Structured Review

MWG-Biotech dna sequences
Dna Sequences, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 92/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna sequences/product/MWG-Biotech
Average 92 stars, based on 15 article reviews
Price from $9.99 to $1999.99
dna sequences - by Bioz Stars, 2020-09
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Genotypic Characterization of Torymus sinensis (Hymenoptera: Torymidae) After Its Introduction in Tuscany (Italy) for the Biological Control of Dryocosmus kuriphilus (Hymenoptera: Cynipidae)
Article Snippet: .. The amplified DNA sequences were cloned and the two haplotypes were sequenced by automated sequencing (MWG Biotech, Ebersberg, Germany). ..

Article Title: Accumulation of the hormone abscisic acid (ABA) at the infection site of the fungus Cercospora beticola supports the role of ABA as a repressor of plant defence in sugar beet
Article Snippet: .. After cloning the PCR product into the pGEM‐T Easy vector (Promega, Mannheim, Germany), the DNA sequence was determined by the DNA sequencing service of MWG Biotech (München, Germany). .. Agrobacterium tumefaciens ‐mediated transformation of the sugar beet ( Beta vulgaris , var.

Article Title: sal Genes Determining the Catabolism of Salicylate Esters Are Part of a Supraoperonic Cluster of Catabolic Genes in Acinetobacter sp. Strain ADP1
Article Snippet: .. DNA sequences were determined by primer walking of fragments cloned in pUC18 by MWG-Biotech Ltd. (Ebersberg, Germany). .. Searches of the GenBank database were carried out with the BLASTN and BLASTP programs from the National Center for Biotechnology Information, Bethesda, Md. ( ).

Amplification:

Article Title: Genotypic Characterization of Torymus sinensis (Hymenoptera: Torymidae) After Its Introduction in Tuscany (Italy) for the Biological Control of Dryocosmus kuriphilus (Hymenoptera: Cynipidae)
Article Snippet: .. The amplified DNA sequences were cloned and the two haplotypes were sequenced by automated sequencing (MWG Biotech, Ebersberg, Germany). ..

Chromosome Walking:

Article Title: sal Genes Determining the Catabolism of Salicylate Esters Are Part of a Supraoperonic Cluster of Catabolic Genes in Acinetobacter sp. Strain ADP1
Article Snippet: .. DNA sequences were determined by primer walking of fragments cloned in pUC18 by MWG-Biotech Ltd. (Ebersberg, Germany). .. Searches of the GenBank database were carried out with the BLASTN and BLASTP programs from the National Center for Biotechnology Information, Bethesda, Md. ( ).

Construct:

Article Title: Platform Engineering of Corynebacterium glutamicum with Reduced Pyruvate Dehydrogenase Complex Activity for Improved Production of l-Lysine, l-Valine, and 2-Ketoisovalerate
Article Snippet: .. All nucleotide sequences of the inserts in the newly constructed plasmids were verified by sequencing (MWG Biotech). ..

Sequencing:

Article Title: Genotypic Characterization of Torymus sinensis (Hymenoptera: Torymidae) After Its Introduction in Tuscany (Italy) for the Biological Control of Dryocosmus kuriphilus (Hymenoptera: Cynipidae)
Article Snippet: .. The amplified DNA sequences were cloned and the two haplotypes were sequenced by automated sequencing (MWG Biotech, Ebersberg, Germany). ..

Article Title: Accumulation of the hormone abscisic acid (ABA) at the infection site of the fungus Cercospora beticola supports the role of ABA as a repressor of plant defence in sugar beet
Article Snippet: .. After cloning the PCR product into the pGEM‐T Easy vector (Promega, Mannheim, Germany), the DNA sequence was determined by the DNA sequencing service of MWG Biotech (München, Germany). .. Agrobacterium tumefaciens ‐mediated transformation of the sugar beet ( Beta vulgaris , var.

Article Title: In vivo and in vitro function of human UDP-galactose 4?-epimerase variants
Article Snippet: .. Following verification of the DNA sequence (MWG-Biotech, Ebersburg, Germany), the mutated plasmid was used to direct the expression of M284K-hGALE. ..

Article Title: Platform Engineering of Corynebacterium glutamicum with Reduced Pyruvate Dehydrogenase Complex Activity for Improved Production of l-Lysine, l-Valine, and 2-Ketoisovalerate
Article Snippet: .. All nucleotide sequences of the inserts in the newly constructed plasmids were verified by sequencing (MWG Biotech). ..

DNA Sequencing:

Article Title: Accumulation of the hormone abscisic acid (ABA) at the infection site of the fungus Cercospora beticola supports the role of ABA as a repressor of plant defence in sugar beet
Article Snippet: .. After cloning the PCR product into the pGEM‐T Easy vector (Promega, Mannheim, Germany), the DNA sequence was determined by the DNA sequencing service of MWG Biotech (München, Germany). .. Agrobacterium tumefaciens ‐mediated transformation of the sugar beet ( Beta vulgaris , var.

Expressing:

Article Title: In vivo and in vitro function of human UDP-galactose 4?-epimerase variants
Article Snippet: .. Following verification of the DNA sequence (MWG-Biotech, Ebersburg, Germany), the mutated plasmid was used to direct the expression of M284K-hGALE. ..

Polymerase Chain Reaction:

Article Title: Accumulation of the hormone abscisic acid (ABA) at the infection site of the fungus Cercospora beticola supports the role of ABA as a repressor of plant defence in sugar beet
Article Snippet: .. After cloning the PCR product into the pGEM‐T Easy vector (Promega, Mannheim, Germany), the DNA sequence was determined by the DNA sequencing service of MWG Biotech (München, Germany). .. Agrobacterium tumefaciens ‐mediated transformation of the sugar beet ( Beta vulgaris , var.

Plasmid Preparation:

Article Title: Accumulation of the hormone abscisic acid (ABA) at the infection site of the fungus Cercospora beticola supports the role of ABA as a repressor of plant defence in sugar beet
Article Snippet: .. After cloning the PCR product into the pGEM‐T Easy vector (Promega, Mannheim, Germany), the DNA sequence was determined by the DNA sequencing service of MWG Biotech (München, Germany). .. Agrobacterium tumefaciens ‐mediated transformation of the sugar beet ( Beta vulgaris , var.

Article Title: In vivo and in vitro function of human UDP-galactose 4?-epimerase variants
Article Snippet: .. Following verification of the DNA sequence (MWG-Biotech, Ebersburg, Germany), the mutated plasmid was used to direct the expression of M284K-hGALE. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    MWG-Biotech sftq2 nucleotide sequence
    Schematic overview showing the subcellular localization of the periplasmic protein interactions and controls assayed with the <t>sfTq2</t> ox ‐mNG FRET pair. PBP5 dimerization interactions were assayed with sfTq2‐mNG. Inh. refers to the inactive mutants PBP5 S44G , FtsB m4 and FtsL m4 . A full list of Ef A values is shown in Table 1 .
    Sftq2 Nucleotide Sequence, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sftq2 nucleotide sequence/product/MWG-Biotech
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sftq2 nucleotide sequence - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    85
    MWG-Biotech 101 nucleotide sequence
    Expression of CRT isoforms in Arabidopsis and maize. A and D, Examination of cross-hybridization of the Arabidopsis CRT1 , CRT2 , and CRT3 (A) and maize CRT1/2 and CRT3 (D) isoform probes. One hundred nanograms of each probe was applied to the membrane and subsequently probed with radiolabeled CRT1 , CRT2 , and CRT3 probes corresponding to respective species. The cross-hybridization was performed in parallel with northern-blot hybridizations. B and E, Northernblot analyses of total RNA (Arabidopsis, 10 μg lane –1 ; and maize, 14 μg lane –1 ) from various tissues in Arabidopsis (B) and maize (E). Membranes were probed with radiolabeled CRT1 , CRT2 , and CRT3 probes (Arabidopsis) and a CRT3 probe (maize) within respective species. Radiolabeled rRNA was used as a control. Arabidopsis experiments were performed independently three times and gave similar expression profiles. Maize experiments were performed once to confirm Arabidopsis patterns. C, Visualization of relative expression of CRT isoforms in various tissues for Arabidopsis. Asterisk, Maize CRT3 probe corresponds to a <t>101-nucleotide</t> 3′-untranslated region (UTR) segment.
    101 Nucleotide Sequence, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/101 nucleotide sequence/product/MWG-Biotech
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    101 nucleotide sequence - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    88
    MWG-Biotech double stranded dna sequence analysis
    <t>DGGE</t> analysis of partial 16S rRNA gene sequences from super-pool <t>DNA</t> and individual gradient fractions (image normalized to remove smiling, using GelCompar software). SP indicates DGGE patterns from unfractionated super-pool DNA, and lane numbers indicate
    Double Stranded Dna Sequence Analysis, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/double stranded dna sequence analysis/product/MWG-Biotech
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    double stranded dna sequence analysis - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    94
    MWG-Biotech dna sequencing
    <t>DGGE</t> analysis of partial 16S rRNA gene sequences from super-pool <t>DNA</t> and individual gradient fractions (image normalized to remove smiling, using GelCompar software). SP indicates DGGE patterns from unfractionated super-pool DNA, and lane numbers indicate
    Dna Sequencing, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 94/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna sequencing/product/MWG-Biotech
    Average 94 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    dna sequencing - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Schematic overview showing the subcellular localization of the periplasmic protein interactions and controls assayed with the sfTq2 ox ‐mNG FRET pair. PBP5 dimerization interactions were assayed with sfTq2‐mNG. Inh. refers to the inactive mutants PBP5 S44G , FtsB m4 and FtsL m4 . A full list of Ef A values is shown in Table 1 .

    Journal: Molecular Microbiology

    Article Title: Superfolder mTurquoise2ox optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets

    doi: 10.1111/mmi.14206

    Figure Lengend Snippet: Schematic overview showing the subcellular localization of the periplasmic protein interactions and controls assayed with the sfTq2 ox ‐mNG FRET pair. PBP5 dimerization interactions were assayed with sfTq2‐mNG. Inh. refers to the inactive mutants PBP5 S44G , FtsB m4 and FtsL m4 . A full list of Ef A values is shown in Table 1 .

    Article Snippet: The sfTq2 nucleotide sequence (encoding mTurquoise2 with S30R, Y39N, F99S, N105T and I171V) was obtained by gene synthesis (MWG biotech).

    Techniques:

    sfTq2 ox comes without a trade‐off. A. Frequency domain FLIM of HeLa cells expressing mTq2, sfTq2 or sfTq2 ox in the cytoplasm reveals a similar average fluorescence lifetime of 3.9 ns. B. FLIM of a suspension of E. coli cells expressing periplasmic OmpA‐sfTq2 or OmpA‐sfTq2 ox also show a similar fluorescence lifetime of 3.9 ns. C. The cellular brightness of mTq2, sfTq2 and sfTq2 ox is equal in Hela cells. The slope coefficients of the fits are, respectively: 0.87, 0.84 and 0.76. D. Fixed samples of LMC500 cells at OD 450 = 1.00 expressing cytoplasmic mTq2, sfTq2 or sfTq2 ox show equal amounts of fluorescence.

    Journal: Molecular Microbiology

    Article Title: Superfolder mTurquoise2ox optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets

    doi: 10.1111/mmi.14206

    Figure Lengend Snippet: sfTq2 ox comes without a trade‐off. A. Frequency domain FLIM of HeLa cells expressing mTq2, sfTq2 or sfTq2 ox in the cytoplasm reveals a similar average fluorescence lifetime of 3.9 ns. B. FLIM of a suspension of E. coli cells expressing periplasmic OmpA‐sfTq2 or OmpA‐sfTq2 ox also show a similar fluorescence lifetime of 3.9 ns. C. The cellular brightness of mTq2, sfTq2 and sfTq2 ox is equal in Hela cells. The slope coefficients of the fits are, respectively: 0.87, 0.84 and 0.76. D. Fixed samples of LMC500 cells at OD 450 = 1.00 expressing cytoplasmic mTq2, sfTq2 or sfTq2 ox show equal amounts of fluorescence.

    Article Snippet: The sfTq2 nucleotide sequence (encoding mTurquoise2 with S30R, Y39N, F99S, N105T and I171V) was obtained by gene synthesis (MWG biotech).

    Techniques: Expressing, Fluorescence

    Superfolder mTurquoise2 fluoresces in the periplasm. A. Plate reader growth data in rich medium at 37°C show that the periplasmic sfTq2 expression is less toxic at high induction than the original mTq2. Plate reader fluorescence measurements confirm that periplasmic sfTq2 gives fluorescent signals while mTq2 does not. B. Fluorescence microscopy of living cells expressing an empty vector control, mTq2‐PBP5 or sfTq2‐PBP5, reveals fluorescence only from the sfTq2 fusion. Fixation of the same cells does not result in a decreased sfTq2 signal. Overnight maturation of the fixed cells at RT to allow for possible chromophore (re)formation (indicated as ‘matured’) did not result in an increase in fluorescence for periplasmic mTq2 suggesting it had not folded properly while sfTq2 showed a strong periplasmic signal. All photographs are shown with the same grey values (100–4000) for comparison and the scale bar represents 2 µm. C. Quantification of the control, mTq2 and sfTq2 cultures for the living, fixed and matured cells shows no difference between the empty vector control and the mTq2 cells. The sfTq2 cells showed a small maturation effect. The error bars at the mean represent the 95% confidence interval. The number of cells measured were: Alive) EV = 1018, mTq2 = 650 and sfTq2 = 571. Fixed) EV = 1176, mTq2 = 1046, sfTq2 = 884. Fixed and matured) EV = 1142, mTq2 = 931, sfTq2 = 988.

    Journal: Molecular Microbiology

    Article Title: Superfolder mTurquoise2ox optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets

    doi: 10.1111/mmi.14206

    Figure Lengend Snippet: Superfolder mTurquoise2 fluoresces in the periplasm. A. Plate reader growth data in rich medium at 37°C show that the periplasmic sfTq2 expression is less toxic at high induction than the original mTq2. Plate reader fluorescence measurements confirm that periplasmic sfTq2 gives fluorescent signals while mTq2 does not. B. Fluorescence microscopy of living cells expressing an empty vector control, mTq2‐PBP5 or sfTq2‐PBP5, reveals fluorescence only from the sfTq2 fusion. Fixation of the same cells does not result in a decreased sfTq2 signal. Overnight maturation of the fixed cells at RT to allow for possible chromophore (re)formation (indicated as ‘matured’) did not result in an increase in fluorescence for periplasmic mTq2 suggesting it had not folded properly while sfTq2 showed a strong periplasmic signal. All photographs are shown with the same grey values (100–4000) for comparison and the scale bar represents 2 µm. C. Quantification of the control, mTq2 and sfTq2 cultures for the living, fixed and matured cells shows no difference between the empty vector control and the mTq2 cells. The sfTq2 cells showed a small maturation effect. The error bars at the mean represent the 95% confidence interval. The number of cells measured were: Alive) EV = 1018, mTq2 = 650 and sfTq2 = 571. Fixed) EV = 1176, mTq2 = 1046, sfTq2 = 884. Fixed and matured) EV = 1142, mTq2 = 931, sfTq2 = 988.

    Article Snippet: The sfTq2 nucleotide sequence (encoding mTurquoise2 with S30R, Y39N, F99S, N105T and I171V) was obtained by gene synthesis (MWG biotech).

    Techniques: Expressing, Fluorescence, Microscopy, Plasmid Preparation

    Cysteine‐replaced sfTq2 variants perform better in the periplasm. A. Periplasmic expression of sfTq2‐PBP5 variants in LMC500 grown in rich medium at 37°C at relatively non‐toxic induction conditions results in large differences in cyan fluorescence. The C70V variant performs better than C48S and the double cysteine mutant version. B. Microscopy of LMC500 grown in rich medium and induced with 15 µM IPTG shows strong fluorescence for the sfTq2‐PBP5 variants in the periplasm. For comparison, the greyscale of all photographs are the same (80–7000) and the scale bar represents 2 µm. C. Quantification of the images confirms bright fluorescence signals from the single C48S and C70V sfTq2 variants. Differences in fluorescence with the prolonged plate reader induction suggest that folding difficulties may still be a problem. The error bars at the mean represent the 95% confidence interval. The number of cells measured were between: Alive 500–1000, Fixed 1000–1500 and Matured 1000–2000 except for EV‐Alive n = 327 and C48S‐C70V‐Fixed n = 775. D. mTq2 is produced at similar levels as sfTq2 but does not fold properly; cysteine mutants of sfTq2 are produced at higher levels. Anti‐GFP immunoblotting of the corresponding samples shows that the fusion proteins are intact and that C48S has a minor propensity to form higher order complexes (asterisk). The + and signs, respectively, indicate the presence or absence of the reducing agent DTT in the sample.

    Journal: Molecular Microbiology

    Article Title: Superfolder mTurquoise2ox optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets

    doi: 10.1111/mmi.14206

    Figure Lengend Snippet: Cysteine‐replaced sfTq2 variants perform better in the periplasm. A. Periplasmic expression of sfTq2‐PBP5 variants in LMC500 grown in rich medium at 37°C at relatively non‐toxic induction conditions results in large differences in cyan fluorescence. The C70V variant performs better than C48S and the double cysteine mutant version. B. Microscopy of LMC500 grown in rich medium and induced with 15 µM IPTG shows strong fluorescence for the sfTq2‐PBP5 variants in the periplasm. For comparison, the greyscale of all photographs are the same (80–7000) and the scale bar represents 2 µm. C. Quantification of the images confirms bright fluorescence signals from the single C48S and C70V sfTq2 variants. Differences in fluorescence with the prolonged plate reader induction suggest that folding difficulties may still be a problem. The error bars at the mean represent the 95% confidence interval. The number of cells measured were between: Alive 500–1000, Fixed 1000–1500 and Matured 1000–2000 except for EV‐Alive n = 327 and C48S‐C70V‐Fixed n = 775. D. mTq2 is produced at similar levels as sfTq2 but does not fold properly; cysteine mutants of sfTq2 are produced at higher levels. Anti‐GFP immunoblotting of the corresponding samples shows that the fusion proteins are intact and that C48S has a minor propensity to form higher order complexes (asterisk). The + and signs, respectively, indicate the presence or absence of the reducing agent DTT in the sample.

    Article Snippet: The sfTq2 nucleotide sequence (encoding mTurquoise2 with S30R, Y39N, F99S, N105T and I171V) was obtained by gene synthesis (MWG biotech).

    Techniques: Expressing, Fluorescence, Variant Assay, Mutagenesis, Microscopy, Produced

    In vivo FRET using the sfTq2‐mNG FRET pair. A. Periplasmic sfTq2 does not show altered spectra compared to cytoplasmic sfTq2. LMC500 grown to steady state in minimal medium at 28°C were induced to express sfTq2 freely in the cytoplasm or the periplasm as the OM‐bound OmpA‐sfTq2 fusion. After 2 MDs, the cells were fixed, washed with PBS and set to an OD 450 value of 1.000 ± 0.002 before measuring the fluorescence spectra. The normalized fluorescence spectra show the same shape suggesting that the spectral properties of sfTq2 are the same in the cytoplasmic and periplasmic compartments. B. Ef A values calculated for the sfTq2‐mNG FRET pair show a large difference for the cytoplasmic and periplasmic tandem. The technical negative control (IM‐OM) did not show any energy transfer. The activity‐related conformational changes of the PBP5 dimers previously observed with the mNG‐mCh FRET pair (Meiresonne et al., 2017 ) were confirmed. The error bars represent the mean and standard deviation. The control Ef A values were calculated from experiments in LMC500 and CS109 ∆ dacA and the PBP5 dimerization experiments were exclusively performed in CS109 ∆ dacA. Table S2 shows the FRET efficiencies measured with the plate reader. Representative unmixing data are shown in Fig. S14 .

    Journal: Molecular Microbiology

    Article Title: Superfolder mTurquoise2ox optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets

    doi: 10.1111/mmi.14206

    Figure Lengend Snippet: In vivo FRET using the sfTq2‐mNG FRET pair. A. Periplasmic sfTq2 does not show altered spectra compared to cytoplasmic sfTq2. LMC500 grown to steady state in minimal medium at 28°C were induced to express sfTq2 freely in the cytoplasm or the periplasm as the OM‐bound OmpA‐sfTq2 fusion. After 2 MDs, the cells were fixed, washed with PBS and set to an OD 450 value of 1.000 ± 0.002 before measuring the fluorescence spectra. The normalized fluorescence spectra show the same shape suggesting that the spectral properties of sfTq2 are the same in the cytoplasmic and periplasmic compartments. B. Ef A values calculated for the sfTq2‐mNG FRET pair show a large difference for the cytoplasmic and periplasmic tandem. The technical negative control (IM‐OM) did not show any energy transfer. The activity‐related conformational changes of the PBP5 dimers previously observed with the mNG‐mCh FRET pair (Meiresonne et al., 2017 ) were confirmed. The error bars represent the mean and standard deviation. The control Ef A values were calculated from experiments in LMC500 and CS109 ∆ dacA and the PBP5 dimerization experiments were exclusively performed in CS109 ∆ dacA. Table S2 shows the FRET efficiencies measured with the plate reader. Representative unmixing data are shown in Fig. S14 .

    Article Snippet: The sfTq2 nucleotide sequence (encoding mTurquoise2 with S30R, Y39N, F99S, N105T and I171V) was obtained by gene synthesis (MWG biotech).

    Techniques: In Vivo, Fluorescence, Negative Control, Activity Assay, Standard Deviation

    Expression of CRT isoforms in Arabidopsis and maize. A and D, Examination of cross-hybridization of the Arabidopsis CRT1 , CRT2 , and CRT3 (A) and maize CRT1/2 and CRT3 (D) isoform probes. One hundred nanograms of each probe was applied to the membrane and subsequently probed with radiolabeled CRT1 , CRT2 , and CRT3 probes corresponding to respective species. The cross-hybridization was performed in parallel with northern-blot hybridizations. B and E, Northernblot analyses of total RNA (Arabidopsis, 10 μg lane –1 ; and maize, 14 μg lane –1 ) from various tissues in Arabidopsis (B) and maize (E). Membranes were probed with radiolabeled CRT1 , CRT2 , and CRT3 probes (Arabidopsis) and a CRT3 probe (maize) within respective species. Radiolabeled rRNA was used as a control. Arabidopsis experiments were performed independently three times and gave similar expression profiles. Maize experiments were performed once to confirm Arabidopsis patterns. C, Visualization of relative expression of CRT isoforms in various tissues for Arabidopsis. Asterisk, Maize CRT3 probe corresponds to a 101-nucleotide 3′-untranslated region (UTR) segment.

    Journal: Plant Physiology

    Article Title: Phylogenetic Analyses and Expression Studies Reveal Two Distinct Groups of Calreticulin Isoforms in Higher Plants 1

    doi: 10.1104/pp.103.024943

    Figure Lengend Snippet: Expression of CRT isoforms in Arabidopsis and maize. A and D, Examination of cross-hybridization of the Arabidopsis CRT1 , CRT2 , and CRT3 (A) and maize CRT1/2 and CRT3 (D) isoform probes. One hundred nanograms of each probe was applied to the membrane and subsequently probed with radiolabeled CRT1 , CRT2 , and CRT3 probes corresponding to respective species. The cross-hybridization was performed in parallel with northern-blot hybridizations. B and E, Northernblot analyses of total RNA (Arabidopsis, 10 μg lane –1 ; and maize, 14 μg lane –1 ) from various tissues in Arabidopsis (B) and maize (E). Membranes were probed with radiolabeled CRT1 , CRT2 , and CRT3 probes (Arabidopsis) and a CRT3 probe (maize) within respective species. Radiolabeled rRNA was used as a control. Arabidopsis experiments were performed independently three times and gave similar expression profiles. Maize experiments were performed once to confirm Arabidopsis patterns. C, Visualization of relative expression of CRT isoforms in various tissues for Arabidopsis. Asterisk, Maize CRT3 probe corresponds to a 101-nucleotide 3′-untranslated region (UTR) segment.

    Article Snippet: A 101-nucleotide sequence corresponding to the 3′ UTR for maize CRT3 (corresponding to 5′-CTATAAAAGTCCCCAAATATTGCATTCCTCAAAAGCATAAGCTGGAAGTTGCTTCGGACATTGTGGGTGCTTTTCAATAATAATAATTGATTCGCCTGGTCAGAA-3′) was obtained from MWG Biotech and used as isoform-specific probe.

    Techniques: Expressing, Hybridization, Northern Blot

    DGGE analysis of partial 16S rRNA gene sequences from super-pool DNA and individual gradient fractions (image normalized to remove smiling, using GelCompar software). SP indicates DGGE patterns from unfractionated super-pool DNA, and lane numbers indicate

    Journal: Applied and Environmental Microbiology

    Article Title: GC Fractionation Enhances Microbial Community Diversity Assessment and Detection of Minority Populations of Bacteria by Denaturing Gradient Gel Electrophoresis

    doi: 10.1128/AEM.70.4.2263-2270.2004

    Figure Lengend Snippet: DGGE analysis of partial 16S rRNA gene sequences from super-pool DNA and individual gradient fractions (image normalized to remove smiling, using GelCompar software). SP indicates DGGE patterns from unfractionated super-pool DNA, and lane numbers indicate

    Article Snippet: All confirmed clones from the super-pool survey and from DGGE bands were subjected to double-stranded DNA sequence analysis (MWG Biotech, High Point, N.C.) and sequence comparison to determine the best match to known sequences using the Ribosomal Database Project II (RDP II) website ( ) ( ).

    Techniques: Denaturing Gradient Gel Electrophoresis, Software

    GC profile of pooled cecal community DNA (super-pool DNA) from ∼500 individual birds from the United States, United Kingdom, Australia, France, and Finland. Numbers indicate locations of individual fractions subjected to DGGE analysis.

    Journal: Applied and Environmental Microbiology

    Article Title: GC Fractionation Enhances Microbial Community Diversity Assessment and Detection of Minority Populations of Bacteria by Denaturing Gradient Gel Electrophoresis

    doi: 10.1128/AEM.70.4.2263-2270.2004

    Figure Lengend Snippet: GC profile of pooled cecal community DNA (super-pool DNA) from ∼500 individual birds from the United States, United Kingdom, Australia, France, and Finland. Numbers indicate locations of individual fractions subjected to DGGE analysis.

    Article Snippet: All confirmed clones from the super-pool survey and from DGGE bands were subjected to double-stranded DNA sequence analysis (MWG Biotech, High Point, N.C.) and sequence comparison to determine the best match to known sequences using the Ribosomal Database Project II (RDP II) website ( ) ( ).

    Techniques: Denaturing Gradient Gel Electrophoresis