Structured Review

SolGent dna polymerase
Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. <t>Amplicons</t> have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic <t>DNA</t> of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.
Dna Polymerase, supplied by SolGent, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/SolGent
Average 92 stars, based on 11 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-04
92/100 stars

Images

1) Product Images from "Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)"

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)

Journal: Frontiers in Genetics

doi: 10.3389/fgene.2017.00097

Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. Amplicons have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic DNA of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.
Figure Legend Snippet: Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. Amplicons have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic DNA of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.

Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification, Methylation, Synthesized, In Vitro, Multiplex Assay, Modification, Standard Deviation

2) Product Images from "Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing"

Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing

Journal: Genomics & Informatics

doi: 10.5808/GI.2015.13.3.81

Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').
Figure Legend Snippet: Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').

Techniques Used: Transgenic Assay, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Amplification

3) Product Images from "Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes"

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes

Journal: Journal of Ginseng Research

doi: 10.5142/jgr.2011.35.4.504

Amplification products of five ginseng cultivars (Korea) by sequence-tagged site-polymerase chain reaction. The monomorphic bands were amplified with (A) UFGp74 and (B) MFGp110A, and in-del polymorphisms were detected with (C) MFGp130 among five ginseng cultivars, respectively. Lane 1, Chunpoong; lane 2, Yunpoong; lane 3, Gopoong; lane 4, Kumpoong; lane 5, Sunpoong; M, size marker (2log DNA ladder; New England Biolabs).
Figure Legend Snippet: Amplification products of five ginseng cultivars (Korea) by sequence-tagged site-polymerase chain reaction. The monomorphic bands were amplified with (A) UFGp74 and (B) MFGp110A, and in-del polymorphisms were detected with (C) MFGp130 among five ginseng cultivars, respectively. Lane 1, Chunpoong; lane 2, Yunpoong; lane 3, Gopoong; lane 4, Kumpoong; lane 5, Sunpoong; M, size marker (2log DNA ladder; New England Biolabs).

Techniques Used: Amplification, Sequencing, Polymerase Chain Reaction, Marker

Related Articles

Clone Assay:

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: STS primer sets UFGp74, MFGp110A and MFGp130A were designed using Primer3 based on sequence information from gDNA library clones of P. ginseng cv. .. PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol.

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The respective PCR products were cloned into the pENTR/D-TOPO vector (Invitrogen, Carlsbad, CA, U.S.A.) and recombined into the p2FGW7 vector for N-terminal GFP fusion and the p2GWF7 vector for C-terminal GFP fusion with LR clonase (Invitrogen) .

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. The PCR products were cloned into the pENTR/ d -TOPO vector (Invitrogen) and sequenced.

Amplification:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: .. First, the poly-C tracts of mtDNA were amplified in a 50-µL reaction mixture containing 50 ng of total DNA, 20 pmol of each component of primer pair, 0.4 mM of each dNTP, 5 U of DNA polymerase (Solgent), 5 µL of 10× buffer, and distilled water (DW). .. After the completion of PCR, 1 µL of each PCR product and 0.5 µL of the gene scan internal size standard, labeled with the fluorescent dye ROX (Applied Biosystems), were added to 20 µL of deionized formamide.

Article Title: Association Study between Norepinephrine Transporter Gene Polymorphism and Schizophrenia in a Korean Population
Article Snippet: .. In brief, the amplification mixture contained 0.5 µL of 100 ng/µL DNA, 2.5 µL of 10x buffer, 0.5 µL of 10mM dNTP mixture, 1 µL primer, 19.375 µL distilled water, and 0.125 µL DNA polymerase (Solgent, Korea). ..

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: .. 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ). .. Every intermittent purification was conducted using ExpinTM PCR SV purification kit (GeneAll).

Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing
Article Snippet: PCR was conducted using DNA polymerase (Solgent Co., Daejeon, Korea) following the manufacturer's instructions. .. The reaction was performed under the following conditions: a pre-denaturation step at 95℃ for 5 min; denaturation at 95℃ for 60 s; 30 amplification cycles, including annealing at 60℃ for 45 s, and elongation at 72℃ for 120 s; and a final elongation at 72℃ for 5 min.

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: .. Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The primer pairs used for PCR amplification were: 5′-CACCATGGGGAGCACGGGGCGCGACG-3′ as forward primer and 5′- CTAGTTCATGTCAGCTTTGTTC-3′ for N-terminal GFP fusion or 5′- GTTCATGTCAGCTTTGTTCTC-3′ for C-terminal fusion as reverse primer, respectively.

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: .. The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. The PCR products were cloned into the pENTR/ d -TOPO vector (Invitrogen) and sequenced.

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: .. Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. PCR products were inserted into the pENTR/D-TOPO vector (Invitrogen) and sequenced.

Synthesized:

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: The STS primers synthesized by Bioneer (Daejeon, Korea) and the sequences of the STS primers are listed in . .. PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol.

Construct:

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The resulting constructs, GFP-Os1BGlu4 and Os1BGlu4-GFP , were introduced into maize mesophyll protoplasts by polyethylene glycol-mediated transformation .

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. Validated insert was subcloned into the transient expression vector p2GWF7 and the binary expression vector pH7FWG2 for C-terminal GFP fusion constructs by LR clonase (Invitrogen) reaction ( ).

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. The resulting GFPOsSUS fusion constructs driven by the CaMV35S promoter were delivered into maize mesophyll protoplasts using a polyethylene glycol (PEG)-calcium mediated method followed by 12-24 h incubation to allow transient expression ; .

Electrophoresis:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: First, the poly-C tracts of mtDNA were amplified in a 50-µL reaction mixture containing 50 ng of total DNA, 20 pmol of each component of primer pair, 0.4 mM of each dNTP, 5 U of DNA polymerase (Solgent), 5 µL of 10× buffer, and distilled water (DW). .. Denatured PCR products were separated by capillary electrophoresis (CE) by using the ABI Prism 3130 Genetic Analyzer and Gene Scan Analysis Software (version 3.1) (Applied Biosystems).

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol. .. Amplification products were analyzed by electrophoresis on 1.5 % agarose gel in TBE buffer (45 mM Tris-HCl, pH 8.0, 45 mM Boric acid, 1 mM EDTA).

Incubation:

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. The resulting GFPOsSUS fusion constructs driven by the CaMV35S promoter were delivered into maize mesophyll protoplasts using a polyethylene glycol (PEG)-calcium mediated method followed by 12-24 h incubation to allow transient expression ; .

Expressing:

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. Validated insert was subcloned into the transient expression vector p2GWF7 and the binary expression vector pH7FWG2 for C-terminal GFP fusion constructs by LR clonase (Invitrogen) reaction ( ).

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. The resulting GFPOsSUS fusion constructs driven by the CaMV35S promoter were delivered into maize mesophyll protoplasts using a polyethylene glycol (PEG)-calcium mediated method followed by 12-24 h incubation to allow transient expression ; .

Transformation Assay:

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The resulting constructs, GFP-Os1BGlu4 and Os1BGlu4-GFP , were introduced into maize mesophyll protoplasts by polyethylene glycol-mediated transformation .

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. The resulting Os9BGlu31-GFP fusion was placed under the control of the CaMV35S promoter and introduced into maize mesophyll protoplasts by polyethylene glycol-mediated transformation ( ).

Flow Cytometry:

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ). .. The equal amount of barcoded libraries were pooled, and they were applied to a parallel deep sequencing in a single flow cell using Illumina Hi-seq 2500.

Ligation:

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: For sequencing library construction, we performed a series of enzymatic reactions such as 5′-end phosphorylation, adaptor ligation, and additional cycles of PCR to attach barcode and other modules. .. 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ).

Polymerase Chain Reaction:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: .. PCR mixtures consisted of 50-100 ng of total DNA, 20 pmol of forward and 20 pmol of reverse primer, 0.4 mM of the deoxynucleoside triphosphates (dNTPs), 5 µL of the 10× F-taq reaction buffer, 5 U of DNA polymerase (Solgent, Daejeon, Korea), and H2 O (final reaction volume of 50 µL). .. PCR was carried out in a TAKARA PCR thermal cycler (TAKARA, Shiga, Japan).

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: First, the poly-C tracts of mtDNA were amplified in a 50-µL reaction mixture containing 50 ng of total DNA, 20 pmol of each component of primer pair, 0.4 mM of each dNTP, 5 U of DNA polymerase (Solgent), 5 µL of 10× buffer, and distilled water (DW). .. After the completion of PCR, 1 µL of each PCR product and 0.5 µL of the gene scan internal size standard, labeled with the fluorescent dye ROX (Applied Biosystems), were added to 20 µL of deionized formamide.

Article Title: Association Study between Norepinephrine Transporter Gene Polymorphism and Schizophrenia in a Korean Population
Article Snippet: The NET T182C SNP was genotyped by the polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) methods according to the protocol originally described by Inoue et al. .. In brief, the amplification mixture contained 0.5 µL of 100 ng/µL DNA, 2.5 µL of 10x buffer, 0.5 µL of 10mM dNTP mixture, 1 µL primer, 19.375 µL distilled water, and 0.125 µL DNA polymerase (Solgent, Korea).

Article Title: Identification of Novel Functional Variants of SIN3A and SRSF1 among Somatic Variants in Acute Myeloid Leukemia Patients
Article Snippet: .. PCR was performed using DNA polymerase (SolGent, Korea) under optimized thermal conditions. .. The PCR products were evaluated in 2% agarose gels, purified and sequenced in both directions using BigDyeR Terminator (Applied Biosystems) reactions and subsequently loaded into a capillary sequencer.

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: For sequencing library construction, we performed a series of enzymatic reactions such as 5′-end phosphorylation, adaptor ligation, and additional cycles of PCR to attach barcode and other modules. .. 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ).

Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing
Article Snippet: .. PCR was conducted using DNA polymerase (Solgent Co., Daejeon, Korea) following the manufacturer's instructions. .. The reaction was performed under the following conditions: a pre-denaturation step at 95℃ for 5 min; denaturation at 95℃ for 60 s; 30 amplification cycles, including annealing at 60℃ for 45 s, and elongation at 72℃ for 120 s; and a final elongation at 72℃ for 5 min.

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: .. Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The primer pairs used for PCR amplification were: 5′-CACCATGGGGAGCACGGGGCGCGACG-3′ as forward primer and 5′- CTAGTTCATGTCAGCTTTGTTC-3′ for N-terminal GFP fusion or 5′- GTTCATGTCAGCTTTGTTCTC-3′ for C-terminal fusion as reverse primer, respectively.

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: .. The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. The PCR products were cloned into the pENTR/ d -TOPO vector (Invitrogen) and sequenced.

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: .. Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. PCR products were inserted into the pENTR/D-TOPO vector (Invitrogen) and sequenced.

Sequencing:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: Paragraph title: 4. Direct sequencing of the mtDNA control, the tRNA leucine 1 , and the cytochrome b regions ... PCR mixtures consisted of 50-100 ng of total DNA, 20 pmol of forward and 20 pmol of reverse primer, 0.4 mM of the deoxynucleoside triphosphates (dNTPs), 5 µL of the 10× F-taq reaction buffer, 5 U of DNA polymerase (Solgent, Daejeon, Korea), and H2 O (final reaction volume of 50 µL).

Article Title: Identification of Novel Functional Variants of SIN3A and SRSF1 among Somatic Variants in Acute Myeloid Leukemia Patients
Article Snippet: Paragraph title: Sanger sequencing ... PCR was performed using DNA polymerase (SolGent, Korea) under optimized thermal conditions.

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: Paragraph title: Library Construction for Illumina Sequencing ... 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ).

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: Paragraph title: Polymerase chain reaction analysis by sequence-tagged site markers ... PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol.

Methylation:

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: Colony PCR was carried out on randomly selected 1099 from the methylation filtered library, to select clones between 0.8 and 1.5 kb as their estimated inserts size, and those clones were then subjected for sequence analysis. .. PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol.

Labeling:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: Each forward primer was labeled with HEX fluorescent dye (See ). .. First, the poly-C tracts of mtDNA were amplified in a 50-µL reaction mixture containing 50 ng of total DNA, 20 pmol of each component of primer pair, 0.4 mM of each dNTP, 5 U of DNA polymerase (Solgent), 5 µL of 10× buffer, and distilled water (DW).

Purification:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: PCR mixtures consisted of 50-100 ng of total DNA, 20 pmol of forward and 20 pmol of reverse primer, 0.4 mM of the deoxynucleoside triphosphates (dNTPs), 5 µL of the 10× F-taq reaction buffer, 5 U of DNA polymerase (Solgent, Daejeon, Korea), and H2 O (final reaction volume of 50 µL). .. PCR products were purified by using the Expin PCR SV kit (GeneAll, Seoul, Korea).

Article Title: Identification of Novel Functional Variants of SIN3A and SRSF1 among Somatic Variants in Acute Myeloid Leukemia Patients
Article Snippet: PCR was performed using DNA polymerase (SolGent, Korea) under optimized thermal conditions. .. The PCR products were evaluated in 2% agarose gels, purified and sequenced in both directions using BigDyeR Terminator (Applied Biosystems) reactions and subsequently loaded into a capillary sequencer.

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ). .. Every intermittent purification was conducted using ExpinTM PCR SV purification kit (GeneAll).

Transgenic Assay:

Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing
Article Snippet: Paragraph title: Experimental validation of transgenic inserts ... PCR was conducted using DNA polymerase (Solgent Co., Daejeon, Korea) following the manufacturer's instructions.

Plasmid Preparation:

Article Title: Recombinant Expression and Characterization of the Cytoplasmic Rice ?-Glucosidase Os1BGlu4
Article Snippet: Subcellular localization To examine the subcellular localization of Os1BGlu4, the entire open reading frames with or without the stop codon were amplified by PCR using a proofreading DNA polymerase (SolGent, Daejeon, Korea). .. The respective PCR products were cloned into the pENTR/D-TOPO vector (Invitrogen, Carlsbad, CA, U.S.A.) and recombined into the p2FGW7 vector for N-terminal GFP fusion and the p2GWF7 vector for C-terminal GFP fusion with LR clonase (Invitrogen) .

Article Title: Rice Os9BGlu31 Is a Transglucosidase with the Capacity to Equilibrate Phenylpropanoid, Flavonoid, and Phytohormone Glycoconjugates *
Article Snippet: The Os9BGlu31 gene was amplified by PCR with proofreading DNA polymerase (SolGent, Daejeon, Korea) and the BGlu31SL-f and BGlu31SL-r primers ( ). .. The PCR products were cloned into the pENTR/ d -TOPO vector (Invitrogen) and sequenced.

Article Title: Identification and Characterization of the Duplicate Rice Sucrose Synthase Genes OsSUS5 and OsSUS7 Which Are Associated with the Plasma Membrane
Article Snippet: Full-length cDNAs of the OsSUS genes were amplified by PCR using proofreading DNA polymerase (SolGent, Korea) and the appropriate primer pairs (Supplementary Table 1). .. PCR products were inserted into the pENTR/D-TOPO vector (Invitrogen) and sequenced.

Software:

Article Title: Clinicopathological Implications of Mitochondrial Genome Alterations in Pediatric Acute Myeloid Leukemia
Article Snippet: First, the poly-C tracts of mtDNA were amplified in a 50-µL reaction mixture containing 50 ng of total DNA, 20 pmol of each component of primer pair, 0.4 mM of each dNTP, 5 U of DNA polymerase (Solgent), 5 µL of 10× buffer, and distilled water (DW). .. Denatured PCR products were separated by capillary electrophoresis (CE) by using the ABI Prism 3130 Genetic Analyzer and Gene Scan Analysis Software (version 3.1) (Applied Biosystems).

Article Title: Identification of Novel Functional Variants of SIN3A and SRSF1 among Somatic Variants in Acute Myeloid Leukemia Patients
Article Snippet: Oligo primers were designed using Primer3 software ( ) to amplify the genome fragments containing the mutations from bone marrow samples. .. PCR was performed using DNA polymerase (SolGent, Korea) under optimized thermal conditions.

Multiplex Assay:

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: Library Construction for Illumina Sequencing Entire amplicons obtained from eight rounds of multiplex PCR were pooled together in equal volumes. .. 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ).

Agarose Gel Electrophoresis:

Article Title: Association Study between Norepinephrine Transporter Gene Polymorphism and Schizophrenia in a Korean Population
Article Snippet: In brief, the amplification mixture contained 0.5 µL of 100 ng/µL DNA, 2.5 µL of 10x buffer, 0.5 µL of 10mM dNTP mixture, 1 µL primer, 19.375 µL distilled water, and 0.125 µL DNA polymerase (Solgent, Korea). .. The amplified DNA was digested with the restriction enzyme StyI (New England Biolabs), which cuts at the -182C site, and the product was electrophoresed in 3% agarose gel and stained with ethidium bromide.

Article Title: Rapid Identification of Ginseng Cultivars (Panax ginseng Meyer) Using Novel SNP-Based Probes
Article Snippet: PCR amplification was performed using the following mixture: 50 ng of genomic DNA, 20 pmole of each primer, 200 uM dNTPs, 0.5 U DNA polymerase (5 U/L uL), 1X PCR buffer (Solgent, Daejeon, Korea); giving a 25 uL reaction mixture according to the manufacturer’s protocol. .. Amplification products were analyzed by electrophoresis on 1.5 % agarose gel in TBE buffer (45 mM Tris-HCl, pH 8.0, 45 mM Boric acid, 1 mM EDTA).

Activation Assay:

Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)
Article Snippet: .. 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ). .. Every intermittent purification was conducted using ExpinTM PCR SV purification kit (GeneAll).

DNA Purification:

Article Title: Association Study between Norepinephrine Transporter Gene Polymorphism and Schizophrenia in a Korean Population
Article Snippet: Genomic DNA was extracted from leukocytes using a commercial DNA extract kit, the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). .. In brief, the amplification mixture contained 0.5 µL of 100 ng/µL DNA, 2.5 µL of 10x buffer, 0.5 µL of 10mM dNTP mixture, 1 µL primer, 19.375 µL distilled water, and 0.125 µL DNA polymerase (Solgent, Korea).

Staining:

Article Title: Association Study between Norepinephrine Transporter Gene Polymorphism and Schizophrenia in a Korean Population
Article Snippet: In brief, the amplification mixture contained 0.5 µL of 100 ng/µL DNA, 2.5 µL of 10x buffer, 0.5 µL of 10mM dNTP mixture, 1 µL primer, 19.375 µL distilled water, and 0.125 µL DNA polymerase (Solgent, Korea). .. The amplified DNA was digested with the restriction enzyme StyI (New England Biolabs), which cuts at the -182C site, and the product was electrophoresed in 3% agarose gel and stained with ethidium bromide.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    SolGent dna polymerase
    Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. <t>Amplicons</t> have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic <t>DNA</t> of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.
    Dna Polymerase, supplied by SolGent, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/SolGent
    Average 92 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    98
    SolGent h taq dna polymerase
    Identification of CpG sites specifically methylated in colon cancer cell lines. (A) Heat map of the methylation levels of target CpGs. Target CpGs that are differentially methylated among the cell lines are indicated by green boxes with the associated gene symbols. Methylation levels of the LIFR and MLH1 (B) and HOXA11 and AXIN2 (D) CpG sites in colon cancer cell lines. Chromosomal locations of target CpG sites are represented as the chromosome (chr) number and coordinate of the position of cytosine. Cell lines of different cancer groups are indicated in different colors below: biliary tract, colon, liver, lung, and stomach cancer cell lines are yellow, blue, dark red, green, and black, respectively. Brackets (red) denote colon cancer cell lines showing differential methylation patterns. (C,E) Combined bisulfite restriction analysis (COBRA). Schematics show the relative positions of the transcription start sites (TSSs) of target genes and the restriction enzyme ( <t>Taq</t> I or Bst UI) site. Genomic <t>DNA</t> was treated with bisulfite to convert unmethylated cytosines to uracils, which are then amplified as thymines, and then used as a template in PCR. The PCR products were digested with the indicated restriction enzyme. If the region of interest were methylated, the PCR product would be digested. In (E) , only colon cancer cell lines were included, and HOXA11 promoter-methylated cell lines are indicated by asterisks. Arrow heads and arrows indicate the band positions of intact and enzyme-digested PCR products, respectively.
    H Taq Dna Polymerase, supplied by SolGent, used in various techniques. Bioz Stars score: 98/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/h taq dna polymerase/product/SolGent
    Average 98 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    h taq dna polymerase - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    Image Search Results


    Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. Amplicons have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic DNA of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.

    Journal: Frontiers in Genetics

    Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)

    doi: 10.3389/fgene.2017.00097

    Figure Lengend Snippet: Evaluation of the targeted bisulfite PCR sequencing (TBPseq) method. (A) Illustration of TBPseq method. Colored horizontal arrows denote primers for target amplification. Amplicons have methylated (5′-CG-3′) or unmethylated (5′-TG-3′) sequences for target CpGs, the ratio of which is used for calculating methylation frequencies of the target CpGs. A total of 113 primer pairs were split into six groups of about 20 pairs for separate multiplexed PCR. (B) Strategy for evaluating the TBPseq method. The whole genomic DNA of 293T cells was amplified using ϕ29 DNA polymerase. A half of the resulting newly synthesized and unmodified (demethylated) DNA was re-methylated in vitro using CpG dinucleotide-specific Sss I methylase. The remethylated and demethylated DNA fractions were equally treated with bisulfite and used as template in multiplex PCR with 20–25 primer pairs per reaction. Multiplex PCR was additionally performed with an equal mixture (1:1 mixed DNA) of the remethylated and demethylated DNA templates. The three different groups of amplicons were modified and differentially barcoded for Illumina sequencing. (C) Methylation levels of target CpG sites. Each CpG site has three different methylation levels that were obtained from demethylated DNA (ϕ29 only, blue), remethylated DNA (ϕ29 + SssI, red), and an equal mixture of them (purple). In the right panel, the mean methylation levels of target CPGs in the three DNA groups are shown (error bars, standard deviation). Individual CpG sites are indicated by their genomic position as “chromosome (chr) number:coordinate” using GRCh37/hg19 as reference genome.

    Article Snippet: 5′-end phosphorylation was performed with 1 μg of pooled amplicons using T4 polynucleotide kinase (NEB) at 37°C for 30 min. 5′-end phosphorylated amplicons then were ligated with 15 μM of home-made Illumina adaptors by incubating them at RT for 1 h. Finally, adaptor ligated amplicons were amplified using index and universal primers by DNA polymerase (SolGent) for indexing in the following conditions: 15 min of enzyme activation at 98°C followed by 25 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s ( ).

    Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Methylation, Synthesized, In Vitro, Multiplex Assay, Modification, Standard Deviation

    Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').

    Journal: Genomics & Informatics

    Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing

    doi: 10.5808/GI.2015.13.3.81

    Figure Lengend Snippet: Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').

    Article Snippet: PCR was conducted using DNA polymerase (Solgent Co., Daejeon, Korea) following the manufacturer's instructions.

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Amplification

    Identification of CpG sites specifically methylated in colon cancer cell lines. (A) Heat map of the methylation levels of target CpGs. Target CpGs that are differentially methylated among the cell lines are indicated by green boxes with the associated gene symbols. Methylation levels of the LIFR and MLH1 (B) and HOXA11 and AXIN2 (D) CpG sites in colon cancer cell lines. Chromosomal locations of target CpG sites are represented as the chromosome (chr) number and coordinate of the position of cytosine. Cell lines of different cancer groups are indicated in different colors below: biliary tract, colon, liver, lung, and stomach cancer cell lines are yellow, blue, dark red, green, and black, respectively. Brackets (red) denote colon cancer cell lines showing differential methylation patterns. (C,E) Combined bisulfite restriction analysis (COBRA). Schematics show the relative positions of the transcription start sites (TSSs) of target genes and the restriction enzyme ( Taq I or Bst UI) site. Genomic DNA was treated with bisulfite to convert unmethylated cytosines to uracils, which are then amplified as thymines, and then used as a template in PCR. The PCR products were digested with the indicated restriction enzyme. If the region of interest were methylated, the PCR product would be digested. In (E) , only colon cancer cell lines were included, and HOXA11 promoter-methylated cell lines are indicated by asterisks. Arrow heads and arrows indicate the band positions of intact and enzyme-digested PCR products, respectively.

    Journal: Frontiers in Genetics

    Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)

    doi: 10.3389/fgene.2017.00097

    Figure Lengend Snippet: Identification of CpG sites specifically methylated in colon cancer cell lines. (A) Heat map of the methylation levels of target CpGs. Target CpGs that are differentially methylated among the cell lines are indicated by green boxes with the associated gene symbols. Methylation levels of the LIFR and MLH1 (B) and HOXA11 and AXIN2 (D) CpG sites in colon cancer cell lines. Chromosomal locations of target CpG sites are represented as the chromosome (chr) number and coordinate of the position of cytosine. Cell lines of different cancer groups are indicated in different colors below: biliary tract, colon, liver, lung, and stomach cancer cell lines are yellow, blue, dark red, green, and black, respectively. Brackets (red) denote colon cancer cell lines showing differential methylation patterns. (C,E) Combined bisulfite restriction analysis (COBRA). Schematics show the relative positions of the transcription start sites (TSSs) of target genes and the restriction enzyme ( Taq I or Bst UI) site. Genomic DNA was treated with bisulfite to convert unmethylated cytosines to uracils, which are then amplified as thymines, and then used as a template in PCR. The PCR products were digested with the indicated restriction enzyme. If the region of interest were methylated, the PCR product would be digested. In (E) , only colon cancer cell lines were included, and HOXA11 promoter-methylated cell lines are indicated by asterisks. Arrow heads and arrows indicate the band positions of intact and enzyme-digested PCR products, respectively.

    Article Snippet: PCR was performed with h-taq DNA polymerase (SolGent) in the following conditions: 15 min of enzyme activation at 95°C followed by 40 cycles of 95°C for 20 s, 55°C for 30 s, and 65°C for 1 min.

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Amplification, Polymerase Chain Reaction

    Validation of the LIFR promoter methylation for cancer specificity and its relationship with the expression of associated genes. (A) DNA methylation levels of target CpGs in public cancer methylome data (Infinium 450K BeadChip array) of four cancer types: colorectal ( n = 313 for cancer samples and n = 38 for normal samples), liver (377 and 50), lung (843 and 74), and stomach (395 and 2) cancers. Infinium CpG identification numbers (IDs) together with the associated gene names are shown; the Infinium IDs cg03723506 and cg11291081 indicate chr5:38557143 and chr3:37033894, respectively, in the Figure 3B . Statistical significance was calculated using Wilcoxon rank sum test. T: tumor samples, N: normal samples. (B) Schematic drawing of COBRA region at the LIFR promoter. Blue arrows, primers. CGI, CpG island (green line). (C) COBRA analysis. Genomic DNA was extracted from each colon cancer cell lines along with a normal control colon cell line (CCD-18co) and subjected to COBRA using the Taq I enzyme to examine the methylation state at the LIFR gene promoter. Arrowhead and arrow indicate the positions of intact and Taq I-digested DNA fragments, respectively. The fraction (% meth) of methylated DNA was measured by band intensity analysis and noted under each cell line. (D) RT-PCR. The same cancer cell lines used in COBRA (C) were subjected to RT-PCR to measure the transcript levels of the LIFR and LIFR-AS genes.

    Journal: Frontiers in Genetics

    Article Title: Simultaneous Methylation-Level Assessment of Hundreds of CpG Sites by Targeted Bisulfite PCR Sequencing (TBPseq)

    doi: 10.3389/fgene.2017.00097

    Figure Lengend Snippet: Validation of the LIFR promoter methylation for cancer specificity and its relationship with the expression of associated genes. (A) DNA methylation levels of target CpGs in public cancer methylome data (Infinium 450K BeadChip array) of four cancer types: colorectal ( n = 313 for cancer samples and n = 38 for normal samples), liver (377 and 50), lung (843 and 74), and stomach (395 and 2) cancers. Infinium CpG identification numbers (IDs) together with the associated gene names are shown; the Infinium IDs cg03723506 and cg11291081 indicate chr5:38557143 and chr3:37033894, respectively, in the Figure 3B . Statistical significance was calculated using Wilcoxon rank sum test. T: tumor samples, N: normal samples. (B) Schematic drawing of COBRA region at the LIFR promoter. Blue arrows, primers. CGI, CpG island (green line). (C) COBRA analysis. Genomic DNA was extracted from each colon cancer cell lines along with a normal control colon cell line (CCD-18co) and subjected to COBRA using the Taq I enzyme to examine the methylation state at the LIFR gene promoter. Arrowhead and arrow indicate the positions of intact and Taq I-digested DNA fragments, respectively. The fraction (% meth) of methylated DNA was measured by band intensity analysis and noted under each cell line. (D) RT-PCR. The same cancer cell lines used in COBRA (C) were subjected to RT-PCR to measure the transcript levels of the LIFR and LIFR-AS genes.

    Article Snippet: PCR was performed with h-taq DNA polymerase (SolGent) in the following conditions: 15 min of enzyme activation at 95°C followed by 40 cycles of 95°C for 20 s, 55°C for 30 s, and 65°C for 1 min.

    Techniques: Methylation, Expressing, DNA Methylation Assay, Combined Bisulfite Restriction Analysis Assay, Reverse Transcription Polymerase Chain Reaction