Structured Review

Genewiz dna sequences
Dna Sequences, supplied by Genewiz, used in various techniques. Bioz Stars score: 92/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna sequences/product/Genewiz
Average 92 stars, based on 22 article reviews
Price from $9.99 to $1999.99
dna sequences - by Bioz Stars, 2020-09
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Identification and characterization of Rhodopseudomonas palustris TIE-1 hopanoid biosynthesis mutants
Article Snippet: .. DNA sequences of all cloning intermediates were confirmed by sequencing at the Biopolymers Laboratory in the MIT Center for Cancer Research or through the GENEWIZ Boston Laboratory. .. E. coli strains were transformed by electroporation using an Electroporator 2510 (Eppendorf, Hamburg, Germany) as recommended by the supplier.

Article Title: Mammalian display screening of diverse cystine-dense peptides for difficult to drug targets
Article Snippet: .. CDP production and purification Test CDPs and TEAD-binding optides were cloned into our secreted, soluble protein production vector, DNA-sequence validated (Sanger sequencing, Genewiz; coding DNA sequences are shown below, and raw sequence files supplied as Supplementary Data ), and purified, as per standard protocols , at either large (2 L in 5 L flasks) or small (1 mL in 96-well deep well blocks) volumes. .. In brief: peptide coding sequences were cloned into the Daedalus vector, a lentivector driving secretion of siderocalin-tagged proteins.

Amplification:

Article Title: Reduced Expression of VEGF-A in Human Retinal Pigment Epithelial Cells and Human Muller Cells Following CRISPR-Cas9 Ribonucleoprotein-Mediated Gene Disruption
Article Snippet: .. DNA SequencingTo assess the effects of the CRISPR-Cas9 gene editing on the DNA sequence, a Sanger sequencing assay of a 284 base pair (bp) amplicon flanking the target area on the VEGF-A gene was performed by Genewiz (South Plainfield, NJ). ..

Synthesized:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

Article Title: FTD/ALS-associated poly(GR) protein impairs the Notch pathway and is recruited by poly(GA) into cytoplasmic inclusions
Article Snippet: .. The DNA sequences were synthesized (Genewiz) and subcloned into pUASTattB vector between the Bgl II and Xho I sites. .. The UAS-(GR)80 control construct was generated by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kits, Agilent Technologies), in which the first two nucleotides of the start codon ATG were mutated to TA to form the stop codon TAG (the a5263t_t5264a mutations primer: TCGTTAACAGATCTCCAC CTAGGATTACAAGGACGACGAC).

Construct:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

Article Title: Structural variability of EspG chaperones from mycobacterial ESX-1, ESX-3 and ESX-5 type VII secretion systems
Article Snippet: .. The DNA sequence of the construct was verified by DNA sequencing (Genewiz). .. EspG3mma was expressed from pMAPLe4 as a maltose binding protein (MBP) fusion which was cleaved in vivo from MBP via a tobacco vein mottling virus (TVMV) protease cleavage site situated between the two moieties; a His6 affinity tag and a tobacco etch virus (TEV) protease cleavage site is encoded in the linker between the TVMV protease cleavage site and the N-terminus of the target protein.

Article Title: The degradation pathway of a model misfolded protein is determined by aggregation propensity
Article Snippet: .. The DNA sequences of all constructs were confirmed by Genewiz. .. Western blot analysis After SDS–PAGE, proteins were transferred onto nitrocellulose (BioTrace NT; Pall Corp.) using the overnight wet transfer system (Amersham Biosciences), and Western blot analysis was performed as described previously ( ) with the following primary antibodies: rabbit anti–glucose-6-phosphate dehydrogenase (G6PD) (A9521; Sigma-Aldrich) at 1:5000, polyclonal rabbit anti-Sec61p ( ) at 1:5000, rat anti–HA-peroxidase (Roche) at 1:10,000, monoclonal mouse anti-GFP antibody (Roche) at 1:5000, and mouse anti-Pma1, which was a gift from Amy Chang (University of Michigan, Ann Arbor, MI) at 1:1000.

Purification:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

Article Title: Mammalian display screening of diverse cystine-dense peptides for difficult to drug targets
Article Snippet: .. CDP production and purification Test CDPs and TEAD-binding optides were cloned into our secreted, soluble protein production vector, DNA-sequence validated (Sanger sequencing, Genewiz; coding DNA sequences are shown below, and raw sequence files supplied as Supplementary Data ), and purified, as per standard protocols , at either large (2 L in 5 L flasks) or small (1 mL in 96-well deep well blocks) volumes. .. In brief: peptide coding sequences were cloned into the Daedalus vector, a lentivector driving secretion of siderocalin-tagged proteins.

Oligonucleotide Labeling:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

Generated:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

DNA Sequencing:

Article Title: Structural variability of EspG chaperones from mycobacterial ESX-1, ESX-3 and ESX-5 type VII secretion systems
Article Snippet: .. The DNA sequence of the construct was verified by DNA sequencing (Genewiz). .. EspG3mma was expressed from pMAPLe4 as a maltose binding protein (MBP) fusion which was cleaved in vivo from MBP via a tobacco vein mottling virus (TVMV) protease cleavage site situated between the two moieties; a His6 affinity tag and a tobacco etch virus (TEV) protease cleavage site is encoded in the linker between the TVMV protease cleavage site and the N-terminus of the target protein.

CRISPR:

Article Title: Reduced Expression of VEGF-A in Human Retinal Pigment Epithelial Cells and Human Muller Cells Following CRISPR-Cas9 Ribonucleoprotein-Mediated Gene Disruption
Article Snippet: .. DNA SequencingTo assess the effects of the CRISPR-Cas9 gene editing on the DNA sequence, a Sanger sequencing assay of a 284 base pair (bp) amplicon flanking the target area on the VEGF-A gene was performed by Genewiz (South Plainfield, NJ). ..

Sequencing:

Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody
Article Snippet: .. The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags. .. Protein was expressed in Sf9 cells by transient transfection (pBiex‐1; Escort IV, Sigma), and affinity purified at 72 h using anti‐FLAG M2 affinity resin (Sigma) similar to previously published protocols.

Article Title: Structural variability of EspG chaperones from mycobacterial ESX-1, ESX-3 and ESX-5 type VII secretion systems
Article Snippet: .. The DNA sequence of the construct was verified by DNA sequencing (Genewiz). .. EspG3mma was expressed from pMAPLe4 as a maltose binding protein (MBP) fusion which was cleaved in vivo from MBP via a tobacco vein mottling virus (TVMV) protease cleavage site situated between the two moieties; a His6 affinity tag and a tobacco etch virus (TEV) protease cleavage site is encoded in the linker between the TVMV protease cleavage site and the N-terminus of the target protein.

Article Title: Identification and characterization of Rhodopseudomonas palustris TIE-1 hopanoid biosynthesis mutants
Article Snippet: .. DNA sequences of all cloning intermediates were confirmed by sequencing at the Biopolymers Laboratory in the MIT Center for Cancer Research or through the GENEWIZ Boston Laboratory. .. E. coli strains were transformed by electroporation using an Electroporator 2510 (Eppendorf, Hamburg, Germany) as recommended by the supplier.

Article Title: Mammalian display screening of diverse cystine-dense peptides for difficult to drug targets
Article Snippet: .. CDP production and purification Test CDPs and TEAD-binding optides were cloned into our secreted, soluble protein production vector, DNA-sequence validated (Sanger sequencing, Genewiz; coding DNA sequences are shown below, and raw sequence files supplied as Supplementary Data ), and purified, as per standard protocols , at either large (2 L in 5 L flasks) or small (1 mL in 96-well deep well blocks) volumes. .. In brief: peptide coding sequences were cloned into the Daedalus vector, a lentivector driving secretion of siderocalin-tagged proteins.

Article Title: The Legionella pneumophila metaeffector Lpg2505 (SusF) regulates SidI-mediated translation inhibition and GDP-dependent glycosyltransferase activity
Article Snippet: .. DNA sequences were confirmed by Sanger sequencing (GENEWIZ, South Plainfield, NJ). .. L. pneumophila Lp01 wild-type and ΔdotA producing CyaA-SidI constructs were generated by electroporation of pcyaA ::sidIRP into competent strains using a BioRad Gene Pulser at 2.4 kV, 200 Ω, and 0.25 µF and plated on CYE supplemented with 10 µg mL-1 chloramphenicol.

Article Title: Reduced Expression of VEGF-A in Human Retinal Pigment Epithelial Cells and Human Muller Cells Following CRISPR-Cas9 Ribonucleoprotein-Mediated Gene Disruption
Article Snippet: .. DNA SequencingTo assess the effects of the CRISPR-Cas9 gene editing on the DNA sequence, a Sanger sequencing assay of a 284 base pair (bp) amplicon flanking the target area on the VEGF-A gene was performed by Genewiz (South Plainfield, NJ). ..

Plasmid Preparation:

Article Title: Mammalian display screening of diverse cystine-dense peptides for difficult to drug targets
Article Snippet: .. CDP production and purification Test CDPs and TEAD-binding optides were cloned into our secreted, soluble protein production vector, DNA-sequence validated (Sanger sequencing, Genewiz; coding DNA sequences are shown below, and raw sequence files supplied as Supplementary Data ), and purified, as per standard protocols , at either large (2 L in 5 L flasks) or small (1 mL in 96-well deep well blocks) volumes. .. In brief: peptide coding sequences were cloned into the Daedalus vector, a lentivector driving secretion of siderocalin-tagged proteins.

Article Title: FTD/ALS-associated poly(GR) protein impairs the Notch pathway and is recruited by poly(GA) into cytoplasmic inclusions
Article Snippet: .. The DNA sequences were synthesized (Genewiz) and subcloned into pUASTattB vector between the Bgl II and Xho I sites. .. The UAS-(GR)80 control construct was generated by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kits, Agilent Technologies), in which the first two nucleotides of the start codon ATG were mutated to TA to form the stop codon TAG (the a5263t_t5264a mutations primer: TCGTTAACAGATCTCCAC CTAGGATTACAAGGACGACGAC).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Genewiz dna sequence
    Lysate was incubated with nanobody‐labeled nanostructures bound to magnetic resin, eluted, and assessed by Western blotting for the Arp2 subunit. (B, C) Representative images are shown of Cy5 nanobody intensity and corresponding Arp2 Western band intensity for both ArpC3 and ArpC4 pulldowns. For both (B) <t>ArpC3‐GFP</t> and (C) ArpC4‐GFP, Arp2 scales with the number of nanobody on <t>DNA</t> nanostructures. Error bars are ± SEM ( n > 5).
    Dna Sequence, supplied by Genewiz, used in various techniques. Bioz Stars score: 92/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna sequence/product/Genewiz
    Average 92 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    dna sequence - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    88
    Genewiz dna sequencing pcr amplicons
    Visualizing the genotype and phenotype of Arabidopsis seedlings. (A) Images of A. thaliana leaves under blue light. Strain numbers are the same as in Figure 1B . (B) Agarose gel electrophoresis of <t>PCR</t> <t>amplicons.</t> The top half shows products of GFP amplification [772 bp with mPing present and 339 bp after mPing excision (lane 6 only)] and the bottom half shows the PCR amplicons for ORF1 (239 bp) and Tpase (435 bp). M: 1-kb Plus O’Gene Ruler (Fermentas). Low molecular weight bands (
    Dna Sequencing Pcr Amplicons, supplied by Genewiz, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna sequencing pcr amplicons/product/Genewiz
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna sequencing pcr amplicons - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    Lysate was incubated with nanobody‐labeled nanostructures bound to magnetic resin, eluted, and assessed by Western blotting for the Arp2 subunit. (B, C) Representative images are shown of Cy5 nanobody intensity and corresponding Arp2 Western band intensity for both ArpC3 and ArpC4 pulldowns. For both (B) ArpC3‐GFP and (C) ArpC4‐GFP, Arp2 scales with the number of nanobody on DNA nanostructures. Error bars are ± SEM ( n > 5).

    Journal: Protein Science : A Publication of the Protein Society

    Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody

    doi: 10.1002/pro.3020

    Figure Lengend Snippet: Lysate was incubated with nanobody‐labeled nanostructures bound to magnetic resin, eluted, and assessed by Western blotting for the Arp2 subunit. (B, C) Representative images are shown of Cy5 nanobody intensity and corresponding Arp2 Western band intensity for both ArpC3 and ArpC4 pulldowns. For both (B) ArpC3‐GFP and (C) ArpC4‐GFP, Arp2 scales with the number of nanobody on DNA nanostructures. Error bars are ± SEM ( n > 5).

    Article Snippet: The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags.

    Techniques: Incubation, Labeling, Western Blot

    Chemical readout of GFP‐tagged adenylyl cyclase on DNA nanostructures. (A) Schematic of activity assay measuring the stoichiometric attachment of GFP‐labeled adenylyl cyclase to Cy5‐labeled DNA nanostructures. Nanostructures with two binding sites are bound to magnetic resin and (1) labeled with Cy3‐tagged GFP‐nanobody, (2) incubated with GFP‐labeled adenylyl cyclase, and (3) reacted with 100 µ M ATP and 100 µ M forskolin at 30°C. (B) Nanobody‐labeled nanostructures with one, two, or four binding sites have distinct gel‐shifts in 0.67% agarose 0.1% SDS gels. (C) Cy5‐labeled DNA nanostructures decorated with increasing numbers of GFP‐labeled adenylyl cyclase show a clear linear increase in enzymatic activity relative to attachment sites ( R 2 = 0.87). Error bars represent ± SEM ( n > 5).

    Journal: Protein Science : A Publication of the Protein Society

    Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody

    doi: 10.1002/pro.3020

    Figure Lengend Snippet: Chemical readout of GFP‐tagged adenylyl cyclase on DNA nanostructures. (A) Schematic of activity assay measuring the stoichiometric attachment of GFP‐labeled adenylyl cyclase to Cy5‐labeled DNA nanostructures. Nanostructures with two binding sites are bound to magnetic resin and (1) labeled with Cy3‐tagged GFP‐nanobody, (2) incubated with GFP‐labeled adenylyl cyclase, and (3) reacted with 100 µ M ATP and 100 µ M forskolin at 30°C. (B) Nanobody‐labeled nanostructures with one, two, or four binding sites have distinct gel‐shifts in 0.67% agarose 0.1% SDS gels. (C) Cy5‐labeled DNA nanostructures decorated with increasing numbers of GFP‐labeled adenylyl cyclase show a clear linear increase in enzymatic activity relative to attachment sites ( R 2 = 0.87). Error bars represent ± SEM ( n > 5).

    Article Snippet: The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags.

    Techniques: Activity Assay, Labeling, Binding Assay, Incubation

    Mechanochemical measurement of GFP‐tagged myosin VI on nanostructures. (A) Schematic of myosin VI‐labeled flat rectangular DNA origami nanostructures interacting with a keratocyte‐derived actin network. (B) Representative detergent‐extracted keratocyte actin network with Alexa488‐phalloidin labeled actin (red) and nanobody‐labeled DNA nanostructures (green). (C–E) Representative trajectories of myosin VI‐decorated nanostructures on the keratocyte‐derived actin network labeled with (C) one, (D) two, or (E) six nanobody adaptors at 2 m M ATP. (F) Mean run length as a function of nanostructure binding sites. Error bars represent ± SEM ( n > 800 trajectories).

    Journal: Protein Science : A Publication of the Protein Society

    Article Title: Patterning protein complexes on DNA nanostructures using a GFP nanobody

    doi: 10.1002/pro.3020

    Figure Lengend Snippet: Mechanochemical measurement of GFP‐tagged myosin VI on nanostructures. (A) Schematic of myosin VI‐labeled flat rectangular DNA origami nanostructures interacting with a keratocyte‐derived actin network. (B) Representative detergent‐extracted keratocyte actin network with Alexa488‐phalloidin labeled actin (red) and nanobody‐labeled DNA nanostructures (green). (C–E) Representative trajectories of myosin VI‐decorated nanostructures on the keratocyte‐derived actin network labeled with (C) one, (D) two, or (E) six nanobody adaptors at 2 m M ATP. (F) Mean run length as a function of nanostructure binding sites. Error bars represent ± SEM ( n > 800 trajectories).

    Article Snippet: The DNA sequence for the GFP‐nanobody was generated and synthesized by Genewiz off of the previously published “enhancer” GFP‐nanobody sequence., The SNAP‐tagged nanobody construct contained from N‐ to C‐terminus: the GFP‐nanobody, a flexible (Gly‐Ser‐Gly)2 linker, the SNAP‐tag for oligo labeling, and both FLAG and 6xHis purification tags.

    Techniques: Labeling, Derivative Assay, Binding Assay

    The bbb22 gene alone is not sufficient to maintain wild-type levels of spirochete loads in infected mouse tissues. DNA was isolated from ear, heart, and joint tissues of C3H/HeN mice inoculated with 1 × 10 4 bbb22-23 + or 22dist p -bbb22 + spirochetes.

    Journal: Infection and Immunity

    Article Title: Molecular Dissection of a Borrelia burgdorferiIn Vivo Essential Purine Transport System

    doi: 10.1128/IAI.02859-14

    Figure Lengend Snippet: The bbb22 gene alone is not sufficient to maintain wild-type levels of spirochete loads in infected mouse tissues. DNA was isolated from ear, heart, and joint tissues of C3H/HeN mice inoculated with 1 × 10 4 bbb22-23 + or 22dist p -bbb22 + spirochetes.

    Article Snippet: Plasmids pBSV2G 22dist p - bbb22 + and pBSV2G 22prox p - bbb22 + were confirmed by restriction digestion and DNA sequence analysis (Genewiz).

    Techniques: Infection, Isolation, Mouse Assay

    In vitro DNA cleavage by Cas9 effector complex. (A) Schematic of DNA/Cas9/sgRNA system. Cas9 is presented by the gray lobe, and the 20-nt guide segment of the sgRNA is shown in red . The DNA target strand is shown in blue , the nontarget strand is in black , and the 20-nt protospacer is underlined . The PAM is highlighted in yellow . The cleavage sites are marked by solid wedges . (B) Cleavage of duplex VEGF DNA monitored by 5’- 32 P labels on both strands. The Cas9/RNA used was 10 nM, and the DNA duplex was 1 nM. Asterisks show the two cleaved bands at the expected locations (37 nt and 23 nt) along the length of the gel in lane 3.

    Journal: Translational Vision Science & Technology

    Article Title: Reduced Expression of VEGF-A in Human Retinal Pigment Epithelial Cells and Human Muller Cells Following CRISPR-Cas9 Ribonucleoprotein-Mediated Gene Disruption

    doi: 10.1167/tvst.9.8.23

    Figure Lengend Snippet: In vitro DNA cleavage by Cas9 effector complex. (A) Schematic of DNA/Cas9/sgRNA system. Cas9 is presented by the gray lobe, and the 20-nt guide segment of the sgRNA is shown in red . The DNA target strand is shown in blue , the nontarget strand is in black , and the 20-nt protospacer is underlined . The PAM is highlighted in yellow . The cleavage sites are marked by solid wedges . (B) Cleavage of duplex VEGF DNA monitored by 5’- 32 P labels on both strands. The Cas9/RNA used was 10 nM, and the DNA duplex was 1 nM. Asterisks show the two cleaved bands at the expected locations (37 nt and 23 nt) along the length of the gel in lane 3.

    Article Snippet: DNA SequencingTo assess the effects of the CRISPR-Cas9 gene editing on the DNA sequence, a Sanger sequencing assay of a 284 base pair (bp) amplicon flanking the target area on the VEGF-A gene was performed by Genewiz (South Plainfield, NJ).

    Techniques: In Vitro

    Visualizing the genotype and phenotype of Arabidopsis seedlings. (A) Images of A. thaliana leaves under blue light. Strain numbers are the same as in Figure 1B . (B) Agarose gel electrophoresis of PCR amplicons. The top half shows products of GFP amplification [772 bp with mPing present and 339 bp after mPing excision (lane 6 only)] and the bottom half shows the PCR amplicons for ORF1 (239 bp) and Tpase (435 bp). M: 1-kb Plus O’Gene Ruler (Fermentas). Low molecular weight bands (

    Journal: Genetics

    Article Title: Transposing from the Laboratory to the Classroom to Generate Authentic Research Experiences for Undergraduates

    doi: 10.1534/genetics.112.147355

    Figure Lengend Snippet: Visualizing the genotype and phenotype of Arabidopsis seedlings. (A) Images of A. thaliana leaves under blue light. Strain numbers are the same as in Figure 1B . (B) Agarose gel electrophoresis of PCR amplicons. The top half shows products of GFP amplification [772 bp with mPing present and 339 bp after mPing excision (lane 6 only)] and the bottom half shows the PCR amplicons for ORF1 (239 bp) and Tpase (435 bp). M: 1-kb Plus O’Gene Ruler (Fermentas). Low molecular weight bands (

    Article Snippet: DNA sequencing PCR amplicons were sequenced directly (by Genewiz, www.genewiz.com ) after purification by treatment with ExoSAP-IT exonuclease and shrimp alkaline phosphatase (Affymetrix/USB Molecular, Santa Clara, CA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Molecular Weight

    TE polymorphism in two maize introns. Agarose gels showing PCR amplicons from 36 maize strains for locus 169020. The strain names are shown above the lanes with the 36 reactions divided across three gels. The negative control for the group of reactions is shown in the last lane. The amplicon containing the TE is 666 bp while the band lacking it is 495 bp.

    Journal: Genetics

    Article Title: Transposing from the Laboratory to the Classroom to Generate Authentic Research Experiences for Undergraduates

    doi: 10.1534/genetics.112.147355

    Figure Lengend Snippet: TE polymorphism in two maize introns. Agarose gels showing PCR amplicons from 36 maize strains for locus 169020. The strain names are shown above the lanes with the 36 reactions divided across three gels. The negative control for the group of reactions is shown in the last lane. The amplicon containing the TE is 666 bp while the band lacking it is 495 bp.

    Article Snippet: DNA sequencing PCR amplicons were sequenced directly (by Genewiz, www.genewiz.com ) after purification by treatment with ExoSAP-IT exonuclease and shrimp alkaline phosphatase (Affymetrix/USB Molecular, Santa Clara, CA).

    Techniques: Polymerase Chain Reaction, Negative Control, Amplification