Not Primed or Naive Human Pluripotency"

    Article Title: TRIM28-Regulated Transposon Repression Is Required for Human Germline Competency and Not Primed or Naive Human Pluripotency

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2017.11.020

    TRIM28 Is Required to Maintain DNA Methylation at Paternal but Not Maternal ICRs in Primed hESCs (A and B) TRIM28 binding at the IG-DMR and the H19-ICR relative to the average TRIM28 binding at 29 maternal ICRs as a control. ICR is underlined. (C) Percent CpG methylation levels at maternal imprinted ICRs in Ctrl and T28KO(U1-9) primed hESCs (n = 29 maternal ICRs), ns, not significant. Error bars represent SD. (D) Browser view of ATAC-seq (blue), WGBS (green), and TRIM28 ChIP-seq (yellow) at the IG-DMR ICR, the MEG3 promoter, and the H19 ICR. (E and F) Relative expression using real-time RT-PCR of MEG3 and H19 in T28KO(U1-9) primed hESCs relative to Ctrl. ∗∗∗∗ p
    Figure Legend Snippet: TRIM28 Is Required to Maintain DNA Methylation at Paternal but Not Maternal ICRs in Primed hESCs (A and B) TRIM28 binding at the IG-DMR and the H19-ICR relative to the average TRIM28 binding at 29 maternal ICRs as a control. ICR is underlined. (C) Percent CpG methylation levels at maternal imprinted ICRs in Ctrl and T28KO(U1-9) primed hESCs (n = 29 maternal ICRs), ns, not significant. Error bars represent SD. (D) Browser view of ATAC-seq (blue), WGBS (green), and TRIM28 ChIP-seq (yellow) at the IG-DMR ICR, the MEG3 promoter, and the H19 ICR. (E and F) Relative expression using real-time RT-PCR of MEG3 and H19 in T28KO(U1-9) primed hESCs relative to Ctrl. ∗∗∗∗ p

    Techniques Used: DNA Methylation Assay, Binding Assay, CpG Methylation Assay, Chromatin Immunoprecipitation, Expressing, Quantitative RT-PCR

    5) Product Images from "Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome"

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome

    Journal: Genome Biology

    doi: 10.1186/gb-2011-12-4-r37

    DNA sequence conservation of DXZ4 . (a) Schematic map of a single human 3-kb DXZ4 monomer represented by an open arrow. Distance in kilobases is given along the top. Underneath, the colored bars indicate the regions of DXZ4 corresponding to the defined promoter, CTCF and TFIID binding sites [ 12 ] and the 402-bp interval of DXZ4 that is most conserved in primates. (b) Phylogenetic tree showing inferred evolutionary relationship of DXZ4 in primates. Sequence alignments were made against a 402 nucleotide region of human DXZ4 that is most conserved in all primates (nucleotides 517 to 918 of accession number [GenBank: HQ659140 ]). Percentage nucleotide identity is indicated to the far right. Primates are color-coded as follows: blue, great apes; pink, lesser apes; yellow, Old World monkeys; brown, New World monkeys; red, lemurs; green, galago; black, tarsier. The tree image was generated using MUSCLE version 3.8 [ 45 ]. (c) Predicted higher-order organization of the ring-tailed lemur DXZ4 sequence as revealed by dot-plot analysis. A single 3-kb DNA sequence is on the y-axis, whereas approximately 70 kb of BAC clone LB2-162N9 is given on the x-axis. The dot-plot was generated using the default settings for NCBI Blast2, and the output image labeled in Adobe Photoshop CS2.
    Figure Legend Snippet: DNA sequence conservation of DXZ4 . (a) Schematic map of a single human 3-kb DXZ4 monomer represented by an open arrow. Distance in kilobases is given along the top. Underneath, the colored bars indicate the regions of DXZ4 corresponding to the defined promoter, CTCF and TFIID binding sites [ 12 ] and the 402-bp interval of DXZ4 that is most conserved in primates. (b) Phylogenetic tree showing inferred evolutionary relationship of DXZ4 in primates. Sequence alignments were made against a 402 nucleotide region of human DXZ4 that is most conserved in all primates (nucleotides 517 to 918 of accession number [GenBank: HQ659140 ]). Percentage nucleotide identity is indicated to the far right. Primates are color-coded as follows: blue, great apes; pink, lesser apes; yellow, Old World monkeys; brown, New World monkeys; red, lemurs; green, galago; black, tarsier. The tree image was generated using MUSCLE version 3.8 [ 45 ]. (c) Predicted higher-order organization of the ring-tailed lemur DXZ4 sequence as revealed by dot-plot analysis. A single 3-kb DNA sequence is on the y-axis, whereas approximately 70 kb of BAC clone LB2-162N9 is given on the x-axis. The dot-plot was generated using the default settings for NCBI Blast2, and the output image labeled in Adobe Photoshop CS2.

    Techniques Used: Sequencing, Binding Assay, Generated, BAC Assay, Labeling

    Mapping and tandem arrangement of DXZ4 in primates . (a) Direct-labeled fluorescence in situ hybridization (FISH) of human DXZ4 BAC clone (2272M5; red) and human PLS3 BAC clone (268A15; green) to male and female rhesus macaque metaphase chromosomes. White arrows point to the hybridizing X chromosome. Metaphase chromosomes were counterstained with DAPI, and converted to gray-scale to assist in visualizing the FISH signals. (b) Southern blot of Xba I digested primate genomic DNA separated by pulsed field gel electrophoresis, hybridized with a human digoxigenin-labeled DXZ4 probe. Primates and group are listed along the top and gender indicated by M (male) or F (female), including rhesus macaque (R. Macaque), pig-tailed macaque (P-T. Macaque), common squirrel monkey (Sq. Monkey) and black-handed spider monkey (Sp. Monkey). Size in kilobases is given to the left. (c) Ethidium bromide stained 0.9% agarose gel showing green monkey and macaque BAC DNA digested with the restriction endonuclease Hin dIII and separated by gel electrophoresis. The sizes of the molecular weight marker are given to the left in kilobases.
    Figure Legend Snippet: Mapping and tandem arrangement of DXZ4 in primates . (a) Direct-labeled fluorescence in situ hybridization (FISH) of human DXZ4 BAC clone (2272M5; red) and human PLS3 BAC clone (268A15; green) to male and female rhesus macaque metaphase chromosomes. White arrows point to the hybridizing X chromosome. Metaphase chromosomes were counterstained with DAPI, and converted to gray-scale to assist in visualizing the FISH signals. (b) Southern blot of Xba I digested primate genomic DNA separated by pulsed field gel electrophoresis, hybridized with a human digoxigenin-labeled DXZ4 probe. Primates and group are listed along the top and gender indicated by M (male) or F (female), including rhesus macaque (R. Macaque), pig-tailed macaque (P-T. Macaque), common squirrel monkey (Sq. Monkey) and black-handed spider monkey (Sp. Monkey). Size in kilobases is given to the left. (c) Ethidium bromide stained 0.9% agarose gel showing green monkey and macaque BAC DNA digested with the restriction endonuclease Hin dIII and separated by gel electrophoresis. The sizes of the molecular weight marker are given to the left in kilobases.

    Techniques Used: Labeling, Fluorescence, In Situ Hybridization, Fluorescence In Situ Hybridization, BAC Assay, Southern Blot, Pulsed-Field Gel, Electrophoresis, Staining, Agarose Gel Electrophoresis, Nucleic Acid Electrophoresis, Molecular Weight, Marker

    6) Product Images from "Epigenetic Priming of AML Blasts for All-trans Retinoic Acid-Induced Differentiation by the HDAC Class-I Selective Inhibitor Entinostat"

    Article Title: Epigenetic Priming of AML Blasts for All-trans Retinoic Acid-Induced Differentiation by the HDAC Class-I Selective Inhibitor Entinostat

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075258

    Epigenetic RARβ2 gene silencing in myeloid leukemia cells is reversed by epigenetically active drugs. ( A ) The AML cell lines NB-4, HL-60, Kasumi-1, SKNO-1 and U-937 as well as the CML cell line K562 were treated with 1 µM ATRA for 72 hours, and expression of RARβ2 was determined by RT-PCR. The expected band of 621 bp corresponding to the RARβ2 isoform is shown. Normal CD34+ cells were used as a positive control for RARβ2 mRNA expression. GAPDH served as a control for equal amounts of RNA. ( B ) Effect of entinostat, alone or in combination with decitabine or ATRA, on RARβ2 expression in Kasumi-1 and HL-60 cells. Upper panel, Kasumi-1 cells were treated as described in Materials and Methods with entinostat and ATRA (1 µM) at the concentrations indicated. RARβ2 and GAPDH (internal control) mRNA levels were assayed using RT-PCR. Lower panel, HL-60 cells were treated with ATRA (1 µM), decitabine (200 nM) and entinostat (500 nM) as described above. Cells were then subjected to RT-PCR as described. ( C ) Effect of entinostat on chromatin structure in the RARβ2 gene region 2 in Kasumi-1 cells. Cells were treated with 1 µM entinostat for 24 hours, chromatin immunoprecipitation was performed for the indicated chromatin marks, followed by quantitative real-time PCR for precipitated DNA using primers specific for RARβ2 region 2 (RARE element, see Materials and Methods). ( D ) Cooperative effects of decitabine and entinostat upon RARβ2 re-induction. Kasumi-1 cells were treated with ATRA (1 µM), decitabine (50 nM) and entinostat (50 nM) as shown in Fig. 1A and B. Expression of RARβ2 and GAPDH mRNAs was determined by RT-PCR. ( E ) Effect of entinostat or ATRA, alone or in combination, on RARβ2 expression in primary AML blasts. Primary AML samples were treated with entinostat and ATRA ex vivo as described in Materials and Methods. RARβ2 and GAPDH (internal control) mRNA levels were assayed using RT-PCR.
    Figure Legend Snippet: Epigenetic RARβ2 gene silencing in myeloid leukemia cells is reversed by epigenetically active drugs. ( A ) The AML cell lines NB-4, HL-60, Kasumi-1, SKNO-1 and U-937 as well as the CML cell line K562 were treated with 1 µM ATRA for 72 hours, and expression of RARβ2 was determined by RT-PCR. The expected band of 621 bp corresponding to the RARβ2 isoform is shown. Normal CD34+ cells were used as a positive control for RARβ2 mRNA expression. GAPDH served as a control for equal amounts of RNA. ( B ) Effect of entinostat, alone or in combination with decitabine or ATRA, on RARβ2 expression in Kasumi-1 and HL-60 cells. Upper panel, Kasumi-1 cells were treated as described in Materials and Methods with entinostat and ATRA (1 µM) at the concentrations indicated. RARβ2 and GAPDH (internal control) mRNA levels were assayed using RT-PCR. Lower panel, HL-60 cells were treated with ATRA (1 µM), decitabine (200 nM) and entinostat (500 nM) as described above. Cells were then subjected to RT-PCR as described. ( C ) Effect of entinostat on chromatin structure in the RARβ2 gene region 2 in Kasumi-1 cells. Cells were treated with 1 µM entinostat for 24 hours, chromatin immunoprecipitation was performed for the indicated chromatin marks, followed by quantitative real-time PCR for precipitated DNA using primers specific for RARβ2 region 2 (RARE element, see Materials and Methods). ( D ) Cooperative effects of decitabine and entinostat upon RARβ2 re-induction. Kasumi-1 cells were treated with ATRA (1 µM), decitabine (50 nM) and entinostat (50 nM) as shown in Fig. 1A and B. Expression of RARβ2 and GAPDH mRNAs was determined by RT-PCR. ( E ) Effect of entinostat or ATRA, alone or in combination, on RARβ2 expression in primary AML blasts. Primary AML samples were treated with entinostat and ATRA ex vivo as described in Materials and Methods. RARβ2 and GAPDH (internal control) mRNA levels were assayed using RT-PCR.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Ex Vivo

    Differential methylation of the RARβ2 promoter/exon1 in human myeloid leukemia cells. ( A ) Map of the RARβ2 promoter region with indication of amplicons 1–3 analyzed by bisulfite sequencing (positions of forward (bis F) and reverse (bis R) primers are shown), pyrosequencing and quantitative real-time PCR of ChIP precipitates. RARE: Retinoic Acid Response Element. Vertical ticks indicate single CpGs (region 1∶18 CpGs; region 2∶3 CpGs; region 3∶11 CpGs). Arrow: transcriptional start site. ( B ) Differential DNA methylation of RARβ2 promoter/exon1 in myeloid cells. Normal CD34+ cells, peripheral blood mononuclear cells and myeloid cell lines NB-4, HL-60, Kasumi-1, SKNO-1, U-937 and K562 were subjected to promoter methylation analyses by bisulfite sequencing of genomic DNA as described. Open circles represent unmethylated, closed circles methylated CpG sites. Percentages indicate mean methylation per region across all sequenced alleles. Region 1 was most heavily methylated in HL-60 cells, region 3 in SKNO-1, HL-60 and Kasumi-1, whereas region 2 disclosed lower overall methylation levels (25 and 21% in Kasumi-1 and HL-60, respectively, between 0 and 12% in the other cell lines). ( C ) RARβ2 promoter/exon1 DNA methylation in human myeloid leukemia cell lines is partially reversed by DNA hypomethylating treatment. Kasumi-1 and HL-60 cells were treated with decitabine by three 24-hours incubations of decitabine (DAC) at 200 nM. Cells were harvested 48 hours after the last pulse of decitabine and subjected to bisulfite sequencing. The sequenced alleles of untreated HL-60 and Kasumi-1 cells correspond to the experiment depicted in Fig. 4B. ( D ) RARβ2 5′UTR/exon1 region is rarely methylated in the primary bone marrow blasts of AML patients. Quantitative DNA methylation of the RARβ2 region 2 and 3 (as depicted in Fig. 4A) was analyzed by pyrosequencing in 41 AML patients and is shown as a heatmap. Columns represent single CpGs, each row represents a different sample. White indicates hypomethylation, dark blue indicates hypermethylation. DNA methylation standards (0%, 25%, 50%, 75% and 100% of the in vitro methylated genomic DNA) are depicted at the bottom of the heat map. BM, normal bone marrow.
    Figure Legend Snippet: Differential methylation of the RARβ2 promoter/exon1 in human myeloid leukemia cells. ( A ) Map of the RARβ2 promoter region with indication of amplicons 1–3 analyzed by bisulfite sequencing (positions of forward (bis F) and reverse (bis R) primers are shown), pyrosequencing and quantitative real-time PCR of ChIP precipitates. RARE: Retinoic Acid Response Element. Vertical ticks indicate single CpGs (region 1∶18 CpGs; region 2∶3 CpGs; region 3∶11 CpGs). Arrow: transcriptional start site. ( B ) Differential DNA methylation of RARβ2 promoter/exon1 in myeloid cells. Normal CD34+ cells, peripheral blood mononuclear cells and myeloid cell lines NB-4, HL-60, Kasumi-1, SKNO-1, U-937 and K562 were subjected to promoter methylation analyses by bisulfite sequencing of genomic DNA as described. Open circles represent unmethylated, closed circles methylated CpG sites. Percentages indicate mean methylation per region across all sequenced alleles. Region 1 was most heavily methylated in HL-60 cells, region 3 in SKNO-1, HL-60 and Kasumi-1, whereas region 2 disclosed lower overall methylation levels (25 and 21% in Kasumi-1 and HL-60, respectively, between 0 and 12% in the other cell lines). ( C ) RARβ2 promoter/exon1 DNA methylation in human myeloid leukemia cell lines is partially reversed by DNA hypomethylating treatment. Kasumi-1 and HL-60 cells were treated with decitabine by three 24-hours incubations of decitabine (DAC) at 200 nM. Cells were harvested 48 hours after the last pulse of decitabine and subjected to bisulfite sequencing. The sequenced alleles of untreated HL-60 and Kasumi-1 cells correspond to the experiment depicted in Fig. 4B. ( D ) RARβ2 5′UTR/exon1 region is rarely methylated in the primary bone marrow blasts of AML patients. Quantitative DNA methylation of the RARβ2 region 2 and 3 (as depicted in Fig. 4A) was analyzed by pyrosequencing in 41 AML patients and is shown as a heatmap. Columns represent single CpGs, each row represents a different sample. White indicates hypomethylation, dark blue indicates hypermethylation. DNA methylation standards (0%, 25%, 50%, 75% and 100% of the in vitro methylated genomic DNA) are depicted at the bottom of the heat map. BM, normal bone marrow.

    Techniques Used: Methylation, Methylation Sequencing, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, DNA Methylation Assay, In Vitro

    7) Product Images from "Nucleosomes impede Cas9 access to DNA in vivo and in vitro"

    Article Title: Nucleosomes impede Cas9 access to DNA in vivo and in vitro

    Journal: eLife

    doi: 10.7554/eLife.12677

    HaloTagged Cas9 activity is indistinguishable from untagged Cas9. ( A ) Diagram of the CDS region in the Cas9 expression plasmid used in this study. ( B ) Cleavage assay comparing the HaloTagged Cas9 construct used in this study with an untagged Cas9 commercially purchased from New England Biolabs (NEB, Ipswich, MA). Both forms of Cas9 were incubated with either naked DNA or the same DNA assembled into a nucleosome (see Figure 3A ). A positive control used the restriction enzyme, StyI-HF (from NEB), to target a sequence at a location within the DNA known to be fully protected upon assembly into a nucleosome. Unless explicitly labaled as NEB, all constructs of Cas9 (and dCas9) used were histidine tagged and HaloTagged. DOI: http://dx.doi.org/10.7554/eLife.12677.007
    Figure Legend Snippet: HaloTagged Cas9 activity is indistinguishable from untagged Cas9. ( A ) Diagram of the CDS region in the Cas9 expression plasmid used in this study. ( B ) Cleavage assay comparing the HaloTagged Cas9 construct used in this study with an untagged Cas9 commercially purchased from New England Biolabs (NEB, Ipswich, MA). Both forms of Cas9 were incubated with either naked DNA or the same DNA assembled into a nucleosome (see Figure 3A ). A positive control used the restriction enzyme, StyI-HF (from NEB), to target a sequence at a location within the DNA known to be fully protected upon assembly into a nucleosome. Unless explicitly labaled as NEB, all constructs of Cas9 (and dCas9) used were histidine tagged and HaloTagged. DOI: http://dx.doi.org/10.7554/eLife.12677.007

    Techniques Used: Activity Assay, Expressing, Plasmid Preparation, Cleavage Assay, Construct, Incubation, Positive Control, Sequencing

    8) Product Images from "CPn0572, the C. pneumoniae ortholog of TarP, reorganizes the actin cytoskeleton via a newly identified F-actin binding domain and recruitment of vinculin"

    Article Title: CPn0572, the C. pneumoniae ortholog of TarP, reorganizes the actin cytoskeleton via a newly identified F-actin binding domain and recruitment of vinculin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0210403

    The N-terminus of CPn0572 inhibits actin association of the ABD-C domain while the C-terminus associates with actin in the absence of ABD-C domain. (A) Schematic representation of CPn0572 and deletion variants thereof. ABD-C, black box; ABD, white box. Numbers indicate amino acid positions. Positive actin association is indicated by a checkmark and non-association with a minus on the right margin of the drawings. (B) Confocal images of HEp-2 cells transfected for 18 h with the indicated CPn0572 variants fused to GFP at the N-terminus. F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Bar: 10 μm. (C) Quantification of intracellular localization of GFP-CPn0572 and variants shown in (B) . n ≥ 90 cells per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.
    Figure Legend Snippet: The N-terminus of CPn0572 inhibits actin association of the ABD-C domain while the C-terminus associates with actin in the absence of ABD-C domain. (A) Schematic representation of CPn0572 and deletion variants thereof. ABD-C, black box; ABD, white box. Numbers indicate amino acid positions. Positive actin association is indicated by a checkmark and non-association with a minus on the right margin of the drawings. (B) Confocal images of HEp-2 cells transfected for 18 h with the indicated CPn0572 variants fused to GFP at the N-terminus. F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Bar: 10 μm. (C) Quantification of intracellular localization of GFP-CPn0572 and variants shown in (B) . n ≥ 90 cells per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.

    Techniques Used: Transfection, Plasmid Preparation

    The C-terminus of CPn0572 contains a vinculin-binding domain. (A) Schematic representation of CPn0572 with its C-terminal variants. ABD-C, black box; ABD, white box; predicted α-helices, dark blue boxes (labeled H1 and H2). Numbers indicate amino acid positions. (B) Confocal fluorescence microscopy analysis of transfected cells expressing GFP or GFP-CPn0572 and vinculin fused to SNAP. HEp-2 cells were transfected for 18 h before fixation. F-actin was visualized with phalloidin (red), vinculin with SNAP-cell SiR647 (magenta) and DNA with DAPI (blue). Bars: 10 μm. (C) Quantification of localization phenotypes of GFP-CPn0572 variants shown in (B). n ≥ 90 cells per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.
    Figure Legend Snippet: The C-terminus of CPn0572 contains a vinculin-binding domain. (A) Schematic representation of CPn0572 with its C-terminal variants. ABD-C, black box; ABD, white box; predicted α-helices, dark blue boxes (labeled H1 and H2). Numbers indicate amino acid positions. (B) Confocal fluorescence microscopy analysis of transfected cells expressing GFP or GFP-CPn0572 and vinculin fused to SNAP. HEp-2 cells were transfected for 18 h before fixation. F-actin was visualized with phalloidin (red), vinculin with SNAP-cell SiR647 (magenta) and DNA with DAPI (blue). Bars: 10 μm. (C) Quantification of localization phenotypes of GFP-CPn0572 variants shown in (B). n ≥ 90 cells per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.

    Techniques Used: Binding Assay, Labeling, Fluorescence, Microscopy, Transfection, Expressing, Plasmid Preparation

    CPn0572ΔABD-C colocalizes with actin in mammalian cells. Confocal images of cells transfected with plasmids encoding GFP or GFP-CPn0572 (A) or GFP-CPn0572ΔABD-C (B) . HEp-2 cells were transfected with indicated plasmids for 12, 18, or 24 h and F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Scale bar: 10 μm. Boxed regions show 3-fold enlargement. (C) Quantification of GFP-CPn0572 and GFP-CPn0572ΔABD-C-derived phenotypes after transfection, monitored every 2 h (range: 12 to 24 h). n ≥ 100 cells per time point and per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.
    Figure Legend Snippet: CPn0572ΔABD-C colocalizes with actin in mammalian cells. Confocal images of cells transfected with plasmids encoding GFP or GFP-CPn0572 (A) or GFP-CPn0572ΔABD-C (B) . HEp-2 cells were transfected with indicated plasmids for 12, 18, or 24 h and F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Scale bar: 10 μm. Boxed regions show 3-fold enlargement. (C) Quantification of GFP-CPn0572 and GFP-CPn0572ΔABD-C-derived phenotypes after transfection, monitored every 2 h (range: 12 to 24 h). n ≥ 100 cells per time point and per transfected plasmid. All quantifications were reproducible and analyzed from triplicates.

    Techniques Used: Transfection, Derivative Assay, Plasmid Preparation

    Helix 2 of CPn0572 plays a role in vinculin association. (A) Schematic representation of CPn0572 and variants thereof. (B) Confocal fluorescence microscopy analysis of transfected cells expressing CPn0572 variants fused to GFP and vinculin fused to SNAP. HEp-2 cells were transfected for 18 h before fixation. Vinculin was visualized with SNAP-cell SiR647 (magenta) and DNA with DAPI (blue). Bars: 10 μm. (C) Schematic representation of the methodology used for the quantification of GFP fluorescence intensity colocalized with vinculin. (D) GFP fluorescence intensity of GFP-CPn0572 variants that colocalize with vinculin puncta. arbitrary units (a.u.). n = 90 independent measurements for each construct analyzed from triplicates.
    Figure Legend Snippet: Helix 2 of CPn0572 plays a role in vinculin association. (A) Schematic representation of CPn0572 and variants thereof. (B) Confocal fluorescence microscopy analysis of transfected cells expressing CPn0572 variants fused to GFP and vinculin fused to SNAP. HEp-2 cells were transfected for 18 h before fixation. Vinculin was visualized with SNAP-cell SiR647 (magenta) and DNA with DAPI (blue). Bars: 10 μm. (C) Schematic representation of the methodology used for the quantification of GFP fluorescence intensity colocalized with vinculin. (D) GFP fluorescence intensity of GFP-CPn0572 variants that colocalize with vinculin puncta. arbitrary units (a.u.). n = 90 independent measurements for each construct analyzed from triplicates.

    Techniques Used: Fluorescence, Microscopy, Transfection, Expressing, Construct

    CPn0572 536-595 associates with actin. (A) Schematic representation of CPn0572 and C-terminal variants. ABD-C, black box; ABD, white box; predicted α-helices, dark blue boxes (labeled H1 and H2). Numbers indicate amino acid positions. Positive actin association is indicated by a checkmark and non-actin association with a minus on the right margin of the drawings. (B) Confocal fluorescence microscopy analysis of transfected cells expressing GFP or GFP-CPn0572 variants. HEp-2 cells were transfected for 18 h before fixation. F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Tips of actin cables are marked by white arrow heads. Bar: 10 μm. (C) Quantification of localization phenotypes of GFP-CPn0572 and variants shown in (B) : CPn0572 536-755 (n = 572), CPn0572 536-595 (n = 313), CPn0572 595-659 (n = 380), CPn0572 660-755 (n = 347) and CPn0572 695-755 (n = 563). All quantifications were reproducible and analyzed from triplicates.
    Figure Legend Snippet: CPn0572 536-595 associates with actin. (A) Schematic representation of CPn0572 and C-terminal variants. ABD-C, black box; ABD, white box; predicted α-helices, dark blue boxes (labeled H1 and H2). Numbers indicate amino acid positions. Positive actin association is indicated by a checkmark and non-actin association with a minus on the right margin of the drawings. (B) Confocal fluorescence microscopy analysis of transfected cells expressing GFP or GFP-CPn0572 variants. HEp-2 cells were transfected for 18 h before fixation. F-actin was visualized with phalloidin (red) and DNA with DAPI (blue). Tips of actin cables are marked by white arrow heads. Bar: 10 μm. (C) Quantification of localization phenotypes of GFP-CPn0572 and variants shown in (B) : CPn0572 536-755 (n = 572), CPn0572 536-595 (n = 313), CPn0572 595-659 (n = 380), CPn0572 660-755 (n = 347) and CPn0572 695-755 (n = 563). All quantifications were reproducible and analyzed from triplicates.

    Techniques Used: Labeling, Fluorescence, Microscopy, Transfection, Expressing

    9) Product Images from "Dissection of DNA double-strand break repair using novel single-molecule forceps"

    Article Title: Dissection of DNA double-strand break repair using novel single-molecule forceps

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-018-0065-1

    Model for multivalent stabilization of DNA-end synapsis by NHEJ machinery. Schematic model for synapsis and repair involves (top) an initial synaptic complex formed by two DNA-PK holoenzymes but with a lifetime in the range of hundreds of milliseconds and which can be stabilized by incorporation of PAXX (left path) or XRCC4–XLF–Ligase IV (right path). A complete complex stabilized by both PAXX and XRCC4–XLF–Ligase IV has the longest lifetime (bottom) and leads to efficient ligation of the DSB.
    Figure Legend Snippet: Model for multivalent stabilization of DNA-end synapsis by NHEJ machinery. Schematic model for synapsis and repair involves (top) an initial synaptic complex formed by two DNA-PK holoenzymes but with a lifetime in the range of hundreds of milliseconds and which can be stabilized by incorporation of PAXX (left path) or XRCC4–XLF–Ligase IV (right path). A complete complex stabilized by both PAXX and XRCC4–XLF–Ligase IV has the longest lifetime (bottom) and leads to efficient ligation of the DSB.

    Techniques Used: Non-Homologous End Joining, Ligation

    Double-strand break repair by NHEJ proteins at single-molecule resolution (A) A 600 bp dsDNA segment (magenta) joins two 1.5 kbp dsDNA segments (blue, red), forming a construct in which two blunt ends face each other. Stars represent phosphate groups. The construct is tethered to a treated glass surface and a 1-micron magnetic bead. Magnets located above the sample generate a controlled extending force on the DNA (green arrow), and the DNA end-to-end extension is determined in real-time. Ligation is observed via a series of four steps: (1) at high force a high-extension state is initially observed, (2) the force is lowered allowing the DNA ends to interact, (3) the force is returned to its initial value but if end ligation has occurred the construct cannot recover its initial extension, (4) the initial extension is recovered upon specific cleavage of repaired DNA. (B) Time-trace obtained upon force-modulation (red) in the presence of Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. Initially, DNA extension (blue points) is shown to alternate between a low and a high value upon force modulation. After addition of NHEJ components (black up arrow) the maximum extension displayed by the construct is reduced. After washing the sample with 0.2% SDS (break in time-trace), addition of SmaI (red up arrow) results in an increase, Δl in DNA extension. (C) Histogram of Δl values. Red line is a fit to a Gaussian distribution, with a maximum at 161 ± 8 nm (SD, n=28 cleavage events). (D) DNA ligation probability per traction cycle. We monitored 50 DNA molecules; of 36 molecules repaired 28 were monitored throughout the cleavage reaction. Red line: single-exponential fitting yields a time constant of ˜0.8 ± 0.2 cycles (SEM, n=36) or ˜175s.
    Figure Legend Snippet: Double-strand break repair by NHEJ proteins at single-molecule resolution (A) A 600 bp dsDNA segment (magenta) joins two 1.5 kbp dsDNA segments (blue, red), forming a construct in which two blunt ends face each other. Stars represent phosphate groups. The construct is tethered to a treated glass surface and a 1-micron magnetic bead. Magnets located above the sample generate a controlled extending force on the DNA (green arrow), and the DNA end-to-end extension is determined in real-time. Ligation is observed via a series of four steps: (1) at high force a high-extension state is initially observed, (2) the force is lowered allowing the DNA ends to interact, (3) the force is returned to its initial value but if end ligation has occurred the construct cannot recover its initial extension, (4) the initial extension is recovered upon specific cleavage of repaired DNA. (B) Time-trace obtained upon force-modulation (red) in the presence of Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. Initially, DNA extension (blue points) is shown to alternate between a low and a high value upon force modulation. After addition of NHEJ components (black up arrow) the maximum extension displayed by the construct is reduced. After washing the sample with 0.2% SDS (break in time-trace), addition of SmaI (red up arrow) results in an increase, Δl in DNA extension. (C) Histogram of Δl values. Red line is a fit to a Gaussian distribution, with a maximum at 161 ± 8 nm (SD, n=28 cleavage events). (D) DNA ligation probability per traction cycle. We monitored 50 DNA molecules; of 36 molecules repaired 28 were monitored throughout the cleavage reaction. Red line: single-exponential fitting yields a time constant of ˜0.8 ± 0.2 cycles (SEM, n=36) or ˜175s.

    Techniques Used: Non-Homologous End Joining, Construct, Ligation, DNA Ligation

    Maximum stabilization of DNA end synapsis by Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. (A) Experimental design. DNA is prepared with blunt ends using SmaI digest and then dephosphorylated (see Materials Methods ). (B) Representative time-trace obtained upon application of the force-modulation pattern (red) in the presence of Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. Transient synapsis is observed as an intermediate DNA extension state, which spontaneously reverts to the maximum extension, allowing us to characterize the duration of the intermediate state and the change in extension upon reversion to the maximum extension. (C) Histogram of DNA extension change (Δl) upon rupture event. Red line is a fit to a Gaussian distribution, with a maximum (red arrow) at 165 ± 9 nm (SD, n=324 events in the histogram, of which 183 within three standard deviations from the peak). (D) Lifetime distribution of the synaptic state is fit to a single-exponential distribution (red line), giving a lifetime of 66.4 ± 7.6 s (SEM, n=183).
    Figure Legend Snippet: Maximum stabilization of DNA end synapsis by Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. (A) Experimental design. DNA is prepared with blunt ends using SmaI digest and then dephosphorylated (see Materials Methods ). (B) Representative time-trace obtained upon application of the force-modulation pattern (red) in the presence of Ku, DNA-PKcs, PAXX, XLF, XRCC4 and Ligase IV. Transient synapsis is observed as an intermediate DNA extension state, which spontaneously reverts to the maximum extension, allowing us to characterize the duration of the intermediate state and the change in extension upon reversion to the maximum extension. (C) Histogram of DNA extension change (Δl) upon rupture event. Red line is a fit to a Gaussian distribution, with a maximum (red arrow) at 165 ± 9 nm (SD, n=324 events in the histogram, of which 183 within three standard deviations from the peak). (D) Lifetime distribution of the synaptic state is fit to a single-exponential distribution (red line), giving a lifetime of 66.4 ± 7.6 s (SEM, n=183).

    Techniques Used:

    10) Product Images from "Development and Application of a Loop-Mediated Isothermal Amplification (LAMP) Approach for the Rapid Detection of Dirofilaria repens from Biological Samples"

    Article Title: Development and Application of a Loop-Mediated Isothermal Amplification (LAMP) Approach for the Rapid Detection of Dirofilaria repens from Biological Samples

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0004789

    Relative positions of LAMP primers within the cytochrome c oxidase gene of D . repens . The first steps of the LAMP reaction are also depicted. i) Primers F3/B3, and DIR F2/ DIR B2 (parts of DIR FIP and DIR BIP, respectively), recognize and anneal to their respective complementary targets. The DNA synthesis starts and the strand displacement activity of the DNA polymerase let the strand synthesized from DIR F2 and DIR B2 to be detached from the template strand. ii) The displaced neo-synthesized strands bring, at their termini, DIR F1c and DIR B1c that iii) will self-anneal to the DIR F1 and DIR B1 loci, respectively, thus forming a secondary structure with a loop. DIR B3/ DIR F3 and DIR BIP/ DIR FIP (specifically with the portions DIR B2 and DIR F2) hybridize with the complementary regions of the strand. The synthesis and the displacement of strand occur again, catalyzed by the same DNA polymerase. iv) the 3’ and 5’ termini, bearing DIR F1/ DIR B1 and DIR B1c/ DIR F1c, respectively, self-anneal to the complementary loci harbored by the same strand, which, in turn, will form the typical dumbbell structure. The DNA polymerase will catalyze the DNA synthesis starting from the 3’ terminus, displacing the 5’ terminus, and producing a concatamer which will be the basis for following the amplification steps.
    Figure Legend Snippet: Relative positions of LAMP primers within the cytochrome c oxidase gene of D . repens . The first steps of the LAMP reaction are also depicted. i) Primers F3/B3, and DIR F2/ DIR B2 (parts of DIR FIP and DIR BIP, respectively), recognize and anneal to their respective complementary targets. The DNA synthesis starts and the strand displacement activity of the DNA polymerase let the strand synthesized from DIR F2 and DIR B2 to be detached from the template strand. ii) The displaced neo-synthesized strands bring, at their termini, DIR F1c and DIR B1c that iii) will self-anneal to the DIR F1 and DIR B1 loci, respectively, thus forming a secondary structure with a loop. DIR B3/ DIR F3 and DIR BIP/ DIR FIP (specifically with the portions DIR B2 and DIR F2) hybridize with the complementary regions of the strand. The synthesis and the displacement of strand occur again, catalyzed by the same DNA polymerase. iv) the 3’ and 5’ termini, bearing DIR F1/ DIR B1 and DIR B1c/ DIR F1c, respectively, self-anneal to the complementary loci harbored by the same strand, which, in turn, will form the typical dumbbell structure. The DNA polymerase will catalyze the DNA synthesis starting from the 3’ terminus, displacing the 5’ terminus, and producing a concatamer which will be the basis for following the amplification steps.

    Techniques Used: DNA Synthesis, Activity Assay, Synthesized, Amplification

    11) Product Images from "A Universal Next-Generation Sequencing Protocol To Generate Noninfectious Barcoded cDNA Libraries from High-Containment RNA Viruses"

    Article Title: A Universal Next-Generation Sequencing Protocol To Generate Noninfectious Barcoded cDNA Libraries from High-Containment RNA Viruses

    Journal: mSystems

    doi: 10.1128/mSystems.00039-15

    Overview of the proposed standard operating procedure (SOP) for rapid next-generation sequencing library preparation and inactivation of ssRNA+ viruses. (A) Stepwise overview of the SOP. A detailed protocol is provided in Text S1 in the supplemental material. Steps in the pink box denote work performed in a biosafety level 3 and/or 4 (BSL-3/4) laboratory. Steps in the blue box denote work that can be performed in a BSL-2 laboratory. The asterisk in step 1 indicates that for nonselect agent pathogens (e.g., West Nile virus), extracted RNA may be moved to BSL-2 for library construction. Step 1, generating cDNA and SISPA, utilizes a primer with a random hexamer coupled to a unique barcode (BC-N6). SISPA stands for sequence-independent single-primer amplification. (B) The BC-N6 primer is used for both generating single-stranded cDNA from input RNA and generating double-stranded DNA by randomly priming the synthesized cDNA. A PCR step using primers only encoding the barcode sequence with either three or four random nucleotides (3N/4N) at the 5′ end simultaneously amplifies and uniquely identifies (barcodes) a sample. (C) Representative gel image that displays products of the SOP obtained from serial dilutions of genomic human rhinovirus 16 (HRV-16) virion RNA. At high-input RNA amounts, a smear between 200 bp and 1,000 bp is visible. This signal intensity diminishes as the starting material is diluted. (D) Summary of diverse types of starting material which can feed into the SOP. Samples enriched for virus-specific sequence (e.g., virion stocks) can directly proceed to the SOP. For samples that contain a majority of host nucleic acid, the use of upstream procedures to enrich for virus-specific signal (e.g., rRNA depletion or mRNA enhancement) is recommended.
    Figure Legend Snippet: Overview of the proposed standard operating procedure (SOP) for rapid next-generation sequencing library preparation and inactivation of ssRNA+ viruses. (A) Stepwise overview of the SOP. A detailed protocol is provided in Text S1 in the supplemental material. Steps in the pink box denote work performed in a biosafety level 3 and/or 4 (BSL-3/4) laboratory. Steps in the blue box denote work that can be performed in a BSL-2 laboratory. The asterisk in step 1 indicates that for nonselect agent pathogens (e.g., West Nile virus), extracted RNA may be moved to BSL-2 for library construction. Step 1, generating cDNA and SISPA, utilizes a primer with a random hexamer coupled to a unique barcode (BC-N6). SISPA stands for sequence-independent single-primer amplification. (B) The BC-N6 primer is used for both generating single-stranded cDNA from input RNA and generating double-stranded DNA by randomly priming the synthesized cDNA. A PCR step using primers only encoding the barcode sequence with either three or four random nucleotides (3N/4N) at the 5′ end simultaneously amplifies and uniquely identifies (barcodes) a sample. (C) Representative gel image that displays products of the SOP obtained from serial dilutions of genomic human rhinovirus 16 (HRV-16) virion RNA. At high-input RNA amounts, a smear between 200 bp and 1,000 bp is visible. This signal intensity diminishes as the starting material is diluted. (D) Summary of diverse types of starting material which can feed into the SOP. Samples enriched for virus-specific sequence (e.g., virion stocks) can directly proceed to the SOP. For samples that contain a majority of host nucleic acid, the use of upstream procedures to enrich for virus-specific signal (e.g., rRNA depletion or mRNA enhancement) is recommended.

    Techniques Used: Next-Generation Sequencing, Random Hexamer Labeling, Sequencing, Amplification, Synthesized, Polymerase Chain Reaction

    12) Product Images from "IL-32 gamma reduces lung tumor development through upregulation of TIMP-3 overexpression and hypomethylation"

    Article Title: IL-32 gamma reduces lung tumor development through upregulation of TIMP-3 overexpression and hypomethylation

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0375-6

    Effect of IL-32γ on the binding of DNMT1 in TIMP-3 promoter. a Expression of DNMT1 of murine tumors was determined by Western blotting. b Expression of DNMT1 in nuclear extracts of lung cancer cells transfected by IL-32γ was determined by Western blotting. c A549 lung cancer cells were transfected with pcDNA or IL-32γ plasmid for 24 h. Reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by ChiP assay. d Effect of DNA methyltransferase inhibitor (5-Aza-CdR; 5 μM) on reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by ChiP assay. Effect of NF-κB inhibitor (PS1145; 10 μM) on reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by chip assay. TIMP-3 promoter was determined by ChiP assay. Each band is representative of three independent experiments. e , f Effect of DNA methyltransferase inhibitor (5-Aza-CdR; 5 μM) ( e ) or NF-κB inhibitor (PS1145; 10 μM) ( f ) on cell viability was determined by MTT assay. g Effect of NF-κB inhibitor (PS1145; 10 μM) on TIMP-3 methylation and Expression of DNMT1. h Effect of recombinant protein (rP) of p50 (50 ng/ml) on TIMP-3 methylation and Expression of DNMT1 in A549 cells. Allthe experiment were performed three times with duplicates. * P
    Figure Legend Snippet: Effect of IL-32γ on the binding of DNMT1 in TIMP-3 promoter. a Expression of DNMT1 of murine tumors was determined by Western blotting. b Expression of DNMT1 in nuclear extracts of lung cancer cells transfected by IL-32γ was determined by Western blotting. c A549 lung cancer cells were transfected with pcDNA or IL-32γ plasmid for 24 h. Reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by ChiP assay. d Effect of DNA methyltransferase inhibitor (5-Aza-CdR; 5 μM) on reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by ChiP assay. Effect of NF-κB inhibitor (PS1145; 10 μM) on reduced binding of DNMT1 by IL-32γ in TIMP-3 promoter was determined by chip assay. TIMP-3 promoter was determined by ChiP assay. Each band is representative of three independent experiments. e , f Effect of DNA methyltransferase inhibitor (5-Aza-CdR; 5 μM) ( e ) or NF-κB inhibitor (PS1145; 10 μM) ( f ) on cell viability was determined by MTT assay. g Effect of NF-κB inhibitor (PS1145; 10 μM) on TIMP-3 methylation and Expression of DNMT1. h Effect of recombinant protein (rP) of p50 (50 ng/ml) on TIMP-3 methylation and Expression of DNMT1 in A549 cells. Allthe experiment were performed three times with duplicates. * P

    Techniques Used: Binding Assay, Expressing, Western Blot, Transfection, Plasmid Preparation, Chromatin Immunoprecipitation, MTT Assay, Methylation, Recombinant

    13) Product Images from "Recurrent Variations in DNA Methylation in Human Pluripotent Stem Cells and their Differentiated Derivatives"

    Article Title: Recurrent Variations in DNA Methylation in Human Pluripotent Stem Cells and their Differentiated Derivatives

    Journal:

    doi: 10.1016/j.stem.2012.02.013

    Differential DNA methylation in pluripotent and somatic cells Data for CpG sites differentially methylated between pluripotent and somatic cells (Δβ > 0.2) on the 27K DNA Methylation array are shown. A. PluripotentLowVar /SomaticLowVar : 1432 CpGs for 1282 genes with low variation (s.d. < 0.2) within both the pluripotent and somatic sample groups. The seven clusters of CpGs that were examined using the GREAT algorithm are shaded on the left. B. PluripotentHighVar /SomaticLowVar : 303 CpGs for 234 genes with variable methylation only in the pluripotent group (s.d. > 0.2). C. PluripotentLowVar /SomaticHighVar : 1691 CpGs for 1442 genes with variable methylation only in the somatic group. The color scale for the β values is shown. The distribution of sample types are indicated below each heatmap, with hESCs in black, hiPSCs in yellow, and somatic cells in red. See also and .
    Figure Legend Snippet: Differential DNA methylation in pluripotent and somatic cells Data for CpG sites differentially methylated between pluripotent and somatic cells (Δβ > 0.2) on the 27K DNA Methylation array are shown. A. PluripotentLowVar /SomaticLowVar : 1432 CpGs for 1282 genes with low variation (s.d. < 0.2) within both the pluripotent and somatic sample groups. The seven clusters of CpGs that were examined using the GREAT algorithm are shaded on the left. B. PluripotentHighVar /SomaticLowVar : 303 CpGs for 234 genes with variable methylation only in the pluripotent group (s.d. > 0.2). C. PluripotentLowVar /SomaticHighVar : 1691 CpGs for 1442 genes with variable methylation only in the somatic group. The color scale for the β values is shown. The distribution of sample types are indicated below each heatmap, with hESCs in black, hiPSCs in yellow, and somatic cells in red. See also and .

    Techniques Used: DNA Methylation Assay, Methylation

    14) Product Images from "Optimized Whole-Genome Amplification Strategy for Extremely AT-Biased Template"

    Article Title: Optimized Whole-Genome Amplification Strategy for Extremely AT-Biased Template

    Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

    doi: 10.1093/dnares/dsu028

    Determining the lowest threshold of input DNA mass for WGA. Different amounts of P. falciparum 3D7 genomic DNA (ranging from 2 ng to 100 fg, as shown in sample names) were used as an input template for amplification by Repli_g following the standard or optimized procedure. Samples were multiplexed and sequenced using a fast turn-around Illumina Miseq machine. Sequence reads mapped to the reference were normalized and analysed for coverage and base quality using the ‘CallableLoci’ program of GATK. A non-WGA sample was used as an unamplified control. Input quantities ranging from 2 ng down to 10 pg produced reads with high-quality ‘callable’ bases covering over 60% of the genome. Input DNA below the10-pg threshold produced poor base quality with only
    Figure Legend Snippet: Determining the lowest threshold of input DNA mass for WGA. Different amounts of P. falciparum 3D7 genomic DNA (ranging from 2 ng to 100 fg, as shown in sample names) were used as an input template for amplification by Repli_g following the standard or optimized procedure. Samples were multiplexed and sequenced using a fast turn-around Illumina Miseq machine. Sequence reads mapped to the reference were normalized and analysed for coverage and base quality using the ‘CallableLoci’ program of GATK. A non-WGA sample was used as an unamplified control. Input quantities ranging from 2 ng down to 10 pg produced reads with high-quality ‘callable’ bases covering over 60% of the genome. Input DNA below the10-pg threshold produced poor base quality with only

    Techniques Used: Whole Genome Amplification, Amplification, Sequencing, Produced

    15) Product Images from "Detection and characterization of spacer integration intermediates in type I-E CRISPR-Cas system"

    Article Title: Detection and characterization of spacer integration intermediates in type I-E CRISPR-Cas system

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku510

    Southern analyses with genomic DNA after induction of spacer integration. Genomic DNAs were prepared from BL21-AI strains harboring either pCR001 (expressing wild-type Cas1 and Cas2 proteins) or pCR002 (expressing D221A Cas1 and wild-type Cas2), grown for 24 h without (−) or with IPTG/arabinose-induction (+). 27.5 μg (in C and D ) or 30 μg (in F) of Dra- or Ban-digested DNA were separated on 10% denaturing polyacrylamide gel and blotted onto nylon membrane. The fragments were visualized by hybridization with radiolabeled oligonucleotides complementary to the non-template or template strand of the leader DNA (probes 1 and 2), the second spacer sequence (probes 3 and 4), or the first spacer (probes 5 and 6). Autoradiograms of the Southern blots obtained with DraI-digested (C, F ) or BanI-digested genomic DNA (D, F) are shown. Cas1 and Cas2-dependent cleavage products and their lengths are indicated by arrows. ( A and B ) The schemes depict the expected lengths of the DNA fragments in the case of a putative Cas1 and Cas2-directed staggered cut at the first repeat sequence. ( E ) Modified model for the intermediates is shown, which considers a concerted cut and ligation of a new spacer DNA (S0, green). R: repeat; S: spacer.
    Figure Legend Snippet: Southern analyses with genomic DNA after induction of spacer integration. Genomic DNAs were prepared from BL21-AI strains harboring either pCR001 (expressing wild-type Cas1 and Cas2 proteins) or pCR002 (expressing D221A Cas1 and wild-type Cas2), grown for 24 h without (−) or with IPTG/arabinose-induction (+). 27.5 μg (in C and D ) or 30 μg (in F) of Dra- or Ban-digested DNA were separated on 10% denaturing polyacrylamide gel and blotted onto nylon membrane. The fragments were visualized by hybridization with radiolabeled oligonucleotides complementary to the non-template or template strand of the leader DNA (probes 1 and 2), the second spacer sequence (probes 3 and 4), or the first spacer (probes 5 and 6). Autoradiograms of the Southern blots obtained with DraI-digested (C, F ) or BanI-digested genomic DNA (D, F) are shown. Cas1 and Cas2-dependent cleavage products and their lengths are indicated by arrows. ( A and B ) The schemes depict the expected lengths of the DNA fragments in the case of a putative Cas1 and Cas2-directed staggered cut at the first repeat sequence. ( E ) Modified model for the intermediates is shown, which considers a concerted cut and ligation of a new spacer DNA (S0, green). R: repeat; S: spacer.

    Techniques Used: Expressing, Hybridization, Sequencing, Modification, Ligation

    Related Articles

    Amplification:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA). .. The relative amounts of H-RasG12V gene or mRNA were analyzed by real time PCR or real time RT-PCR, respectively, using the SYBR GreenER Q-PCR SuperMix for the iCycler® kit and protocol (Invitrogen, Carlsbad, CA, USA).

    Article Title: A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping
    Article Snippet: Amplification was performed in a 2720 Thermal Cycler (Applied Biosystems) under the following conditions: initial denaturation for 5 min at 94°C, followed by 30 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 50°C and elongation for 60 s at 72°C plus a final elongation step for 7 min at 72°C. .. We separated 10 μl of PCR product by electrophoresis in a 2% agarose gel (Eurogentec, Belgium), which was also loaded with a 100 bp DNA size ladder (New England BioLabs).

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Article Title: Functional Heterogeneity of the UpaH Autotransporter Protein from Uropathogenic Escherichia coli
    Article Snippet: Experimentally tested curved motifs produce curvature values of 5 to 25°/helical turn, whereas straight motifs give values below 5°/helical turn. .. The upaH 250-bp promoter region was amplified using the primers upaH.pro.ext-5 + 250 (5′-TTGATTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250B (5′-TTGGTTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250C (5′-TGGTTTATACCGTTTTTTTCATTA-3′), and upaH.pro.ext-3-1ATG (5′-AATAAATCCTTCTGGCGAATATAA-3′) and its intrinsic curvature was assessed by comparing its electrophoretic mobility with that of a 100-bp DNA ladder (New England BioLabs) on a 0.5× TBE, 7.5% PAGE gel at 4°C. .. The prevalence of the upaH gene was analyzed in 61 complete and 247 draft E. coli genome sequences available in the NCBI database.

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: After preclearing, 1% of this reaction was saved for direct PCR amplification (input). .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Article Title: A real-time PCR assay for quantification of parasite burden in murine models of leishmaniasis
    Article Snippet: After amplification by conventional PCR, three of these primer pairs resulted in non-specific amplification as detected by ethidium bromide detection in a 1% agarose gel. .. Amplicon size was verified by separating the PCR product in a 1% agarose gel, visualizing the product by ethidium bromide staining, and comparing to 100 bp DNA staining ladder (N3231S; New England Biolabs, Ipswich, MA, USA). .. Based on this initial screen, the primers reported in were then used to amplify wildtype L. major (MHOM/SN/74/Seidman) promastigote DNA as described below.

    Polymerase Chain Reaction:

    Article Title: Intravenous Delivery of Oncolytic Reovirus to Brain Tumor Patients Immunologically Primes for Subsequent Checkpoint Blockade
    Article Snippet: Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs). .. Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs).

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. Products of TP-PCR with a fluorescently labeled primer were analyzed by capillary electrophoresis, with scans shown in (A) where the green line plots the TP-PCR products.

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: All PCR products were separated by agarose-gel electrophoresis, stained with SYBR® Safe DNA gel stain (Invitrogen) and visualized using a UV transluminator. .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs). .. Images of stained gels were taken using an UVP ImageStore 5000 system.

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA). .. The relative amounts of H-RasG12V gene or mRNA were analyzed by real time PCR or real time RT-PCR, respectively, using the SYBR GreenER Q-PCR SuperMix for the iCycler® kit and protocol (Invitrogen, Carlsbad, CA, USA).

    Article Title: A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping
    Article Snippet: Amplification was performed in a 2720 Thermal Cycler (Applied Biosystems) under the following conditions: initial denaturation for 5 min at 94°C, followed by 30 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 50°C and elongation for 60 s at 72°C plus a final elongation step for 7 min at 72°C. .. We separated 10 μl of PCR product by electrophoresis in a 2% agarose gel (Eurogentec, Belgium), which was also loaded with a 100 bp DNA size ladder (New England BioLabs). .. Electrophoresis was performed in 20 cm-long gels, in 1× TBE buffer (89 mM Tris-Borate, 2.5 mM EDTA) containing 1 μg/ml ethidium bromide run at 10 V/cm.

    Article Title: STRetch: detecting and discovering pathogenic short tandem repeat expansions
    Article Snippet: To validate the novel STR expansion in an intron of MTHFD2 (as predicted by STRetch), PCR was conducted using GoTaq G2 colorless master mix (Promega, USA) with 0.5-μM primers (see Additional file : Table S5) and 10 ng of template DNA per reaction. .. Product sizes and STR length were estimated relative to a 100-bp DNA ladder by generating a standard curve (NEB, USA).

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The single-stranded PCR products were prepared by lambda exonuclease digestion to facilitate hybridization of the fluorescently labeled probes to the target sequence. .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Article Title: Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR
    Article Snippet: The PCR products were analyzed by gel electrophoresis on 15-cm-long 2% agarose gels in 0.5× TBE (Tris-borate-EDTA) buffer at 175 V for 75 min. .. The sizes of the PCR products and corresponding serotype were determined by comparison with a 100-bp molecular size standard (New England BioLabs). .. The accession numbers for the CPS sequences described in this paper are shown in .

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: PCR reactions were performed using the following primers: 583 site 5′ GTGAGTGTGAGCTGAAGCGGG 3′ (−662 to −641 relative to the transcription start site) and 5′ GTTTCCCCTGAAGCCCGCGTG 3′ (−524 to −503); 251/272 site 5′ GCGGGTGATGTCAGCTCTC 3′ (−3 1 5 t o −296) and 5′ GTGAGCGTGCGTGCGCGTGTG 3′ (−167 to −146). .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Article Title: A High-Throughput Screening Assay for the Functional Delivery of Splice-Switching Oligonucleotides in Human Melanoma Cells
    Article Snippet: Luciferase PCR Primers. .. 100 bp DNA ladder (New England Biolabs).

    Article Title: A real-time PCR assay for quantification of parasite burden in murine models of leishmaniasis
    Article Snippet: After amplification by conventional PCR, three of these primer pairs resulted in non-specific amplification as detected by ethidium bromide detection in a 1% agarose gel. .. Amplicon size was verified by separating the PCR product in a 1% agarose gel, visualizing the product by ethidium bromide staining, and comparing to 100 bp DNA staining ladder (N3231S; New England Biolabs, Ipswich, MA, USA). .. Based on this initial screen, the primers reported in were then used to amplify wildtype L. major (MHOM/SN/74/Seidman) promastigote DNA as described below.

    Construct:

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: First, deletion mutants with varying lengths (23–500 bp) between two constant primer regions were constructed from a pMAL plasmid with a Quikchange site-directed mutagenesis kit (Agilent, Santa Clara, CA). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Electrophoresis:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: All PCR products were separated by agarose-gel electrophoresis, stained with SYBR® Safe DNA gel stain (Invitrogen) and visualized using a UV transluminator. .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs).

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Article Title: A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping
    Article Snippet: Amplification was performed in a 2720 Thermal Cycler (Applied Biosystems) under the following conditions: initial denaturation for 5 min at 94°C, followed by 30 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 50°C and elongation for 60 s at 72°C plus a final elongation step for 7 min at 72°C. .. We separated 10 μl of PCR product by electrophoresis in a 2% agarose gel (Eurogentec, Belgium), which was also loaded with a 100 bp DNA size ladder (New England BioLabs). .. Electrophoresis was performed in 20 cm-long gels, in 1× TBE buffer (89 mM Tris-Borate, 2.5 mM EDTA) containing 1 μg/ml ethidium bromide run at 10 V/cm.

    Incubation:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: MBN is specific for single-stranded DNA including hairpin tips and loops of slip-outs, while T7endoI cleaves at the arms of three-way DNA junctions, common to slipped-DNA formed from CTG/CAG repeats , . .. 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. After digestion, the DNA was subjected to TP-PCR (see Supplementary for primers).

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: The remainder of the reaction was incubated with rabbit anti-NF-κB p65 antibody, rabbit anti-NF-κB p50 antibody, or control rabbit IgG (Invitrogen). .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Luciferase:

    Article Title: A High-Throughput Screening Assay for the Functional Delivery of Splice-Switching Oligonucleotides in Human Melanoma Cells
    Article Snippet: Luciferase PCR Primers. .. 100 bp DNA ladder (New England Biolabs).

    In Silico:

    Article Title: Functional Heterogeneity of the UpaH Autotransporter Protein from Uropathogenic Escherichia coli
    Article Snippet: The upaH promoter region was analyzed in silico using BendIt, a program that enables the prediction of a curvature-propensity plot calculated with DNase I-based parameters ( ). .. The upaH 250-bp promoter region was amplified using the primers upaH.pro.ext-5 + 250 (5′-TTGATTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250B (5′-TTGGTTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250C (5′-TGGTTTATACCGTTTTTTTCATTA-3′), and upaH.pro.ext-3-1ATG (5′-AATAAATCCTTCTGGCGAATATAA-3′) and its intrinsic curvature was assessed by comparing its electrophoretic mobility with that of a 100-bp DNA ladder (New England BioLabs) on a 0.5× TBE, 7.5% PAGE gel at 4°C.

    Expressing:

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs). .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs).

    Western Blot:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: Paragraph title: Confirmation of transformation by Western blot, PCR, RT-PCR and real-time PCR ... The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Transformation Assay:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: Paragraph title: Confirmation of transformation by Western blot, PCR, RT-PCR and real-time PCR ... The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Derivative Assay:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: The full data, derived from multiple independent genomic isolations and independent IPs, are summarized in . (PDF) Click here for additional data file. .. 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Hybridization:

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The single-stranded PCR products were prepared by lambda exonuclease digestion to facilitate hybridization of the fluorescently labeled probes to the target sequence. .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Article Title: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics
    Article Snippet: For northern blots, 10 µg of total RNA was electrophoresed on 6% acrylamide gels, electroblotted to Zeta-probe nylon membranes (BioRad), and hybridized to 5′ end-labeled 40–50 nt oligonucleotide probes, as previously described , except the hybridization temperature was 65°C. .. The 100 bp DNA size standard ladder was from New England Biolabs.

    Article Title: Induction of Mitochondrial Alternative Oxidase in Response to a Cell Signal Pathway Down-Regulating the Cytochrome Pathway Prevents Programmed Cell Death
    Article Snippet: A 100-bp DNA ladder (New England Biolabs) was also run on the gel. .. RNA was isolated by a miniprep procedure , separated on agarose gels containing formaldehyde, transferred to membrane (Hybond-XL, Amersham-Pharmacia Biotech, Piscataway, NJ) using a vacuum blotting pump (Amersham-Pharmacia Biotech), and UV cross-linked.

    Northern Blot:

    Article Title: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics
    Article Snippet: Paragraph title: Northern blots and transcript sequencing ... The 100 bp DNA size standard ladder was from New England Biolabs.

    Article Title: Induction of Mitochondrial Alternative Oxidase in Response to a Cell Signal Pathway Down-Regulating the Cytochrome Pathway Prevents Programmed Cell Death
    Article Snippet: A 100-bp DNA ladder (New England Biolabs) was also run on the gel. .. RNA was isolated by a miniprep procedure , separated on agarose gels containing formaldehyde, transferred to membrane (Hybond-XL, Amersham-Pharmacia Biotech, Piscataway, NJ) using a vacuum blotting pump (Amersham-Pharmacia Biotech), and UV cross-linked.

    Generated:

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The rulers were then generated from the deletion mutants by primer extension with Pfu Hotstart DNA polymerase (Agilent, Santa Clara, CA) using dye-labeled constant region primers (forward primer: 5′-biotin-GGTGA(Cy3)AATCATGCCGAACATCCCG and reverse primer: 5′-GATGGCGCGAATGT(Cy5)CATCAGA ACG). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Imaging:

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: PCR reactions were performed using the following primers: 583 site 5′ GTGAGTGTGAGCTGAAGCGGG 3′ (−662 to −641 relative to the transcription start site) and 5′ GTTTCCCCTGAAGCCCGCGTG 3′ (−524 to −503); 251/272 site 5′ GCGGGTGATGTCAGCTCTC 3′ (−3 1 5 t o −296) and 5′ GTGAGCGTGCGTGCGCGTGTG 3′ (−167 to −146). .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system. .. Band intensities were analyzed densitometrically using the ImageJ 1.41o program.

    Sequencing:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA). .. The relative amounts of H-RasG12V gene or mRNA were analyzed by real time PCR or real time RT-PCR, respectively, using the SYBR GreenER Q-PCR SuperMix for the iCycler® kit and protocol (Invitrogen, Carlsbad, CA, USA).

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The rulers were then generated from the deletion mutants by primer extension with Pfu Hotstart DNA polymerase (Agilent, Santa Clara, CA) using dye-labeled constant region primers (forward primer: 5′-biotin-GGTGA(Cy3)AATCATGCCGAACATCCCG and reverse primer: 5′-GATGGCGCGAATGT(Cy5)CATCAGA ACG). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA). .. The CGG repeat-containing ssDNAs were incubated with Cy3-labeled [5′-Cy3-CCGCCGCCGCCGCCG; (CCG)5 ] repeat probes and a Cy5-labeled probe (5′-Cy5-CATCTT CTCTTCAGCCCTGCTAGCGCCGGGAGC) complementary to a flanking region (Integrated DNA Technologies, Coralville, IA).

    Article Title: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics
    Article Snippet: Paragraph title: Northern blots and transcript sequencing ... The 100 bp DNA size standard ladder was from New England Biolabs.

    Sonication:

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system. .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Recombinant:

    Article Title: G-quadruplex structures in RNA stimulate mitochondrial transcription termination and primer formation
    Article Snippet: Recombinant POLRMT, TFAM, and TFB2M were expressed in insect cells and purified as described previously ( ). .. Transcripts were purified and run on 6% acrylamide/urea gels in 1× Tris/Borate/EDTA buffer (45 mM Tris-borate, 1 mM EDTA), in parallel with 100-bp DNA marker (NEB).

    Magnetic Cell Separation:

    Article Title: Intravenous Delivery of Oncolytic Reovirus to Brain Tumor Patients Immunologically Primes for Subsequent Checkpoint Blockade
    Article Snippet: PBMC subsets were isolated by MACS Microbead selection (Miltenyi Biotec) according to manufacturer’s instructions. .. Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs).

    DNA Sequencing:

    Article Title: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics
    Article Snippet: The 100 bp DNA size standard ladder was from New England Biolabs. .. To facilitate comparison of results, all northern blots were consistently exposed for 18–20 h on a Phosphorimager screen (Molecular Dynamics).

    DNA Extraction:

    Article Title: Implementing principles of traditional concentrated grape must fermentation to the production of new generation balsamic vinegars. Starter selection and effectiveness
    Article Snippet: DNA fragment sizes were determined by comparison with a molecular marker 100 bp ladder (New England Bio-Labs, Beverly, USA). .. Strain typing of S. cerevisiae isolates were performed by amplification of inter- region, using the primers pair δ2 (5′-GTGGATTTTTATTCCAAC-3′) (Ness et al. ) and δ12 (5′-TCAACAATGGAATCCCAAC-3′) (Legras and Karst ).

    Nucleic Acid Electrophoresis:

    Article Title: Low picomolar, instrument-free visual detection of mercury and silver ions using low-cost programmable nanoprobes
    Article Snippet: Ethidium bromide (EthBr), Laemmli loading dye, and certified genetic quality tested DNA grade agarose were purchased from Bio-Rad (Hercules, CA, USA). .. 100 bp DNA ladder was purchased from New England BioLabs, Inc. (Ipswich, MA, USA) for gel electrophoresis studies. .. Mercury(ii ) perchlorate trihydrate (Hg(ClO4 )2 ·3H2 O) was purchased from Alfa Aesar and silver nitrate (AgNO3 ) was purchased from Sigma Aldrich.

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The rulers were then generated from the deletion mutants by primer extension with Pfu Hotstart DNA polymerase (Agilent, Santa Clara, CA) using dye-labeled constant region primers (forward primer: 5′-biotin-GGTGA(Cy3)AATCATGCCGAACATCCCG and reverse primer: 5′-GATGGCGCGAATGT(Cy5)CATCAGA ACG). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA). .. The CGG repeat-containing ssDNAs were incubated with Cy3-labeled [5′-Cy3-CCGCCGCCGCCGCCG; (CCG)5 ] repeat probes and a Cy5-labeled probe (5′-Cy5-CATCTT CTCTTCAGCCCTGCTAGCGCCGGGAGC) complementary to a flanking region (Integrated DNA Technologies, Coralville, IA).

    Article Title: Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR
    Article Snippet: The PCR products were analyzed by gel electrophoresis on 15-cm-long 2% agarose gels in 0.5× TBE (Tris-borate-EDTA) buffer at 175 V for 75 min. .. The sizes of the PCR products and corresponding serotype were determined by comparison with a 100-bp molecular size standard (New England BioLabs).

    Fluorescence:

    Article Title: ELISA-like Analysis of Cisplatinated DNA Using Magnetic Separation
    Article Snippet: A 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) within the size range from 0.1 to 1.5 kb was used to monitor the size of the analysed fragment. .. A 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) within the size range from 0.1 to 1.5 kb was used to monitor the size of the analysed fragment.

    Mutagenesis:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: Genomic DNA (200ng) was hybridized with primers complementary to the human sequences that span the activating mutation site or to β-actin as follows: 5′-GTCGGTGTGGGCAAGAGT-3′ and 5′-ATCAATGACCACCTGCTTCC-3′ (H-RasG12V ), 5′-AGAGGGAAATCGTGCGTGAC-3′ and 5′-CAATAGTGATGACCT GGCCGT-3′ (mouse β-actin). .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: First, deletion mutants with varying lengths (23–500 bp) between two constant primer regions were constructed from a pMAL plasmid with a Quikchange site-directed mutagenesis kit (Agilent, Santa Clara, CA). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Isolation:

    Article Title: Intravenous Delivery of Oncolytic Reovirus to Brain Tumor Patients Immunologically Primes for Subsequent Checkpoint Blockade
    Article Snippet: PBMC subsets were isolated by MACS Microbead selection (Miltenyi Biotec) according to manufacturer’s instructions. .. Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs).

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: After isolation and washing of antibody containing complexes, DNA was extracted for PCR analysis. .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Article Title: Induction of Mitochondrial Alternative Oxidase in Response to a Cell Signal Pathway Down-Regulating the Cytochrome Pathway Prevents Programmed Cell Death
    Article Snippet: Paragraph title: DNA and RNA Isolation and Analysis ... A 100-bp DNA ladder (New England Biolabs) was also run on the gel.

    Marker:

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs). .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs).

    Article Title: Implementing principles of traditional concentrated grape must fermentation to the production of new generation balsamic vinegars. Starter selection and effectiveness
    Article Snippet: Restriction fragments were run onto a 2.0 % (w/v) agarose gel in a 0.5 TBE buffer, stained with ethidium bromide and visualized under UV light. .. DNA fragment sizes were determined by comparison with a molecular marker 100 bp ladder (New England Bio-Labs, Beverly, USA). .. Yeasts were identified at a species level by comparing the amplified product and their restriction fragment sizes with those described elsewhere (e.g. Esteve-Zarzoso et al. ).

    Article Title: G-quadruplex structures in RNA stimulate mitochondrial transcription termination and primer formation
    Article Snippet: Transcription reactions were carried out in the presence of [α-32 P]-UTP as in Falkenberg et al. , but with addition of NaCl, KCl, or LiCl where indicated in the figure legends. .. Transcripts were purified and run on 6% acrylamide/urea gels in 1× Tris/Borate/EDTA buffer (45 mM Tris-borate, 1 mM EDTA), in parallel with 100-bp DNA marker (NEB). .. Gels were visualized on X-ray film and radioactive signal was quantified using the FLA-7000 analyzer (Fujifilm).

    Labeling:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: The single-stranded PCR products were prepared by lambda exonuclease digestion to facilitate hybridization of the fluorescently labeled probes to the target sequence. .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Purification:

    Article Title: Implementing principles of traditional concentrated grape must fermentation to the production of new generation balsamic vinegars. Starter selection and effectiveness
    Article Snippet: PCR products were digested without further purification with restriction enzymes Hae III, Cfo I and Dde I (Promega, Milan, Italy). .. DNA fragment sizes were determined by comparison with a molecular marker 100 bp ladder (New England Bio-Labs, Beverly, USA).

    Article Title: G-quadruplex structures in RNA stimulate mitochondrial transcription termination and primer formation
    Article Snippet: Transcription reactions were carried out in the presence of [α-32 P]-UTP as in Falkenberg et al. , but with addition of NaCl, KCl, or LiCl where indicated in the figure legends. .. Transcripts were purified and run on 6% acrylamide/urea gels in 1× Tris/Borate/EDTA buffer (45 mM Tris-borate, 1 mM EDTA), in parallel with 100-bp DNA marker (NEB). .. Gels were visualized on X-ray film and radioactive signal was quantified using the FLA-7000 analyzer (Fujifilm).

    Article Title: Flow-dependent epigenetic DNA methylation regulates endothelial gene expression and atherosclerosis
    Article Snippet: Genomic DNA was collected and purified by the DNeasy Blood and Tissue kit (QIAGEN) from HUVECs treated with either 5 μM 5Aza or vehicle control for 5 days. .. The reaction products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide alongside a 100-bp ladder (N3231L; New England BioLabs) and imaged under UV light.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Intravenous Delivery of Oncolytic Reovirus to Brain Tumor Patients Immunologically Primes for Subsequent Checkpoint Blockade
    Article Snippet: Paragraph title: Peripheral reovirus carriage RT-PCR ... Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs).

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: Paragraph title: Confirmation of transformation by Western blot, PCR, RT-PCR and real-time PCR ... The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Article Title: A High-Throughput Screening Assay for the Functional Delivery of Splice-Switching Oligonucleotides in Human Melanoma Cells
    Article Snippet: Paragraph title: 2.3 RT-PCR Assay ... 100 bp DNA ladder (New England Biolabs).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Functional Heterogeneity of the UpaH Autotransporter Protein from Uropathogenic Escherichia coli
    Article Snippet: Experimentally tested curved motifs produce curvature values of 5 to 25°/helical turn, whereas straight motifs give values below 5°/helical turn. .. The upaH 250-bp promoter region was amplified using the primers upaH.pro.ext-5 + 250 (5′-TTGATTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250B (5′-TTGGTTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250C (5′-TGGTTTATACCGTTTTTTTCATTA-3′), and upaH.pro.ext-3-1ATG (5′-AATAAATCCTTCTGGCGAATATAA-3′) and its intrinsic curvature was assessed by comparing its electrophoretic mobility with that of a 100-bp DNA ladder (New England BioLabs) on a 0.5× TBE, 7.5% PAGE gel at 4°C. .. The prevalence of the upaH gene was analyzed in 61 complete and 247 draft E. coli genome sequences available in the NCBI database.

    Rapid Amplification of cDNA Ends:

    Article Title: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics
    Article Snippet: The 100 bp DNA size standard ladder was from New England Biolabs. .. To facilitate comparison of results, all northern blots were consistently exposed for 18–20 h on a Phosphorimager screen (Molecular Dynamics).

    Chromatin Immunoprecipitation:

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: Paragraph title: Chromatin immunoprecipitation assay ... Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system.

    Plasmid Preparation:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA). .. The relative amounts of H-RasG12V gene or mRNA were analyzed by real time PCR or real time RT-PCR, respectively, using the SYBR GreenER Q-PCR SuperMix for the iCycler® kit and protocol (Invitrogen, Carlsbad, CA, USA).

    Article Title: A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome
    Article Snippet: First, deletion mutants with varying lengths (23–500 bp) between two constant primer regions were constructed from a pMAL plasmid with a Quikchange site-directed mutagenesis kit (Agilent, Santa Clara, CA). .. The sequences of the mutants were confirmed by sequencing, and the DNA ruler lengths were confirmed by gel electrophoresis on 3% agarose gels with a 100-bp DNA ladder (New England Biolabs, Ipswich, MA).

    Article Title: Functional Heterogeneity of the UpaH Autotransporter Protein from Uropathogenic Escherichia coli
    Article Snippet: The upaH 250-bp promoter region was amplified using the primers upaH.pro.ext-5 + 250 (5′-TTGATTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250B (5′-TTGGTTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250C (5′-TGGTTTATACCGTTTTTTTCATTA-3′), and upaH.pro.ext-3-1ATG (5′-AATAAATCCTTCTGGCGAATATAA-3′) and its intrinsic curvature was assessed by comparing its electrophoretic mobility with that of a 100-bp DNA ladder (New England BioLabs) on a 0.5× TBE, 7.5% PAGE gel at 4°C. .. The upaH 250-bp promoter region was amplified using the primers upaH.pro.ext-5 + 250 (5′-TTGATTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250B (5′-TTGGTTTATACCGTTTTTTCATTA-3′), upaH.pro.ext-5 + 250C (5′-TGGTTTATACCGTTTTTTTCATTA-3′), and upaH.pro.ext-3-1ATG (5′-AATAAATCCTTCTGGCGAATATAA-3′) and its intrinsic curvature was assessed by comparing its electrophoretic mobility with that of a 100-bp DNA ladder (New England BioLabs) on a 0.5× TBE, 7.5% PAGE gel at 4°C.

    Software:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. In (B) products of TP-PCR were run on a 1% agarose gel at a constant 100 V. Reduced amounts of the expanded repeat allele are visible in (A) as a reduced tail running towards the right of the scan, and (B) as a reduction in the PCR product smear.

    Article Title: A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping
    Article Snippet: We separated 10 μl of PCR product by electrophoresis in a 2% agarose gel (Eurogentec, Belgium), which was also loaded with a 100 bp DNA size ladder (New England BioLabs). .. In each run, at least one lane was loaded with PCR product from one of the reference strains, NEM316, A909 or 2603 V/R.

    Article Title: ELISA-like Analysis of Cisplatinated DNA Using Magnetic Separation
    Article Snippet: A 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) within the size range from 0.1 to 1.5 kb was used to monitor the size of the analysed fragment. .. A 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) within the size range from 0.1 to 1.5 kb was used to monitor the size of the analysed fragment.

    Article Title: A real-time PCR assay for quantification of parasite burden in murine models of leishmaniasis
    Article Snippet: Primers were designed using Primer-BLAST software ( ). .. Amplicon size was verified by separating the PCR product in a 1% agarose gel, visualizing the product by ethidium bromide staining, and comparing to 100 bp DNA staining ladder (N3231S; New England Biolabs, Ipswich, MA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: Paragraph title: Confirmation of transformation by Western blot, PCR, RT-PCR and real-time PCR ... The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Multiplex Assay:

    Article Title: Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR
    Article Snippet: Paragraph title: Multiplex PCR. ... The sizes of the PCR products and corresponding serotype were determined by comparison with a 100-bp molecular size standard (New England BioLabs).

    Selection:

    Article Title: Intravenous Delivery of Oncolytic Reovirus to Brain Tumor Patients Immunologically Primes for Subsequent Checkpoint Blockade
    Article Snippet: PBMC subsets were isolated by MACS Microbead selection (Miltenyi Biotec) according to manufacturer’s instructions. .. Samples were run on 2 % agarose gels alongside a 100 bp DNA ladder (New England Biolabs).

    Agarose Gel Electrophoresis:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively. .. Products of TP-PCR with a fluorescently labeled primer were analyzed by capillary electrophoresis, with scans shown in (A) where the green line plots the TP-PCR products.

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: All PCR products were separated by agarose-gel electrophoresis, stained with SYBR® Safe DNA gel stain (Invitrogen) and visualized using a UV transluminator. .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs).

    Article Title: A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping
    Article Snippet: Amplification was performed in a 2720 Thermal Cycler (Applied Biosystems) under the following conditions: initial denaturation for 5 min at 94°C, followed by 30 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 50°C and elongation for 60 s at 72°C plus a final elongation step for 7 min at 72°C. .. We separated 10 μl of PCR product by electrophoresis in a 2% agarose gel (Eurogentec, Belgium), which was also loaded with a 100 bp DNA size ladder (New England BioLabs). .. Electrophoresis was performed in 20 cm-long gels, in 1× TBE buffer (89 mM Tris-Borate, 2.5 mM EDTA) containing 1 μg/ml ethidium bromide run at 10 V/cm.

    Article Title: ELISA-like Analysis of Cisplatinated DNA Using Magnetic Separation
    Article Snippet: Paragraph title: 2.8 Agarose gel electrophoresis ... A 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) within the size range from 0.1 to 1.5 kb was used to monitor the size of the analysed fragment.

    Article Title: STRetch: detecting and discovering pathogenic short tandem repeat expansions
    Article Snippet: Samples were analyzed on a 2% agarose gel stained with ethidium bromide (0.5 μg/mL). .. Product sizes and STR length were estimated relative to a 100-bp DNA ladder by generating a standard curve (NEB, USA).

    Article Title: Implementing principles of traditional concentrated grape must fermentation to the production of new generation balsamic vinegars. Starter selection and effectiveness
    Article Snippet: Restriction fragments were run onto a 2.0 % (w/v) agarose gel in a 0.5 TBE buffer, stained with ethidium bromide and visualized under UV light. .. DNA fragment sizes were determined by comparison with a molecular marker 100 bp ladder (New England Bio-Labs, Beverly, USA).

    Article Title: Nuclear Factor-?B Contributes to Neuron-Dependent Induction of GLT-1 Expression in Astrocytes
    Article Snippet: PCR reactions were performed using the following primers: 583 site 5′ GTGAGTGTGAGCTGAAGCGGG 3′ (−662 to −641 relative to the transcription start site) and 5′ GTTTCCCCTGAAGCCCGCGTG 3′ (−524 to −503); 251/272 site 5′ GCGGGTGATGTCAGCTCTC 3′ (−3 1 5 t o −296) and 5′ GTGAGCGTGCGTGCGCGTGTG 3′ (−167 to −146). .. Products were resolved on 1% agarose gel with 100 bp DNA ladder (New England Biolabs) and visualized under UV light using a ChemiImager 4400 imaging system. .. Band intensities were analyzed densitometrically using the ImageJ 1.41o program.

    Article Title: Flow-dependent epigenetic DNA methylation regulates endothelial gene expression and atherosclerosis
    Article Snippet: Either MspI or HpaII (ER0541; ThermoSci) was reacted with the gDNA according to the recommended protocol for the restriction enzymes. .. The reaction products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide alongside a 100-bp ladder (N3231L; New England BioLabs) and imaged under UV light. .. HUVECs were pretreated with either 5Aza or siRNA and were subjected to either LS or OS for 24 hours.

    Article Title: Induction of Mitochondrial Alternative Oxidase in Response to a Cell Signal Pathway Down-Regulating the Cytochrome Pathway Prevents Programmed Cell Death
    Article Snippet: Then, 4 μg of DNA was separated on a 2% (w/v) agarose gel containing ethidium bromide, visualized on a UV transilluminator, and photographed. .. A 100-bp DNA ladder (New England Biolabs) was also run on the gel.

    Article Title: A real-time PCR assay for quantification of parasite burden in murine models of leishmaniasis
    Article Snippet: After amplification by conventional PCR, three of these primer pairs resulted in non-specific amplification as detected by ethidium bromide detection in a 1% agarose gel. .. Amplicon size was verified by separating the PCR product in a 1% agarose gel, visualizing the product by ethidium bromide staining, and comparing to 100 bp DNA staining ladder (N3231S; New England Biolabs, Ipswich, MA, USA). .. Based on this initial screen, the primers reported in were then used to amplify wildtype L. major (MHOM/SN/74/Seidman) promastigote DNA as described below.

    In Vitro:

    Article Title: G-quadruplex structures in RNA stimulate mitochondrial transcription termination and primer formation
    Article Snippet: Paragraph title: In Vitro Transcription. ... Transcripts were purified and run on 6% acrylamide/urea gels in 1× Tris/Borate/EDTA buffer (45 mM Tris-borate, 1 mM EDTA), in parallel with 100-bp DNA marker (NEB).

    Article Title: Flow-dependent epigenetic DNA methylation regulates endothelial gene expression and atherosclerosis
    Article Snippet: Paragraph title: Restriction enzyme (MspI/HpaII) assay to determine global DNA methylation status in vitro. ... The reaction products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide alongside a 100-bp ladder (N3231L; New England BioLabs) and imaged under UV light.

    Knock-Out:

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA). .. Amplification was monitored using the BIO-RAD iCycler detection system.

    DNA Methylation Assay:

    Article Title: Flow-dependent epigenetic DNA methylation regulates endothelial gene expression and atherosclerosis
    Article Snippet: Paragraph title: Restriction enzyme (MspI/HpaII) assay to determine global DNA methylation status in vitro. ... The reaction products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide alongside a 100-bp ladder (N3231L; New England BioLabs) and imaged under UV light.

    Concentration Assay:

    Article Title: Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR
    Article Snippet: The sizes of the PCR products and corresponding serotype were determined by comparison with a 100-bp molecular size standard (New England BioLabs). .. The sizes of the PCR products and corresponding serotype were determined by comparison with a 100-bp molecular size standard (New England BioLabs).

    Molecular Weight:

    Article Title: Structural diversity of supercoiled DNA
    Article Snippet: Acrylamide, ampicillin, chloroform, isopropyl beta-D-thiogalactoside, sodium chloride and sodium citrate were purchased from Fisher Scientific (Pittsburgh, PA). .. BbvCI, EcoRV, Nb.BbvCI, NdeI, Nuclease Bal-31, T4 DNA Ligase, low molecular weight DNA ladder and 100 bp DNA ladder were purchased from New England Biolabs (Ipswich, MA). .. Proteinase K was purchased from Roche Molecular Biochemicals (Mannheim, Germany).

    CTG Assay:

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues
    Article Snippet: MBN is specific for single-stranded DNA including hairpin tips and loops of slip-outs, while T7endoI cleaves at the arms of three-way DNA junctions, common to slipped-DNA formed from CTG/CAG repeats , . .. 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Staining:

    Article Title: Changes in expression and activity of the secretory pathway Ca2+ ATPase 1 (SPCA1) in A7r5 vascular smooth muscle cells cultured at different glucose concentrations
    Article Snippet: All PCR products were separated by agarose-gel electrophoresis, stained with SYBR® Safe DNA gel stain (Invitrogen) and visualized using a UV transluminator. .. PCR product band sizes were checked using a 100 bp DNA ladder (New England Biolabs).

    Article Title: Ganglioside synthase knockout in oncogene-transformed fibroblasts depletes gangliosides and impairs tumor growth
    Article Snippet: The products were detected by ethidium bromide staining following electrophoresis in 1.6% agarose gels. .. The sizes of the amplified PCR products were compared to the predicted fragments based upon the plasmid sequence using DNA (100 bp ladder) markers (New England Biolabs, Ipswich, MA, USA).

    Article Title: STRetch: detecting and discovering pathogenic short tandem repeat expansions
    Article Snippet: Samples were analyzed on a 2% agarose gel stained with ethidium bromide (0.5 μg/mL). .. Product sizes and STR length were estimated relative to a 100-bp DNA ladder by generating a standard curve (NEB, USA).

    Article Title: Implementing principles of traditional concentrated grape must fermentation to the production of new generation balsamic vinegars. Starter selection and effectiveness
    Article Snippet: Restriction fragments were run onto a 2.0 % (w/v) agarose gel in a 0.5 TBE buffer, stained with ethidium bromide and visualized under UV light. .. DNA fragment sizes were determined by comparison with a molecular marker 100 bp ladder (New England Bio-Labs, Beverly, USA).

    Article Title: Flow-dependent epigenetic DNA methylation regulates endothelial gene expression and atherosclerosis
    Article Snippet: Either MspI or HpaII (ER0541; ThermoSci) was reacted with the gDNA according to the recommended protocol for the restriction enzymes. .. The reaction products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide alongside a 100-bp ladder (N3231L; New England BioLabs) and imaged under UV light. .. HUVECs were pretreated with either 5Aza or siRNA and were subjected to either LS or OS for 24 hours.

    Article Title: A real-time PCR assay for quantification of parasite burden in murine models of leishmaniasis
    Article Snippet: After amplification by conventional PCR, three of these primer pairs resulted in non-specific amplification as detected by ethidium bromide detection in a 1% agarose gel. .. Amplicon size was verified by separating the PCR product in a 1% agarose gel, visualizing the product by ethidium bromide staining, and comparing to 100 bp DNA staining ladder (N3231S; New England Biolabs, Ipswich, MA, USA). .. Based on this initial screen, the primers reported in were then used to amplify wildtype L. major (MHOM/SN/74/Seidman) promastigote DNA as described below.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs high fidelity dna polymerase
    Specific and non-specific binding of <t>DNA</t> by <t>ParB:</t> a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).
    High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    84
    New England Biolabs linear dna fragment
    <t>DdrC</t> stimulates <t>DNA</t> annealing. Kinetics of two complementary 67-mer oligonucleotides annealing in the absence (w/o protein) or the presence of DdrC, T4 gp32 or SSB using a DAPI fluorescence-based method. The 67-mer oligonucleotide (200 nM) was mixed in 1 ml of reaction buffer with 0.2 μM DdrC protein, or 0.1 μM T4 gp32, or 0.1 μM SSB from E . coli prior to addition of the reverse oligonucleotide. The extent of DNA annealing is defined as follows: (observed fluorescence—67-mer ssDNA fluorescence) x 100 / 67-mer ds DNA fluorescence.
    Linear Dna Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/linear dna fragment/product/New England Biolabs
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    linear dna fragment - by Bioz Stars, 2019-10
    84/100 stars
      Buy from Supplier

    76
    New England Biolabs φx174 supercoiled dna substrate
    RAD52 promotes coaggregation of <t>RAD52-RAD51-DNA</t> complexes: centrifugation assay followed by protein analyses . Relaxed <t>φX174</t> DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of RAD52 (0 μM, 0.5 μM, 1.0 μM 2.0 μM) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, AMP-PNP, ATPγS, or AMP (1 mM each) (Panels E-I) or no nucleotide (Panel J), followed by centrifugation assay (Methods) and analyses of proteins by SDS-PAGE (Methods). Lanes s1–s4 and p1–p4 in all the Panels represent supernatant and pellet fractions for increasing concentrations of RAD52 respectively. Lanes 1 2 of Panel A show input RAD52 and RAD51 respectively used in centrifugation assay. No DNA controls: lanes s1 and p1 of Panel C correspond to supernatant and pellet fractions for RAD51 (3 μM) and RAD52 (2 μM) together, while the same for Panels B and D correspond to RAD52 protein alone and RAD51 protein alone, respectively. Intensity of protein bands was quantified using Image J software. Percentage of RAD51 protein in pellet was expressed as a ratio of the total intensity associated with pellet and supernatant protein bands and plotted as a function of RAD52 protein concentration (Panel K) (percentage of protein in supernatant fraction will therefore be 100% minus pellet fraction). The quantitative data has been given for RAD52 corresponding to only ATP set.
    φx174 Supercoiled Dna Substrate, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/φx174 supercoiled dna substrate/product/New England Biolabs
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    φx174 supercoiled dna substrate - by Bioz Stars, 2019-10
    76/100 stars
      Buy from Supplier

    75
    New England Biolabs frequent dna cleavage properties
    Cleavage of λ <t>DNA</t> (48,502 bp) under TaqII specificity changing conditions. ( A ) Complete TaqII cleavage pattern λ DNA under affinity star maximizing conditions (Methods). Samples of 1 μg λ DNA (=0.32 pmol recognition sites), digested under various conditions, were electrophoresed on 1% agarose/TBE gel. The <t>TaqII/SIN/DMSO</t> cleavage products were subsequently shotgun cloned to determine affinity star specificity (Methods). Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); Lane K, undigested λ DNA; lanes 1–4, λ DNA digested with TaqII: lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, with 20% DMSO, no SIN; lane 4, with SIN and 20% DMSO. ( B ) Insert size distribution of 160 clones randomly selected from TaqII SIN/DMSO-generated λ DNA library in pUC19 vector (see Methods, Figures 2 , 3 and 6 ). The average insert size of the library was estimated to be 160 bp.
    Frequent Dna Cleavage Properties, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/frequent dna cleavage properties/product/New England Biolabs
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    frequent dna cleavage properties - by Bioz Stars, 2019-10
    75/100 stars
      Buy from Supplier

    Image Search Results


    Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay

    Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Titration

    Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Molecular Weight, Sequencing

    Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Incubation

    The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Size-exclusion Chromatography, Mass Spectrometry, Sequencing

    The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Fluorescence, Titration

    ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Flow Cytometry, Concentration Assay, Protein Concentration, Standard Deviation

    ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection

    ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques:

    DdrC stimulates DNA annealing. Kinetics of two complementary 67-mer oligonucleotides annealing in the absence (w/o protein) or the presence of DdrC, T4 gp32 or SSB using a DAPI fluorescence-based method. The 67-mer oligonucleotide (200 nM) was mixed in 1 ml of reaction buffer with 0.2 μM DdrC protein, or 0.1 μM T4 gp32, or 0.1 μM SSB from E . coli prior to addition of the reverse oligonucleotide. The extent of DNA annealing is defined as follows: (observed fluorescence—67-mer ssDNA fluorescence) x 100 / 67-mer ds DNA fluorescence.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: DdrC stimulates DNA annealing. Kinetics of two complementary 67-mer oligonucleotides annealing in the absence (w/o protein) or the presence of DdrC, T4 gp32 or SSB using a DAPI fluorescence-based method. The 67-mer oligonucleotide (200 nM) was mixed in 1 ml of reaction buffer with 0.2 μM DdrC protein, or 0.1 μM T4 gp32, or 0.1 μM SSB from E . coli prior to addition of the reverse oligonucleotide. The extent of DNA annealing is defined as follows: (observed fluorescence—67-mer ssDNA fluorescence) x 100 / 67-mer ds DNA fluorescence.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Fluorescence

    DdrC binds to ssDNA and dsDNA with a preference for ssDNA. A Binding of recombinant DdrC to plasmid or viral DNA analyzed by EMSA. 200 ng of supercoiled or linear pBR322 DNA as well as 200 ng of RFI or single-stranded DNA of phiX174 virion (31 μM nucleotides of each DNA) were incubated with increasing concentrations of DdrC as indicated in the figure. DNA-protein complexes were separated in 1.2% agarose gels. Products loaded in the right lane of the left panel were treated with SDS and proteinase K. sc: supercoiled dsDNA, oc: open circle dsDNA, Li: linear dsDNA. B Binding of DdrC to oligonucleotides. Increasing concentrations of DdrC were incubated with 3.3 nM of a single-stranded (ss) 67-mer fluorescent oligonucleotide (left panel) or 3.3 nM of the corresponding ds oligonucleotide (right panel). The products of the reactions were separated in 6% native polyacrylamide gels. Lanes C: DNA control without DdrC.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: DdrC binds to ssDNA and dsDNA with a preference for ssDNA. A Binding of recombinant DdrC to plasmid or viral DNA analyzed by EMSA. 200 ng of supercoiled or linear pBR322 DNA as well as 200 ng of RFI or single-stranded DNA of phiX174 virion (31 μM nucleotides of each DNA) were incubated with increasing concentrations of DdrC as indicated in the figure. DNA-protein complexes were separated in 1.2% agarose gels. Products loaded in the right lane of the left panel were treated with SDS and proteinase K. sc: supercoiled dsDNA, oc: open circle dsDNA, Li: linear dsDNA. B Binding of DdrC to oligonucleotides. Increasing concentrations of DdrC were incubated with 3.3 nM of a single-stranded (ss) 67-mer fluorescent oligonucleotide (left panel) or 3.3 nM of the corresponding ds oligonucleotide (right panel). The products of the reactions were separated in 6% native polyacrylamide gels. Lanes C: DNA control without DdrC.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Binding Assay, Recombinant, Plasmid Preparation, Incubation

    Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Electron Microscopy, Plasmid Preparation

    Visualization of DdrC-DNA complexes by transmission electron microscopy. A PhiX174 ssDNA (1.4 nM, 7.5 μM nucleotides) was incubated with 1 μM (panels b-d) or 2 μM (panels f-h) of DdrC. Panel a: phiX174 ssDNA control without DdrC. Panel e: Interaction of E . coli SSB protein (1 μM) with ssDNA. Magnification = 85,000. B Supercoiled pBR322 DNA (1.7 nM, 7.5 μM base pairs) incubated with 1 μM (panel b and c) or 2 μM (panel d) of DdrC. Panel a: pBR322 DNA control without protein. Magnification = 85,000. Some“bridge” structures, forming loops or kinks, are indicated by arrows.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: Visualization of DdrC-DNA complexes by transmission electron microscopy. A PhiX174 ssDNA (1.4 nM, 7.5 μM nucleotides) was incubated with 1 μM (panels b-d) or 2 μM (panels f-h) of DdrC. Panel a: phiX174 ssDNA control without DdrC. Panel e: Interaction of E . coli SSB protein (1 μM) with ssDNA. Magnification = 85,000. B Supercoiled pBR322 DNA (1.7 nM, 7.5 μM base pairs) incubated with 1 μM (panel b and c) or 2 μM (panel d) of DdrC. Panel a: pBR322 DNA control without protein. Magnification = 85,000. Some“bridge” structures, forming loops or kinks, are indicated by arrows.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Transmission Assay, Electron Microscopy, Incubation

    DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from DNase I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from DNase I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Plasmid Preparation, Activity Assay, Incubation

    Cellular localization of DdrC-GFP after γ-irradiation of D . radiodurans cells. Bacteria expressing a DdrC-GFP fusion protein (GY15931) recovering from γ-irradiation (5 kGy) were visualized by fluorescence microscopy at the indicated times of post-irradiation incubation. DNA was stained with DAPI. Overlays of GFP (green) and DAPI (blue) images as well as overlays of Nomarski DIC (grey), GFP and DAPI are shown.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: Cellular localization of DdrC-GFP after γ-irradiation of D . radiodurans cells. Bacteria expressing a DdrC-GFP fusion protein (GY15931) recovering from γ-irradiation (5 kGy) were visualized by fluorescence microscopy at the indicated times of post-irradiation incubation. DNA was stained with DAPI. Overlays of GFP (green) and DAPI (blue) images as well as overlays of Nomarski DIC (grey), GFP and DAPI are shown.

    Article Snippet: To analyze interaction of DdrC with linear DNA fragment, pUC19 plasmid (New England Biolabs) was linearized with SspI (New England Biolabs) restriction enzyme producing blunt ends and pBR322 plasmid was linearized with PstI (New England Biolabs) producing 3’ overhang cohesive ends.

    Techniques: Irradiation, Expressing, Fluorescence, Microscopy, Incubation, Staining

    RAD52 promotes coaggregation of RAD52-RAD51-DNA complexes: centrifugation assay followed by protein analyses . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of RAD52 (0 μM, 0.5 μM, 1.0 μM 2.0 μM) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, AMP-PNP, ATPγS, or AMP (1 mM each) (Panels E-I) or no nucleotide (Panel J), followed by centrifugation assay (Methods) and analyses of proteins by SDS-PAGE (Methods). Lanes s1–s4 and p1–p4 in all the Panels represent supernatant and pellet fractions for increasing concentrations of RAD52 respectively. Lanes 1 2 of Panel A show input RAD52 and RAD51 respectively used in centrifugation assay. No DNA controls: lanes s1 and p1 of Panel C correspond to supernatant and pellet fractions for RAD51 (3 μM) and RAD52 (2 μM) together, while the same for Panels B and D correspond to RAD52 protein alone and RAD51 protein alone, respectively. Intensity of protein bands was quantified using Image J software. Percentage of RAD51 protein in pellet was expressed as a ratio of the total intensity associated with pellet and supernatant protein bands and plotted as a function of RAD52 protein concentration (Panel K) (percentage of protein in supernatant fraction will therefore be 100% minus pellet fraction). The quantitative data has been given for RAD52 corresponding to only ATP set.

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: RAD52 promotes coaggregation of RAD52-RAD51-DNA complexes: centrifugation assay followed by protein analyses . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of RAD52 (0 μM, 0.5 μM, 1.0 μM 2.0 μM) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, AMP-PNP, ATPγS, or AMP (1 mM each) (Panels E-I) or no nucleotide (Panel J), followed by centrifugation assay (Methods) and analyses of proteins by SDS-PAGE (Methods). Lanes s1–s4 and p1–p4 in all the Panels represent supernatant and pellet fractions for increasing concentrations of RAD52 respectively. Lanes 1 2 of Panel A show input RAD52 and RAD51 respectively used in centrifugation assay. No DNA controls: lanes s1 and p1 of Panel C correspond to supernatant and pellet fractions for RAD51 (3 μM) and RAD52 (2 μM) together, while the same for Panels B and D correspond to RAD52 protein alone and RAD51 protein alone, respectively. Intensity of protein bands was quantified using Image J software. Percentage of RAD51 protein in pellet was expressed as a ratio of the total intensity associated with pellet and supernatant protein bands and plotted as a function of RAD52 protein concentration (Panel K) (percentage of protein in supernatant fraction will therefore be 100% minus pellet fraction). The quantitative data has been given for RAD52 corresponding to only ATP set.

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Centrifugation, Incubation, Concentration Assay, Binding Assay, SDS Page, Software, Protein Concentration

    KCl induced changes in dsDNA unwinding by RAD51 . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 [3.0 μM] in presence of increasing concentration of KCl [0 mM, 10 mM, 25 mM, 50 mM, 100 mM, 120 mM, 140 mM, 160 mM, 180 mM 200 mM] with ATP either in presence of RAD52 [2.0 μM] (Panel B: lanes 1–10) or in its absence (Panel A: lanes 2–11). Lane 1 in Panel A represents no protein control. Unwound DNA band intensity was expressed as percentage of total DNA band intensities per lane and plotted as a function of KCl concentration (Panel C).

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: KCl induced changes in dsDNA unwinding by RAD51 . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 [3.0 μM] in presence of increasing concentration of KCl [0 mM, 10 mM, 25 mM, 50 mM, 100 mM, 120 mM, 140 mM, 160 mM, 180 mM 200 mM] with ATP either in presence of RAD52 [2.0 μM] (Panel B: lanes 1–10) or in its absence (Panel A: lanes 2–11). Lane 1 in Panel A represents no protein control. Unwound DNA band intensity was expressed as percentage of total DNA band intensities per lane and plotted as a function of KCl concentration (Panel C).

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Incubation, Concentration Assay

    KCl induced changes in the aggregation of RAD51-dsDNA complexes: protein and DNA analyses . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of KCl [0 mM, 25 mM, 50 mM, 100 mM, 140 mM, 200 mM] with 1 mM ATP either in presence of RAD52 [2.0 μM] (Panel B: Protein analysis, Panel D:DNA analysis) or in its absence (Panel A: Protein analysis, Panel C:DNA analysis) in binding buffer R at 37°C for 12 minutes followed by centrifugation assay (Methods) and analyses of proteins by SDS-PAGE (Methods). Lanes s1–s6 and p1–p6 in all the Panels represent supernatant and pellet fractions for increasing concentrations of KCl respectively. RAD51 bands in pellet fraction is expressed as a fraction of the protein band intensities associated with the sum of supernatant and pellet fractions and plotted as a function of KCl concentration [(Open square: Panel E) in presence of RAD52] [(Open diamond: Panel E) in absence of RAD52)]. Similarly RAD52 protein is also represented in Panel E (open triangle). For DNA analysis, samples were deproteinized (Methods). Percentage of DNA (relaxed and unwound forms) in pellet fraction was expressed as a ratio of the total DNA (relaxed and unwound forms) in both pellet and supernatant fractions and plotted as a function of KCl concentration [(Filled square: Panel E) presence of RAD52 (Filled diamond: Panel E) absence of RAD52].

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: KCl induced changes in the aggregation of RAD51-dsDNA complexes: protein and DNA analyses . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of KCl [0 mM, 25 mM, 50 mM, 100 mM, 140 mM, 200 mM] with 1 mM ATP either in presence of RAD52 [2.0 μM] (Panel B: Protein analysis, Panel D:DNA analysis) or in its absence (Panel A: Protein analysis, Panel C:DNA analysis) in binding buffer R at 37°C for 12 minutes followed by centrifugation assay (Methods) and analyses of proteins by SDS-PAGE (Methods). Lanes s1–s6 and p1–p6 in all the Panels represent supernatant and pellet fractions for increasing concentrations of KCl respectively. RAD51 bands in pellet fraction is expressed as a fraction of the protein band intensities associated with the sum of supernatant and pellet fractions and plotted as a function of KCl concentration [(Open square: Panel E) in presence of RAD52] [(Open diamond: Panel E) in absence of RAD52)]. Similarly RAD52 protein is also represented in Panel E (open triangle). For DNA analysis, samples were deproteinized (Methods). Percentage of DNA (relaxed and unwound forms) in pellet fraction was expressed as a ratio of the total DNA (relaxed and unwound forms) in both pellet and supernatant fractions and plotted as a function of KCl concentration [(Filled square: Panel E) presence of RAD52 (Filled diamond: Panel E) absence of RAD52].

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Incubation, Concentration Assay, Binding Assay, Centrifugation, SDS Page

    Effect of KCl on RAD51 binding to dsDNA: gel shift assay . Supercoiled φX174 DNA (30 μM) was incubated with RAD51 (3 μM) with ATP (1 mM) in binding buffer R at 37°C for 12 minutes in presence of increasing concentrations of KCl [0 mM, 25 mM, 50 mM, 100 mM, 140 mM 200 mM] (lanes 2–7), followed by gel-shift analyses (Methods). Lane 1 represents no protein control.

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: Effect of KCl on RAD51 binding to dsDNA: gel shift assay . Supercoiled φX174 DNA (30 μM) was incubated with RAD51 (3 μM) with ATP (1 mM) in binding buffer R at 37°C for 12 minutes in presence of increasing concentrations of KCl [0 mM, 25 mM, 50 mM, 100 mM, 140 mM 200 mM] (lanes 2–7), followed by gel-shift analyses (Methods). Lane 1 represents no protein control.

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation

    RAD52 stimulates RAD51 mediated dsDNA unwinding . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of RAD52 (0 μM, 0.5 μM, 1.0 μM 2.0 μM) (lanes 1–4 in each Panel) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, AMP-PNP, ATPγS, or AMP (1 mM each) (Panels A-E) or no nucleotide (Panel F), followed by deproteinization and agarose gel assay (Methods). Lane 5 in all the Panels has all the components except RAD51. Panel G represents only RAD52 control in presence of ATP. Panel H represents no protein control. Percentage unwound DNA (normalized and quantified) was expressed as a ratio of the intensity associated with unwound DNA band to the sum of intensities corresponding to unwound as well as relaxed dsDNA bands. This was plotted as a function of RAD52 concentration (Panel I). Data points were statistically analyzed as explained earlier.

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: RAD52 stimulates RAD51 mediated dsDNA unwinding . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of increasing concentration of RAD52 (0 μM, 0.5 μM, 1.0 μM 2.0 μM) (lanes 1–4 in each Panel) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, AMP-PNP, ATPγS, or AMP (1 mM each) (Panels A-E) or no nucleotide (Panel F), followed by deproteinization and agarose gel assay (Methods). Lane 5 in all the Panels has all the components except RAD51. Panel G represents only RAD52 control in presence of ATP. Panel H represents no protein control. Percentage unwound DNA (normalized and quantified) was expressed as a ratio of the intensity associated with unwound DNA band to the sum of intensities corresponding to unwound as well as relaxed dsDNA bands. This was plotted as a function of RAD52 concentration (Panel I). Data points were statistically analyzed as explained earlier.

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Incubation, Concentration Assay, Binding Assay, Agarose Gel Electrophoresis

    RAD52 stimulates RAD51 mediated dsDNA unwinding even in presence of ADP: Time-course analysis . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of RAD52 (2.0 μM) in binding buffer R at 37°C with either 1 mM ATP (Panel A) or ADP (Panel B). Reactions were terminated after indicated time points by SDS/Proteinase K treatment and analyzed on agarose gels. Lane 6 in both Panels represents only RAD52 control while lane 7 represents only RAD51 control. Percentage intensity of unwound DNA to total DNA per lane (as explained earlier) was plotted as a function of time (Panel C).

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: RAD52 stimulates RAD51 mediated dsDNA unwinding even in presence of ADP: Time-course analysis . Relaxed φX174 DNA (30 μM) along with Topo I was incubated with RAD51 (3.0 μM) in presence of RAD52 (2.0 μM) in binding buffer R at 37°C with either 1 mM ATP (Panel A) or ADP (Panel B). Reactions were terminated after indicated time points by SDS/Proteinase K treatment and analyzed on agarose gels. Lane 6 in both Panels represents only RAD52 control while lane 7 represents only RAD51 control. Percentage intensity of unwound DNA to total DNA per lane (as explained earlier) was plotted as a function of time (Panel C).

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Incubation, Binding Assay

    RAD52 promotes formation of large complexes of RAD52-RAD51-DNA: gel shift assay . Supercoiled φX174 DNA (30 μM) was incubated with increasing concentrations of RAD51 (3 μM, 6 μM 9 μM) either in presence or absence of RAD52 (2 μM) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, ATPγS, AMP-PNP, or AMP (1 mM each) or no nucleotide, followed by agarose gel assay (Methods). Controls (Lane 1 in Panel A: no proteins; Panel D: no RAD51). Lane 5 in Panel A was excised (from the region shown in thatched box) and subjected to analyses on 12% SDS-PAGE gel followed by Coomassie staining (lane 1, Panel E). Purified RAD51 (lane 2, Panel E) and RAD52 proteins (lanes 3, Panel E).

    Journal: BMC Biochemistry

    Article Title: Human Rad51 mediated DNA unwinding is facilitated by conditions that favour Rad51-dsDNA aggregation

    doi: 10.1186/1471-2091-10-2

    Figure Lengend Snippet: RAD52 promotes formation of large complexes of RAD52-RAD51-DNA: gel shift assay . Supercoiled φX174 DNA (30 μM) was incubated with increasing concentrations of RAD51 (3 μM, 6 μM 9 μM) either in presence or absence of RAD52 (2 μM) in binding buffer R at 37°C for 12 minutes, in presence of either ATP, ADP, ATPγS, AMP-PNP, or AMP (1 mM each) or no nucleotide, followed by agarose gel assay (Methods). Controls (Lane 1 in Panel A: no proteins; Panel D: no RAD51). Lane 5 in Panel A was excised (from the region shown in thatched box) and subjected to analyses on 12% SDS-PAGE gel followed by Coomassie staining (lane 1, Panel E). Purified RAD51 (lane 2, Panel E) and RAD52 proteins (lanes 3, Panel E).

    Article Snippet: φX174 supercoiled DNA substrate was obtained from New England Biolabs.

    Techniques: Electrophoretic Mobility Shift Assay, Incubation, Binding Assay, Agarose Gel Electrophoresis, SDS Page, Staining, Purification

    Cleavage of λ DNA (48,502 bp) under TaqII specificity changing conditions. ( A ) Complete TaqII cleavage pattern λ DNA under affinity star maximizing conditions (Methods). Samples of 1 μg λ DNA (=0.32 pmol recognition sites), digested under various conditions, were electrophoresed on 1% agarose/TBE gel. The TaqII/SIN/DMSO cleavage products were subsequently shotgun cloned to determine affinity star specificity (Methods). Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); Lane K, undigested λ DNA; lanes 1–4, λ DNA digested with TaqII: lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, with 20% DMSO, no SIN; lane 4, with SIN and 20% DMSO. ( B ) Insert size distribution of 160 clones randomly selected from TaqII SIN/DMSO-generated λ DNA library in pUC19 vector (see Methods, Figures 2 , 3 and 6 ). The average insert size of the library was estimated to be 160 bp.

    Journal: BMC Genomics

    Article Title: A new genomic tool, ultra-frequently cleaving TaqII/sinefungin endonuclease with a combined 2.9-bp recognition site, applied to the construction of horse DNA libraries

    doi: 10.1186/1471-2164-14-370

    Figure Lengend Snippet: Cleavage of λ DNA (48,502 bp) under TaqII specificity changing conditions. ( A ) Complete TaqII cleavage pattern λ DNA under affinity star maximizing conditions (Methods). Samples of 1 μg λ DNA (=0.32 pmol recognition sites), digested under various conditions, were electrophoresed on 1% agarose/TBE gel. The TaqII/SIN/DMSO cleavage products were subsequently shotgun cloned to determine affinity star specificity (Methods). Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); Lane K, undigested λ DNA; lanes 1–4, λ DNA digested with TaqII: lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, with 20% DMSO, no SIN; lane 4, with SIN and 20% DMSO. ( B ) Insert size distribution of 160 clones randomly selected from TaqII SIN/DMSO-generated λ DNA library in pUC19 vector (see Methods, Figures 2 , 3 and 6 ). The average insert size of the library was estimated to be 160 bp.

    Article Snippet: The new TaqII/SIN/DMSO “molecular scissors” presented in this paper are potentially very useful for generating quasi-random genomic libraries, as there are only five other high-specificity enzyme that possess similarly frequent DNA cleavage properties: CviJI/CviJI*, FaiI, SetI, TspGWI/SIN and NEBNext dsDNA Fragmentase.

    Techniques: Clone Assay, Generated, Plasmid Preparation

    Digestion of highest complexity genomic DNA ( Equus caballus ) with TaqII/SIN/DMSO for BAC library construction. TaqII affinity star cleaved 1 μg horse liver DNA was electrophoresed on 1.5% agarose/TBE gel. Cleavage was carried out as described in Methods. ( A ) Partial digestion controlled by serial enzyme dilutions. Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); Lane K, undigested genomic DNA; lanes 1–4, DNA digested with 4 μg (32 pmols) of TaqII (Methods): lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN, 20% DMSO; lanes 5–14, DNA digested with twofold dilutions of TaqII for 3 h at 65°C in the presence of SIN/DMSO: lane 5, 5 μg; lane 6, 2.5 μg; lane 7, 1.25 μg; lane 8, 0.63 μg; lane 9, 0.31 μg; lane 10, 0.16 μg; lane 11, 0.08 μg; lane 12, 0.04 μg; lane 13, 0.02 μg; lane 14, 0.01 μg. ( B ) Partial digestion controlled by reaction duration. Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); DNA digested with 5 μg (40 pmols) of TaqII at 65°C in the presence of SIN/DMSO (Methods): lane 1, 16 h; lane 2, 8 h; lane 3, 4 h; lane 4, 2 h; lane 5, 1 h; lane 6, 30 min; lane 7, 15 min; lane 8, 7.5 min; lane 9, 3.25 min; lane 10, 1.62 min; lane 11, 0.81 min.

    Journal: BMC Genomics

    Article Title: A new genomic tool, ultra-frequently cleaving TaqII/sinefungin endonuclease with a combined 2.9-bp recognition site, applied to the construction of horse DNA libraries

    doi: 10.1186/1471-2164-14-370

    Figure Lengend Snippet: Digestion of highest complexity genomic DNA ( Equus caballus ) with TaqII/SIN/DMSO for BAC library construction. TaqII affinity star cleaved 1 μg horse liver DNA was electrophoresed on 1.5% agarose/TBE gel. Cleavage was carried out as described in Methods. ( A ) Partial digestion controlled by serial enzyme dilutions. Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); Lane K, undigested genomic DNA; lanes 1–4, DNA digested with 4 μg (32 pmols) of TaqII (Methods): lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN, 20% DMSO; lanes 5–14, DNA digested with twofold dilutions of TaqII for 3 h at 65°C in the presence of SIN/DMSO: lane 5, 5 μg; lane 6, 2.5 μg; lane 7, 1.25 μg; lane 8, 0.63 μg; lane 9, 0.31 μg; lane 10, 0.16 μg; lane 11, 0.08 μg; lane 12, 0.04 μg; lane 13, 0.02 μg; lane 14, 0.01 μg. ( B ) Partial digestion controlled by reaction duration. Lane M1, Fermentas 100 bp DNA Ladder (selected bands marked); lane M2, Fermentas 1 kb DNA Ladder (selected bands marked); DNA digested with 5 μg (40 pmols) of TaqII at 65°C in the presence of SIN/DMSO (Methods): lane 1, 16 h; lane 2, 8 h; lane 3, 4 h; lane 4, 2 h; lane 5, 1 h; lane 6, 30 min; lane 7, 15 min; lane 8, 7.5 min; lane 9, 3.25 min; lane 10, 1.62 min; lane 11, 0.81 min.

    Article Snippet: The new TaqII/SIN/DMSO “molecular scissors” presented in this paper are potentially very useful for generating quasi-random genomic libraries, as there are only five other high-specificity enzyme that possess similarly frequent DNA cleavage properties: CviJI/CviJI*, FaiI, SetI, TspGWI/SIN and NEBNext dsDNA Fragmentase.

    Techniques: BAC Assay

    Digestion of complex bacterial genomes with various sizes and GC contents. TaqII affinity star cleaved 0.5 μg bacterial ( E. coli and T. thermophilus ) genomic DNA samples were electrophoresed on 1.5% agarose/TBE gel. Cleavage (maximum extend) was carried out under specificity change stimulatory conditions (see Methods Figures 2 , 3 and 6 ). ( A ) TaqII affinity star cleavage of E. coli genomic DNA (51% GC, 4.6 Mb [GeneBank CP000948]). Lane M1, Fermentas 1 kb DNA Ladder (selected bands marked); lane M2, Fermentas 100 bp DNA Ladder (selected bands marked); Lane K, undigested genomic DNA; lanes 1–4, DNA digested with TaqII: lane 1, without SIN and DMSO; lane 2, with SIN added, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN and 20% DMSO. ( B ) TaqII affinity star cleavage of T. thermophilus genomic DNA (69.4% GC, 1.89 Mb [GenBank AE017221]). Reactions were conducted as in Panel A , except that T. thermophilus genomic DNA was used as substrate. ( C ) TaqII affinity star cleavage of horse genomic DNA (51% GC, 2.47 Gb [GenBank AAWR02000000]). Reactions were conducted as in Panel A , except that horse genomic DNA was used as substrate.

    Journal: BMC Genomics

    Article Title: A new genomic tool, ultra-frequently cleaving TaqII/sinefungin endonuclease with a combined 2.9-bp recognition site, applied to the construction of horse DNA libraries

    doi: 10.1186/1471-2164-14-370

    Figure Lengend Snippet: Digestion of complex bacterial genomes with various sizes and GC contents. TaqII affinity star cleaved 0.5 μg bacterial ( E. coli and T. thermophilus ) genomic DNA samples were electrophoresed on 1.5% agarose/TBE gel. Cleavage (maximum extend) was carried out under specificity change stimulatory conditions (see Methods Figures 2 , 3 and 6 ). ( A ) TaqII affinity star cleavage of E. coli genomic DNA (51% GC, 4.6 Mb [GeneBank CP000948]). Lane M1, Fermentas 1 kb DNA Ladder (selected bands marked); lane M2, Fermentas 100 bp DNA Ladder (selected bands marked); Lane K, undigested genomic DNA; lanes 1–4, DNA digested with TaqII: lane 1, without SIN and DMSO; lane 2, with SIN added, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN and 20% DMSO. ( B ) TaqII affinity star cleavage of T. thermophilus genomic DNA (69.4% GC, 1.89 Mb [GenBank AE017221]). Reactions were conducted as in Panel A , except that T. thermophilus genomic DNA was used as substrate. ( C ) TaqII affinity star cleavage of horse genomic DNA (51% GC, 2.47 Gb [GenBank AAWR02000000]). Reactions were conducted as in Panel A , except that horse genomic DNA was used as substrate.

    Article Snippet: The new TaqII/SIN/DMSO “molecular scissors” presented in this paper are potentially very useful for generating quasi-random genomic libraries, as there are only five other high-specificity enzyme that possess similarly frequent DNA cleavage properties: CviJI/CviJI*, FaiI, SetI, TspGWI/SIN and NEBNext dsDNA Fragmentase.

    Techniques: Gas Chromatography

    Comparative digestion of the PCR amplified horse butyrylcholinesterase gene with frequently cleaving REases. TaqII affinity star cleaved 1 μg horse butyrylcholinesterase gene DNA (1841 bp) was electrophoresed on 1.5% agarose/TBE gel. Cleavage was carried out at 65°C for 16 h with 5 μg (40 pmol) of enzyme in 50 μl of reaction volume. Lane M1, Fermentas 1 kb DNA Ladder (selected bands marked); lane M2, Fermentas 100 bp DNA Ladder (selected bands marked); Lane K, undigested DNA; lanes 1–4, DNA digested with TaqII (Methods): lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN, 20% DMSO; lane 5, DNA digested with HaeIII (5 units); lane 6, DNA digested with CviJI (0.25 unit).

    Journal: BMC Genomics

    Article Title: A new genomic tool, ultra-frequently cleaving TaqII/sinefungin endonuclease with a combined 2.9-bp recognition site, applied to the construction of horse DNA libraries

    doi: 10.1186/1471-2164-14-370

    Figure Lengend Snippet: Comparative digestion of the PCR amplified horse butyrylcholinesterase gene with frequently cleaving REases. TaqII affinity star cleaved 1 μg horse butyrylcholinesterase gene DNA (1841 bp) was electrophoresed on 1.5% agarose/TBE gel. Cleavage was carried out at 65°C for 16 h with 5 μg (40 pmol) of enzyme in 50 μl of reaction volume. Lane M1, Fermentas 1 kb DNA Ladder (selected bands marked); lane M2, Fermentas 100 bp DNA Ladder (selected bands marked); Lane K, undigested DNA; lanes 1–4, DNA digested with TaqII (Methods): lane 1, without SIN and DMSO; lane 2, with SIN, no DMSO; lane 3, no SIN, 20% DMSO; lane 4, with SIN, 20% DMSO; lane 5, DNA digested with HaeIII (5 units); lane 6, DNA digested with CviJI (0.25 unit).

    Article Snippet: The new TaqII/SIN/DMSO “molecular scissors” presented in this paper are potentially very useful for generating quasi-random genomic libraries, as there are only five other high-specificity enzyme that possess similarly frequent DNA cleavage properties: CviJI/CviJI*, FaiI, SetI, TspGWI/SIN and NEBNext dsDNA Fragmentase.

    Techniques: Polymerase Chain Reaction, Amplification

    Specificity change of TaqII REase in the presence of SIN and DMSO. Relaxed recognition sites were determined by shotgun cloning and sequencing of TaqII restriction fragments obtained in the presence of SIN and DMSO. After digestion DNA was blunted with T4 polymerase and cloned into the SmaI site of pUC19 vector. TaqII – canonical recognition sequences. TaqII*/SIN – variants of SIN induced relaxed recognition sequences.

    Journal: BMC Genomics

    Article Title: A new genomic tool, ultra-frequently cleaving TaqII/sinefungin endonuclease with a combined 2.9-bp recognition site, applied to the construction of horse DNA libraries

    doi: 10.1186/1471-2164-14-370

    Figure Lengend Snippet: Specificity change of TaqII REase in the presence of SIN and DMSO. Relaxed recognition sites were determined by shotgun cloning and sequencing of TaqII restriction fragments obtained in the presence of SIN and DMSO. After digestion DNA was blunted with T4 polymerase and cloned into the SmaI site of pUC19 vector. TaqII – canonical recognition sequences. TaqII*/SIN – variants of SIN induced relaxed recognition sequences.

    Article Snippet: The new TaqII/SIN/DMSO “molecular scissors” presented in this paper are potentially very useful for generating quasi-random genomic libraries, as there are only five other high-specificity enzyme that possess similarly frequent DNA cleavage properties: CviJI/CviJI*, FaiI, SetI, TspGWI/SIN and NEBNext dsDNA Fragmentase.

    Techniques: Clone Assay, Sequencing, Plasmid Preparation