Structured Review

Roche dna polymerase
Antigenic region of the VacA gene from Helicobacter pylori amplified by <t>PCR.</t> Lane 1: <t>DNA</t> marker, Lane 2: PCR product
Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/Roche
Average 99 stars, based on 112 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori"

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori

Journal: Iranian Journal of Basic Medical Sciences

doi:

Antigenic region of the VacA gene from Helicobacter pylori amplified by PCR. Lane 1: DNA marker, Lane 2: PCR product
Figure Legend Snippet: Antigenic region of the VacA gene from Helicobacter pylori amplified by PCR. Lane 1: DNA marker, Lane 2: PCR product

Techniques Used: Amplification, Polymerase Chain Reaction, Marker

2) Product Images from "The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]"

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]

Journal: Plant Physiology

doi: 10.1104/pp.104.057216

Isolation of two homozygous T-DNA insertion mutants in the AtHAK5 gene. A, The cartoon shows the positions of the two T-DNA insertion lines, which were verified by sequencing of the left border PCR products. B, RT-PCR using cDNA from roots of wild-type
Figure Legend Snippet: Isolation of two homozygous T-DNA insertion mutants in the AtHAK5 gene. A, The cartoon shows the positions of the two T-DNA insertion lines, which were verified by sequencing of the left border PCR products. B, RT-PCR using cDNA from roots of wild-type

Techniques Used: Isolation, Sequencing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

3) Product Images from "Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization"

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization

Journal: The Plant Pathology Journal

doi: 10.5423/PPJ.NT.05.2016.0132

Schematic flow of the diagnostic method developed in this study for latent infection of strawberry anthracnose fungi. The diagnostic steps consist of 4 steps, initial culturing of candidate fungi (Step 1), DNA extraction from fungal hyphae (Step 2), synthesis of PCR-amplified probes (Step 3), and microtube hybridization (MTH) and colorimetric detection (Step 4). The experimental details are described in the text.
Figure Legend Snippet: Schematic flow of the diagnostic method developed in this study for latent infection of strawberry anthracnose fungi. The diagnostic steps consist of 4 steps, initial culturing of candidate fungi (Step 1), DNA extraction from fungal hyphae (Step 2), synthesis of PCR-amplified probes (Step 3), and microtube hybridization (MTH) and colorimetric detection (Step 4). The experimental details are described in the text.

Techniques Used: Flow Cytometry, Diagnostic Assay, Infection, DNA Extraction, Polymerase Chain Reaction, Amplification, Hybridization

4) Product Images from "p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts"

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts

Journal: PLoS ONE

doi: 10.1371/journal.pone.0066892

AP-1 binds directly to the PAK3 promoter at (+52/+60) both in vivo and in vitro . A: Electrophoretic Mobility Shift Assay (EMSA) showing protein binding to the (+52/+60) PAK3 promoter region. Lane 1 shows the presence of a DNA/protein complex when the (+52/+60) PAK3 promoter radioactively-labelled oligomer was incubated with protein cell lysate of Rat1a-J4 cells treated with doxycycline. This DNA/protein complex could be competed for with unlabelled (+52/+60) wild-type (WT) oligomers (lane 2), but not with a mutated (+52/+60) sequence oligomer (lane 3). The second panel shows supershifted complexes using anti-cJun (lane 4), -JunB (lane 5) and –JunD (lane 6) antibodies. B: Chromatin Immunoprecipitation Assay (ChIP) showing cJun binding to the (+52/+60) PAK3 promoter region. Rat1a-J4 cells were treated with doxycycline for 48 hrs, after which DNA and protein complexes were cross-linked and pulled down with an anti-cJun antibody. RT-PCR amplification off the pulled-down chromatin showed cJun binding to the (+52/+60) PAK3 promoter region in the presence of doxycycline.
Figure Legend Snippet: AP-1 binds directly to the PAK3 promoter at (+52/+60) both in vivo and in vitro . A: Electrophoretic Mobility Shift Assay (EMSA) showing protein binding to the (+52/+60) PAK3 promoter region. Lane 1 shows the presence of a DNA/protein complex when the (+52/+60) PAK3 promoter radioactively-labelled oligomer was incubated with protein cell lysate of Rat1a-J4 cells treated with doxycycline. This DNA/protein complex could be competed for with unlabelled (+52/+60) wild-type (WT) oligomers (lane 2), but not with a mutated (+52/+60) sequence oligomer (lane 3). The second panel shows supershifted complexes using anti-cJun (lane 4), -JunB (lane 5) and –JunD (lane 6) antibodies. B: Chromatin Immunoprecipitation Assay (ChIP) showing cJun binding to the (+52/+60) PAK3 promoter region. Rat1a-J4 cells were treated with doxycycline for 48 hrs, after which DNA and protein complexes were cross-linked and pulled down with an anti-cJun antibody. RT-PCR amplification off the pulled-down chromatin showed cJun binding to the (+52/+60) PAK3 promoter region in the presence of doxycycline.

Techniques Used: In Vivo, In Vitro, Electrophoretic Mobility Shift Assay, Protein Binding, Incubation, Sequencing, Chromatin Immunoprecipitation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Amplification

5) Product Images from "Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci"

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci

Journal: PLoS ONE

doi: 10.1371/journal.pone.0048918

Analysis of the expression of the CAMP factor II (SAL_2074) gene. RT-PCR were performed using, as templates, RNA extracted from stationary-phase cultures of strain 515 (1, and negative control without RTase, 4); strain NEM316 (2 and negative control without RTase, 5); and transconjugant NEM316 (ICE_ 515_tRNA Lys ) (3 and negative control without RTase, 6). The same results were obtained in exponential phase. A positive control using genomic DNA of strain 515 was included (7) as well as a negative control with water (8). DNA molecular weight marker is marker number VI (Roche Applied Science).
Figure Legend Snippet: Analysis of the expression of the CAMP factor II (SAL_2074) gene. RT-PCR were performed using, as templates, RNA extracted from stationary-phase cultures of strain 515 (1, and negative control without RTase, 4); strain NEM316 (2 and negative control without RTase, 5); and transconjugant NEM316 (ICE_ 515_tRNA Lys ) (3 and negative control without RTase, 6). The same results were obtained in exponential phase. A positive control using genomic DNA of strain 515 was included (7) as well as a negative control with water (8). DNA molecular weight marker is marker number VI (Roche Applied Science).

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Molecular Weight, Marker

6) Product Images from "Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus"

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.8.3286-3294.2004

Generation of Nrf3-deficient mice. (A) Replacement of two exons of the Nrf3 gene, comprising the sequences coding for the bZIP domain, by the neomycin-cytosine deaminase cassette of the targeting vector. Nrf3 gene exons are represented by open boxes, and the exon encoding the Nrf3 bZIP domain is shown. The targeting vector contains 7.5 and 3.2 kb of Nrf3 gene homologous genomic sequences on the 5′ and 3′ sides of the neomycin-cytosine deaminase cassette, respectively. The probe used for Southern analysis and the expected fragments from EcoRI/SpeI digests of wild-type and knockout genomic DNA are indicated. tk, thymidine kinase; neo, neomycin; cda, cytosine deaminase. (B) Generation of Nrf3 −/− mice. Southern blot analysis of Nrf3 +/− mouse matings yielding offspring with homozygous wild-type (wt) and heterozygous and homozygous mutant (null) genotypes. ko, knockout.
Figure Legend Snippet: Generation of Nrf3-deficient mice. (A) Replacement of two exons of the Nrf3 gene, comprising the sequences coding for the bZIP domain, by the neomycin-cytosine deaminase cassette of the targeting vector. Nrf3 gene exons are represented by open boxes, and the exon encoding the Nrf3 bZIP domain is shown. The targeting vector contains 7.5 and 3.2 kb of Nrf3 gene homologous genomic sequences on the 5′ and 3′ sides of the neomycin-cytosine deaminase cassette, respectively. The probe used for Southern analysis and the expected fragments from EcoRI/SpeI digests of wild-type and knockout genomic DNA are indicated. tk, thymidine kinase; neo, neomycin; cda, cytosine deaminase. (B) Generation of Nrf3 −/− mice. Southern blot analysis of Nrf3 +/− mouse matings yielding offspring with homozygous wild-type (wt) and heterozygous and homozygous mutant (null) genotypes. ko, knockout.

Techniques Used: Mouse Assay, Plasmid Preparation, Genomic Sequencing, Knock-Out, Southern Blot, Mutagenesis

7) Product Images from "Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery"

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

Journal: Antiviral Research

doi: 10.1016/j.antiviral.2012.03.011

Dose-dependent decrease in Ad5 genome copy numbers mediated by the DNA polymerase siRNA. A549 cells were transfected with the DNA polymerase siRNA or a non-targeting control siRNA (neg. ctrl.) in decreasing concentrations as indicated, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR, using E1A-specific primers. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: Dose-dependent decrease in Ad5 genome copy numbers mediated by the DNA polymerase siRNA. A549 cells were transfected with the DNA polymerase siRNA or a non-targeting control siRNA (neg. ctrl.) in decreasing concentrations as indicated, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR, using E1A-specific primers. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Infection, Real-time Polymerase Chain Reaction

Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).
Figure Legend Snippet: Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).

Techniques Used: Transfection, Concentration Assay, Negative Control, Infection

Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p
Figure Legend Snippet: Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p

Techniques Used: Inhibition, Binding Assay, Sequencing, Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Concentration Assay, Infection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p
Figure Legend Snippet: siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p

Techniques Used: Transfection, Concentration Assay, Infection

SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p
Figure Legend Snippet: SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p

Techniques Used: Infection, Transfection, Concentration Assay, MTS Assay

8) Product Images from "Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele"

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele

Journal: Molecular Plant Pathology

doi: 10.1111/j.1364-3703.2009.00602.x

Segregation of Bean common mosaic virus (BCMV) resistance and a cleaved amplified polymorphic sequence (CAPS) marker differentiating eIF4E alleles PveIF4E 2 ( 4E 2 ) and PveIF4E 1 ( 4E 1 ). A Phaseolus vulgaris F 2 population was generated from a cross between parents (P) USCR8 ( 4E 2 /4E 2 , lane 2) and Dubbele Witte (DW) ( 4E 1 /4E 1 , lane 3). Successful crossing was verified on F 1 individuals (lane 4) and results from 17 F 2 individuals are shown (lanes 5–21).The response to BCMV was assayed by enzyme‐linked immunosorbent assay (ELISA). Plants with an ELISA A405 (absorbance at 405 nm) reading of more than 2.5 times that of the mock‐inoculated control were rated as susceptible (s); plants with an ELISA A405 reading of less than 2.5 times that of the mock‐inoculated control were rated as resistant (r). The genotype was determined by restriction enzyme Rsa I digestion of a 541‐bp polymerase chain reaction (PCR) product amplified with primers ENM‐FWe and ENM‐RVe from genomic DNA. DNA fragments were analysed by agarose gel electrophoresis with a 100‐bp ladder as marker (lane 1).
Figure Legend Snippet: Segregation of Bean common mosaic virus (BCMV) resistance and a cleaved amplified polymorphic sequence (CAPS) marker differentiating eIF4E alleles PveIF4E 2 ( 4E 2 ) and PveIF4E 1 ( 4E 1 ). A Phaseolus vulgaris F 2 population was generated from a cross between parents (P) USCR8 ( 4E 2 /4E 2 , lane 2) and Dubbele Witte (DW) ( 4E 1 /4E 1 , lane 3). Successful crossing was verified on F 1 individuals (lane 4) and results from 17 F 2 individuals are shown (lanes 5–21).The response to BCMV was assayed by enzyme‐linked immunosorbent assay (ELISA). Plants with an ELISA A405 (absorbance at 405 nm) reading of more than 2.5 times that of the mock‐inoculated control were rated as susceptible (s); plants with an ELISA A405 reading of less than 2.5 times that of the mock‐inoculated control were rated as resistant (r). The genotype was determined by restriction enzyme Rsa I digestion of a 541‐bp polymerase chain reaction (PCR) product amplified with primers ENM‐FWe and ENM‐RVe from genomic DNA. DNA fragments were analysed by agarose gel electrophoresis with a 100‐bp ladder as marker (lane 1).

Techniques Used: Amplification, Sequencing, Marker, Generated, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis

9) Product Images from "Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery"

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

Journal: Antiviral Research

doi: 10.1016/j.antiviral.2012.03.011

Dose-dependent decrease in Ad5 genome copy numbers mediated by the DNA polymerase siRNA. A549 cells were transfected with the DNA polymerase siRNA or a non-targeting control siRNA (neg. ctrl.) in decreasing concentrations as indicated, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR, using E1A-specific primers. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: Dose-dependent decrease in Ad5 genome copy numbers mediated by the DNA polymerase siRNA. A549 cells were transfected with the DNA polymerase siRNA or a non-targeting control siRNA (neg. ctrl.) in decreasing concentrations as indicated, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR, using E1A-specific primers. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Infection, Real-time Polymerase Chain Reaction

Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).
Figure Legend Snippet: Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).

Techniques Used: Transfection, Concentration Assay, Negative Control, Infection

Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p
Figure Legend Snippet: Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p

Techniques Used: Inhibition, Binding Assay, Sequencing, Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p
Figure Legend Snippet: siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

Techniques Used: Transfection, Concentration Assay, Infection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p
Figure Legend Snippet: siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p

Techniques Used: Transfection, Concentration Assay, Infection

SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p
Figure Legend Snippet: SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p

Techniques Used: Infection, Transfection, Concentration Assay, MTS Assay

Related Articles

Clone Assay:

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts
Article Snippet: .. PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes. ..

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: .. The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. The 3′ Nco I site was introduced by a mismatch in the antisense primer (5′-cctcaccatccatGGtttgctgtgtt-3′), while the 5′ Pst I site was present in the native DNA sequence (5′-cttacactgctgcagcctcggctt-3′).

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. Cloning of VacA gene in bacterial expression vector and transformation The PCR product was purified from the agarose gel by high pure PCR product purification kit (Roche, Germany) according to the manufacturer guideline.

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: Paragraph title: RNA extraction, reverse transcriptase‐polymerase chain reaction (RT‐PCR), cloning and sequence analysis ... PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ).

Centrifugation:

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
Article Snippet: After centrifugation at 5,000 rpm for 30 s, the supernatant was directly used for the following PCR as a fungal DNA template. .. The reaction mixture contained 2.5 units Tth DNA polymerase (Roche Diagnostics, Tokyo, Japan), 1× PCR buffer, 1 mM dNTP (Roche Diagnostics) and 0.5 μM of each primer.

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: Two mL of cell pellets were collected at OD600 = 0.4 and 0.8 by centrifugation at 2000× g at 4°C and conserved by a quick freezing at −80°C. .. Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier .

Amplification:

Article Title: Clinical Implications of Microsatellite Instability in T1 Colorectal Cancer
Article Snippet: .. Fifty nanograms of DNA were amplified in a 20 µL reaction solution containing 2 µL of 10X buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2 , 0.3 µM of each primer pair, 250 µM of deoxynucleotide triphosphate, and 2.5 units of DNA polymerase (Roche). .. The primer sequences and polymerase chain reaction (PCR) cycles for each marker were adapted from the published data.

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts
Article Snippet: Plasmid preparation The (-2436/+149) rat PAK3 promoter region (GenBank Accession Number: NC_005120) was amplified using primers: F 5′-TG ACGCGT AGAGAAGGAAGCCAAGAATC-3′ (Mlu1 site in bold) and R 5′-CG CTCGAG GTGTAAGACCCCAGACAGTT-3′ (Xho1 site is underlined). .. PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes.

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: .. The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. The 3′ Nco I site was introduced by a mismatch in the antisense primer (5′-cctcaccatccatGGtttgctgtgtt-3′), while the 5′ Pst I site was present in the native DNA sequence (5′-cttacactgctgcagcctcggctt-3′).

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: The primer pair sequences used for polymerase chain reaction (PCR) amplification were: 5′-gttacactcaggcctcgcagaa-3′/5′-cgagtacccaaatgc tgactgaa-3′ for pancreatic lipase (Accession number, XM535023.4) and 5′-cattgccctcaatgaccact-3′/5′-tccttggaggccatgtagac-3′ for GAPDH ( ). .. Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix.

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. The following conditions were used for amplification: initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 53°C for 1 min and extension at 72°C for 1 min and further extension for 5 min at 72°C ( ).

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: .. PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ). ..

Article Title: Microarray Approach Combined with ddPCR: An Useful Pipeline for the Detection and Quantification of Circulating Tumour DNA Mutations
Article Snippet: In addition to the single amplification, we optimized a triplex PCR amplification in which the primers used for the KRAS codon 12-13, NRAS codon 12-13 and BRAF codon 600 were mixed together in the same PCR mixture. .. The triplex PCR was performed in 50 µL of reactions containing 15 µL of DNA extracted from plasma, 200 µM deoxynucleotide triphosphates, 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.9 mM MgCl2 , 1.95 U of DNA polymerase (FastStart Taq, Roche Diagnostics, Mannheim, Germany) and 20 pmoles of each primer with the exception of the KRAS codon 12-13 primer forward and reveres for which 40 pmoles were used.

DNA Synthesis:

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: After the initial denaturation step at 94°C for 2 min, PCR was conducted for 30 cycles with denaturation at 94°C for 40 s, primer annealing at 55°C for 40 s and DNA synthesis at 72°C for 60 s for each 1 kb of cDNA + plasmid sequence, e. g. 5 min for a plasmid + cDNA sequence of 5 kb. .. The DNA polymerase we use is Pwo (Roche, Germany).

Positive Control:

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
Article Snippet: The reaction mixture contained 2.5 units Tth DNA polymerase (Roche Diagnostics, Tokyo, Japan), 1× PCR buffer, 1 mM dNTP (Roche Diagnostics) and 0.5 μM of each primer. .. A primer pair to amplify a small subunit rDNA region that is highly conserved among fungi was also added to the multiplex PCR primer set as a positive control ( ).

Synthesized:

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Complementary DNA (cDNA) was synthesized from 1.0 μg (pancreas) or 0.5 μg (liver) of total RNA using a commercially available cDNA synthesis kit (ReverTra Ace qPCR RT Master Mix; Toyobo, Osaka, Japan). .. Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix.

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: DNA was synthesized using the M-MLV retro-transcriptase (In Vitrogen Life Technologies, Carlsbad, USA). .. Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier .

Real-time Polymerase Chain Reaction:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′). ..

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Complementary DNA (cDNA) was synthesized from 1.0 μg (pancreas) or 0.5 μg (liver) of total RNA using a commercially available cDNA synthesis kit (ReverTra Ace qPCR RT Master Mix; Toyobo, Osaka, Japan). .. Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix.

Incubation:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: After 24 h of incubation, medium was exchanged and cells were infected with Ad5 at an multiplicity of infection (MOI) of 0.01 TCID50 /cell, and total RNA was isolated at 24 h post-infection using an RNeasy Mini® Kit (QIAGEN). .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′).

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
Article Snippet: The sterilized pieces were put on the potato sucrose agar including 0.01% streptomycin sulfate salt and incubated at 25°C for 3 days. .. The reaction mixture contained 2.5 units Tth DNA polymerase (Roche Diagnostics, Tokyo, Japan), 1× PCR buffer, 1 mM dNTP (Roche Diagnostics) and 0.5 μM of each primer.

Luciferase:

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts
Article Snippet: .. PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes. ..

Expressing:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′). ..

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Paragraph title: Gene expression analysis of pancreatic lipase in the pancreas and liver ... Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix.

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. Cloning of VacA gene in bacterial expression vector and transformation The PCR product was purified from the agarose gel by high pure PCR product purification kit (Roche, Germany) according to the manufacturer guideline.

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: RT-PCR The expression of the SAL_2074 gene, which encodes the putative new CAMP factor on the ICE_515_tRNALys genetic element, was examined by RT-PCR. .. Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier .

Transformation Assay:

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. Arabidopsis ecotype Col-0 plants were transformed by the floral dip method ( ) with Agrobacterium tumefaciens cells harboring the promoter AtHAK5 :GUS-GFP plasmid.

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. Cloning of VacA gene in bacterial expression vector and transformation The PCR product was purified from the agarose gel by high pure PCR product purification kit (Roche, Germany) according to the manufacturer guideline.

Hybridization:

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus
Article Snippet: Paragraph title: RNA preparation and Northern blot hybridization analyses. ... The Nrf3 probe was generated by random priming of a 572-bp SacII/PstI fragment (corresponding to amino acids 131 to 321 of mouse Nrf3) by using [32 P]dCTP (Amersham) and the Klenow fragment of DNA polymerase I according to standard methods (Roche).

Sequencing:

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: After the initial denaturation step at 94°C for 2 min, PCR was conducted for 30 cycles with denaturation at 94°C for 40 s, primer annealing at 55°C for 40 s and DNA synthesis at 72°C for 60 s for each 1 kb of cDNA + plasmid sequence, e. g. 5 min for a plasmid + cDNA sequence of 5 kb. .. The DNA polymerase we use is Pwo (Roche, Germany).

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. The 3′ Nco I site was introduced by a mismatch in the antisense primer (5′-cctcaccatccatGGtttgctgtgtt-3′), while the 5′ Pst I site was present in the native DNA sequence (5′-cttacactgctgcagcctcggctt-3′).

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix. .. Nucleotide sequences were confirmed by a DNA sequencing kit (BigDye Terminator v 3.1 Cycle Sequencing Kit; Applied Biosystems, Foster City, California, USA) with a genetic analyzer (ABI PRISM 3100 Genetic Analyzer; Applied Biosystems).

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Detection of antigenic region Since the most prevalent VacA genotype of H. pylori among Iranian strains is s1m2 , in order to find out antigenic region, the sequence of VacA gene with s1m2 genotype (4243 base pair, 1323 amino acids) which encodes the 142.973 Kilodaltons (KDa) protein, from a reference strain (NCBI GenBank, Accession number: U95971, protein id: AAC25911.1) was submitted to ABCpred, Bcepred and Emboss Antigenic web servers ( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: Paragraph title: RNA extraction, reverse transcriptase‐polymerase chain reaction (RT‐PCR), cloning and sequence analysis ... PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ).

Northern Blot:

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus
Article Snippet: Paragraph title: RNA preparation and Northern blot hybridization analyses. ... The Nrf3 probe was generated by random priming of a 572-bp SacII/PstI fragment (corresponding to amino acids 131 to 321 of mouse Nrf3) by using [32 P]dCTP (Amersham) and the Klenow fragment of DNA polymerase I according to standard methods (Roche).

Infection:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: After 24 h of incubation, medium was exchanged and cells were infected with Ad5 at an multiplicity of infection (MOI) of 0.01 TCID50 /cell, and total RNA was isolated at 24 h post-infection using an RNeasy Mini® Kit (QIAGEN). .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′).

Generated:

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus
Article Snippet: .. The Nrf3 probe was generated by random priming of a 572-bp SacII/PstI fragment (corresponding to amino acids 131 to 321 of mouse Nrf3) by using [32 P]dCTP (Amersham) and the Klenow fragment of DNA polymerase I according to standard methods (Roche). ..

Inhibition:

Article Title: Toward an International Standard for PCR-Based Detection of Food-Borne Thermotolerant Campylobacters: Assay Development and Analytical Validation
Article Snippet: .. Taq and DyNAzyme polymerases were not inhibited when the chicken rinse was added to the PCR at a concentration of 0.2% (vol/vol), while T th DNA polymerase showed no inhibition at a concentration of 2% (vol/vol) chicken rinse. ..

DNA Sequencing:

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix. .. Nucleotide sequences were confirmed by a DNA sequencing kit (BigDye Terminator v 3.1 Cycle Sequencing Kit; Applied Biosystems, Foster City, California, USA) with a genetic analyzer (ABI PRISM 3100 Genetic Analyzer; Applied Biosystems).

Polymerase Chain Reaction:

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
Article Snippet: .. The reaction mixture contained 2.5 units Tth DNA polymerase (Roche Diagnostics, Tokyo, Japan), 1× PCR buffer, 1 mM dNTP (Roche Diagnostics) and 0.5 μM of each primer. ..

Article Title: Toward an International Standard for PCR-Based Detection of Food-Borne Thermotolerant Campylobacters: Assay Development and Analytical Validation
Article Snippet: .. Taq and DyNAzyme polymerases were not inhibited when the chicken rinse was added to the PCR at a concentration of 0.2% (vol/vol), while T th DNA polymerase showed no inhibition at a concentration of 2% (vol/vol) chicken rinse. ..

Article Title: Clinical Implications of Microsatellite Instability in T1 Colorectal Cancer
Article Snippet: Fifty nanograms of DNA were amplified in a 20 µL reaction solution containing 2 µL of 10X buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2 , 0.3 µM of each primer pair, 250 µM of deoxynucleotide triphosphate, and 2.5 units of DNA polymerase (Roche). .. The primer sequences and polymerase chain reaction (PCR) cycles for each marker were adapted from the published data.

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: Paragraph title: SDM using single-primer PCR ... The DNA polymerase we use is Pwo (Roche, Germany).

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts
Article Snippet: .. PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes. ..

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: .. The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. The 3′ Nco I site was introduced by a mismatch in the antisense primer (5′-cctcaccatccatGGtttgctgtgtt-3′), while the 5′ Pst I site was present in the native DNA sequence (5′-cttacactgctgcagcctcggctt-3′).

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: .. Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix. ..

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. The following conditions were used for amplification: initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 53°C for 1 min and extension at 72°C for 1 min and further extension for 5 min at 72°C ( ).

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: .. PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ). ..

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: .. Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier . .. Analysis of the supernatants by SDS-PAGE and mass spectrometry Supernatant of S. agalactiae NEM316 and NEM316 (ICE_515_tRNALys ) cultures grown overnight in BHI or chemically defined medium (CDM, peptide-free medium, ) were collected after centrifugation at 5000× g at 4°C for 10 min. Proteins were precipitated using a sodium deoxycholate (DOC) - trichloroacetic acid (TCA) protocol .

Article Title: T cell homeostasis in patients with rheumatoid arthritis
Article Snippet: .. PCR reactions were performed with 0.1 μg of DNA, 2.6 units of DNA polymerase (Expand High Fidelity PCR System, Roche Molecular Biochemicals–Boehringer Mannheim), 1.5 mM MgCl2 , 0.2 mM dNTPs, and 0.6 μM of each primer in 25 μl under the following conditions: 95°C for 5 min followed by 95°C, 60°C, and 72°C for 30 sec each for 35 cycles. .. To each PCR reaction was added 104 , 103 , or 102 molecules of signal-joint standard (kindly provided by D. C. Douek, Dallas, TX).

DNA Extraction:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Chromosomal DNA isolation Genomic DNA of H. pylori was extracted from the colonies on the Brucella agar plates according to the standard CTAB/NaCl protocol ( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Nucleic Acid Electrophoresis:

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus
Article Snippet: For Northern blotting, 10 μg of each RNA sample was then separated by formaldehyde-agarose gel electrophoresis, transferred to a nylon membrane (Amersham), and subjected to hybridization as previously described, with minor modifications ( ). .. The Nrf3 probe was generated by random priming of a 572-bp SacII/PstI fragment (corresponding to amino acids 131 to 321 of mouse Nrf3) by using [32 P]dCTP (Amersham) and the Klenow fragment of DNA polymerase I according to standard methods (Roche).

Fluorescence:

Article Title: Clinical Implications of Microsatellite Instability in T1 Colorectal Cancer
Article Snippet: Fifty nanograms of DNA were amplified in a 20 µL reaction solution containing 2 µL of 10X buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2 , 0.3 µM of each primer pair, 250 µM of deoxynucleotide triphosphate, and 2.5 units of DNA polymerase (Roche). .. Fluorescence markers (NED, FAM) were attached to the 5' end of the forward primer.

Methylation:

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: Digest methylated non-mutated DNA (i.e. the parental plasmid) with DpnI. .. The DNA polymerase we use is Pwo (Roche, Germany).

Isolation:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: After 24 h of incubation, medium was exchanged and cells were infected with Ad5 at an multiplicity of infection (MOI) of 0.01 TCID50 /cell, and total RNA was isolated at 24 h post-infection using an RNeasy Mini® Kit (QIAGEN). .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′).

Article Title: Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus
Article Snippet: Total RNA was isolated by using the Trizol reagent according to the manufacturer's instructions (Invitrogen). .. The Nrf3 probe was generated by random priming of a 572-bp SacII/PstI fragment (corresponding to amino acids 131 to 321 of mouse Nrf3) by using [32 P]dCTP (Amersham) and the Klenow fragment of DNA polymerase I according to standard methods (Roche).

Multiplex Assay:

Article Title: Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
Article Snippet: The reaction mixture contained 2.5 units Tth DNA polymerase (Roche Diagnostics, Tokyo, Japan), 1× PCR buffer, 1 mM dNTP (Roche Diagnostics) and 0.5 μM of each primer. .. The PCR conditions consisted of 1 cycle of 2 min at 94°C, followed by 35 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. For specific identification of C. acutatum and G. cingulata by multiplex PCR, the primers were designed for specific regions in the gene MAT1-2 , which codes for a factor determining mating type.

Purification:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Quality and quantity of the purified genomic DNA was assessed by 0.8% horizontal agarose gel electrophoresis in 1X TBE buffer (10X TBE: 890 mM Tris-base, 890 mM Boric acid, 25 mM EDTA) and visualized by ethidium bromide (1 µg/ml) staining on UV transilluminator, and spectrophotometry (eppendorf) in 260 nm( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: RNA samples were purified using the RNAeasy mini kit (Qiagen, Hilden, Germany) before being treated with the RQ1 RNase free DNase (Promega, Madison, USA) for 1 hour. .. Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier .

Reverse Transcription Polymerase Chain Reaction:

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: Paragraph title: RNA extraction, reverse transcriptase‐polymerase chain reaction (RT‐PCR), cloning and sequence analysis ... PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ).

Article Title: Characterization of a New CAMP Factor Carried by an Integrative and Conjugative Element in Streptococcus agalactiae and Spreading in Streptococci
Article Snippet: Paragraph title: RT-PCR ... Conventional PCR were done using cDNA as templates for DNA polymerase (Roche Applied Science, Mannheim, Germany) as described earlier .

Plasmid Preparation:

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: After the initial denaturation step at 94°C for 2 min, PCR was conducted for 30 cycles with denaturation at 94°C for 40 s, primer annealing at 55°C for 40 s and DNA synthesis at 72°C for 60 s for each 1 kb of cDNA + plasmid sequence, e. g. 5 min for a plasmid + cDNA sequence of 5 kb. .. The DNA polymerase we use is Pwo (Roche, Germany).

Article Title: p21-Activated Kinase 3 (PAK3) Is an AP-1 Regulated Gene Contributing to Actin Organisation and Migration of Transformed Fibroblasts
Article Snippet: .. PCR using high fidelity Expand Plus DNA Polymerase (Roche) was performed on rat genomic DNA, the products were sub-cloned into the pGEM-T Easy vector (Promega) and excised for cloning into the luciferase reported vector, pGL3 -Basic (Promega) using Mlu1 and Xho1 restriction enzymes. ..

Article Title: The Potassium Transporter AtHAK5 Functions in K+ Deprivation-Induced High-Affinity K+ Uptake and AKT1 K+ Channel Contribution to K+ Uptake Kinetics in Arabidopsis Roots 1 Uptake Kinetics in Arabidopsis Roots 1 [w]
Article Snippet: .. The 2-kb DNA fragment upstream of the AtHAK5 start codon was amplified by PCR from Col-0 genomic DNA using a proofreading DNA polymerase (Pwo, Roche, Indianapolis) and cloned into the Pst I/ Nco I sites of the binary vector pCAMBIA 1303 replacing the cauliflower mosaic virus 35S promoter. .. The 3′ Nco I site was introduced by a mismatch in the antisense primer (5′-cctcaccatccatGGtttgctgtgtt-3′), while the 5′ Pst I site was present in the native DNA sequence (5′-cttacactgctgcagcctcggctt-3′).

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany). .. Cloning of VacA gene in bacterial expression vector and transformation The PCR product was purified from the agarose gel by high pure PCR product purification kit (Roche, Germany) according to the manufacturer guideline.

Software:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Gene amplification Two specific PCR primers were designed with Oligo5 software. .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Article Title: T cell homeostasis in patients with rheumatoid arthritis
Article Snippet: PCR reactions were performed with 0.1 μg of DNA, 2.6 units of DNA polymerase (Expand High Fidelity PCR System, Roche Molecular Biochemicals–Boehringer Mannheim), 1.5 mM MgCl2 , 0.2 mM dNTPs, and 0.6 μM of each primer in 25 μl under the following conditions: 95°C for 5 min followed by 95°C, 60°C, and 72°C for 30 sec each for 35 cycles. .. PCR products were separated on polyacrylamide gels, stained with SYBR-Gold Nucleic Acid Stain (Molecular Probes), and imaged and analyzed using storm 840 and imagequant software (Molecular Dynamics).

RNA Extraction:

Article Title: Effects of immunosuppressive prednisolone therapy on pancreatic tissue and concentration of canine pancreatic lipase immunoreactivity in healthy dogs
Article Snippet: Total RNA was extracted from the pancreas and liver using a commercially available RNA extraction kit (RNeasy Protect Mini Kit; Qiagen, Valencia, California, USA) according to the manufacturer’s instructions. .. Polymerase chain reaction was carried out with DNA polymerase (FastStart PCR Master; Roche, Indianapolis, Indiana, USA) according to the manufacturer’s instructions using the following steps: initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. Reactions were conducted in a 20-μL total volume containing 1 μL of cDNA, 500 nmol primers, and 10 μL of 2× Master Mix.

Article Title: Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc‐3 is associated with the homozygotic presence of a mutated eIF4E allele
Article Snippet: Paragraph title: RNA extraction, reverse transcriptase‐polymerase chain reaction (RT‐PCR), cloning and sequence analysis ... PCR amplification was performed using 5 µL of cDNA in 50 µL reactions containing 0.6 p m of oligonucleotide primers and 4 units of expand DNA polymerase (Roche). cDNA of eIF4E , eIF(iso)4E and nCBP was amplified in 40 cycles: 20 s of denaturation at 94 °C, 20 s of annealing at 57, 60 and 65 °C, respectively, and 35 s of elongation at 72 °C in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Naerum, Denmark) after an initial denaturation at 95 °C for 3 min. ), C lustal ).

Agarose Gel Electrophoresis:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Quality and quantity of the purified genomic DNA was assessed by 0.8% horizontal agarose gel electrophoresis in 1X TBE buffer (10X TBE: 890 mM Tris-base, 890 mM Boric acid, 25 mM EDTA) and visualized by ethidium bromide (1 µg/ml) staining on UV transilluminator, and spectrophotometry (eppendorf) in 260 nm( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Size-exclusion Chromatography:

Article Title: T cell homeostasis in patients with rheumatoid arthritis
Article Snippet: .. PCR reactions were performed with 0.1 μg of DNA, 2.6 units of DNA polymerase (Expand High Fidelity PCR System, Roche Molecular Biochemicals–Boehringer Mannheim), 1.5 mM MgCl2 , 0.2 mM dNTPs, and 0.6 μM of each primer in 25 μl under the following conditions: 95°C for 5 min followed by 95°C, 60°C, and 72°C for 30 sec each for 35 cycles. .. To each PCR reaction was added 104 , 103 , or 102 molecules of signal-joint standard (kindly provided by D. C. Douek, Dallas, TX).

Spectrophotometry:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Quality and quantity of the purified genomic DNA was assessed by 0.8% horizontal agarose gel electrophoresis in 1X TBE buffer (10X TBE: 890 mM Tris-base, 890 mM Boric acid, 25 mM EDTA) and visualized by ethidium bromide (1 µg/ml) staining on UV transilluminator, and spectrophotometry (eppendorf) in 260 nm( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Concentration Assay:

Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery
Article Snippet: 2.6 Determination of mRNA levels 1.25e+05 A549 cells were seeded into the wells of 24-well plates and reverse transfected with siRNAs at a concentration of 10 nM. .. Expression levels of the E1A-12S, E1A-13S, DNA polymerase, pTP, IVa2, hexon, and protease genes were determined by TaqMan real-time quantitative PCR (qPCR), using the LightCycler 480 Probes master mix (Roche Diagnostics) and primer/probe sets specific for E1A-13S (E1A 289R-cDNA-f1 5′-GCATGTTTGTCTACAGTCCTGTGTC-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), E1A-12S (E1A 12S-cDNA-f1 5′-AGGATGAAGAGGGTCCTGTGTCT-3′, E1A 289R-cDNA-r1 5′-GGCGTCTCAGGATAGCAGGC-3′, and E1A 289R-cDNA-p1 5′-AGGCTCCGGTTCTGGCTCGGG-3′), DNA polymerase (Pol-cDNA-f1 5′-ATGGCCTTGGCTCAAGCTC-3′, Pol-cDNA-r1 5′-GCGTAGGTTGCTGGCGAAC-3′, and Pol-cDNA-p1 5′-CGCCTCTGCGTGAAGACGACGG-3′), pTP (pTP-cDNA-f2 5′-AAACCAACGCTCGGTGCC-3′, pTP-cDNA-r2 5′-GGACGCGGTTCCAGATGTT-3′, and pTP-cDNA-p2 5′-CGCGCGCAATCGTTGACGCT-3′), IVa2 (IVa2-cDNA-f1 5′-GGAAACCAGAGGGCGAAGA-3′, IVa2-cDNA-r1 5′-AGGGTCCTCGTCAGCGTAGTC-3′, and IVa2-cDNA-p1 5′-CTTGAGGCTGGTCCTGCTGGT-3′), hexon (Hex-cDNA-f1 5′-CAGTCACAGTCGCAAGAGGAGC-3′, Hex-cDNA-r1 5′-AGGTACTCCGAGGCGTCCTG-3′, and Hex-cDNA-p1 5′-ACCACTGCGGCATCATCGAAGGG-3′), and protease (Prot-cDNA-f1 5′-TCACAGTCGCAAGTCTTTGACG-3′, Prot-cDNA-r1 5′-GCGGCAGCTGTTGTTGATG-3′, and Prot-cDNA-p1 5′-CCGAGAAGGGCGTGCGCAGGTA-3′).

Article Title: Toward an International Standard for PCR-Based Detection of Food-Borne Thermotolerant Campylobacters: Assay Development and Analytical Validation
Article Snippet: .. Taq and DyNAzyme polymerases were not inhibited when the chicken rinse was added to the PCR at a concentration of 0.2% (vol/vol), while T th DNA polymerase showed no inhibition at a concentration of 2% (vol/vol) chicken rinse. ..

Article Title: Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies
Article Snippet: The DNA polymerase we use is Pwo (Roche, Germany). .. We then add 30 units of DpnI (in 1–3 μl depending on the enzyme concentration; sources of enzyme: Fermentas, NEB and Roche) to the reannealed PCR products (as noted above, in 50 μl) and incubate overnight at 37°C.

Marker:

Article Title: Clinical Implications of Microsatellite Instability in T1 Colorectal Cancer
Article Snippet: Fifty nanograms of DNA were amplified in a 20 µL reaction solution containing 2 µL of 10X buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2 , 0.3 µM of each primer pair, 250 µM of deoxynucleotide triphosphate, and 2.5 units of DNA polymerase (Roche). .. The primer sequences and polymerase chain reaction (PCR) cycles for each marker were adapted from the published data.

Staining:

Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori
Article Snippet: Quality and quantity of the purified genomic DNA was assessed by 0.8% horizontal agarose gel electrophoresis in 1X TBE buffer (10X TBE: 890 mM Tris-base, 890 mM Boric acid, 25 mM EDTA) and visualized by ethidium bromide (1 µg/ml) staining on UV transilluminator, and spectrophotometry (eppendorf) in 260 nm( ). .. PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

Article Title: T cell homeostasis in patients with rheumatoid arthritis
Article Snippet: PCR reactions were performed with 0.1 μg of DNA, 2.6 units of DNA polymerase (Expand High Fidelity PCR System, Roche Molecular Biochemicals–Boehringer Mannheim), 1.5 mM MgCl2 , 0.2 mM dNTPs, and 0.6 μM of each primer in 25 μl under the following conditions: 95°C for 5 min followed by 95°C, 60°C, and 72°C for 30 sec each for 35 cycles. .. PCR products were separated on polyacrylamide gels, stained with SYBR-Gold Nucleic Acid Stain (Molecular Probes), and imaged and analyzed using storm 840 and imagequant software (Molecular Dynamics).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 77
    Roche quantitative polymerization assay rna dependent dna polymerase activity
    Determination of K D -values by fluorescence anisotropy measurements. Fifteen nanomolar of a fluorescently labeled <t>DNA/DNA</t> ( A ) or <t>DNA/RNA</t> ( B ) P/T substrate was titrated with different PR–RTs at 25°C. The curves show the best fit to Equation ( 3 ) (‘Materials and methods’ section) describing the binding equilibrium with K D -values shown in Table 2 .
    Quantitative Polymerization Assay Rna Dependent Dna Polymerase Activity, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative polymerization assay rna dependent dna polymerase activity/product/Roche
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quantitative polymerization assay rna dependent dna polymerase activity - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    99
    Roche pwo dna polymerase
    Characteristics and applications of the USER technique. ( a ) A comparison of the ability of <t>DNA</t> polymerases to amplify DNA fragments using uracil-free (-dU) and uracil-containing primers (+dU). Hm Taq: HotMaster™ Taq DNA Polymerase, Taq: Platinum ® Taq DNA Polymerase, <t>Pwo:</t> Pwo DNA Polymerase, Phusion: Phusion™ DNA Polymerase, PfuCx: PfuTurbo ® C x Hotstart DNA polymerase. ( b ) Functional expression of A.thaliana glucose transporter AtSTP1 in X.laevis oocytes from the Xenopus -specific USER compatible vector, pNB1u. H 2 O: control oocytes injected with water; STP1: oocytes injected with AtSTP1 cRNA. ( c ) Functional expression of the cyano fluorescence protein in leaf and root of A.thaliana from the CaMV 35S promoter using the USER compatible pCAMBIA230035Su vector (35S:CFP). Control: empty pCAMBIA230035Su.
    Pwo Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 159 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pwo dna polymerase/product/Roche
    Average 99 stars, based on 159 article reviews
    Price from $9.99 to $1999.99
    pwo dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Roche high fidelity dna polymerase
    POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative <t>DNA</t> concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative <t>PCR.</t> Error bars are sem.
    High Fidelity Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase/product/Roche
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    94
    Roche expand dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Expand Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand dna polymerase/product/Roche
    Average 94 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    expand dna polymerase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    Image Search Results


    Determination of K D -values by fluorescence anisotropy measurements. Fifteen nanomolar of a fluorescently labeled DNA/DNA ( A ) or DNA/RNA ( B ) P/T substrate was titrated with different PR–RTs at 25°C. The curves show the best fit to Equation ( 3 ) (‘Materials and methods’ section) describing the binding equilibrium with K D -values shown in Table 2 .

    Journal: Nucleic Acids Research

    Article Title: AZT resistance of simian foamy virus reverse transcriptase is based on the excision of AZTMP in the presence of ATP

    doi: 10.1093/nar/gkm1087

    Figure Lengend Snippet: Determination of K D -values by fluorescence anisotropy measurements. Fifteen nanomolar of a fluorescently labeled DNA/DNA ( A ) or DNA/RNA ( B ) P/T substrate was titrated with different PR–RTs at 25°C. The curves show the best fit to Equation ( 3 ) (‘Materials and methods’ section) describing the binding equilibrium with K D -values shown in Table 2 .

    Article Snippet: Quantitative polymerization assay RNA-dependent DNA polymerase activity was quantitated on a poly(rA)/oligo(dT)15 substrate (0.2 U/ml) (Roche Diagnostics GmbH, Mannheim, Germany) in a standard assay (30 μl reaction volume) as described previously ( , ) with 150 μM TTP and 41.7 Ci/ml [3 H]TTP (49.9 Ci/mmol; MP Biomedicals Inc., Irvine, CA, USA) in reaction buffer [50 mM Tris/HCl, pH 8.0, 80 mM KCl, 6 mM MgCl2 , 0.5 mM dithiothreitol (DTT), 0.05% Triton X-100].

    Techniques: Fluorescence, Labeling, Binding Assay

    Characteristics and applications of the USER technique. ( a ) A comparison of the ability of DNA polymerases to amplify DNA fragments using uracil-free (-dU) and uracil-containing primers (+dU). Hm Taq: HotMaster™ Taq DNA Polymerase, Taq: Platinum ® Taq DNA Polymerase, Pwo: Pwo DNA Polymerase, Phusion: Phusion™ DNA Polymerase, PfuCx: PfuTurbo ® C x Hotstart DNA polymerase. ( b ) Functional expression of A.thaliana glucose transporter AtSTP1 in X.laevis oocytes from the Xenopus -specific USER compatible vector, pNB1u. H 2 O: control oocytes injected with water; STP1: oocytes injected with AtSTP1 cRNA. ( c ) Functional expression of the cyano fluorescence protein in leaf and root of A.thaliana from the CaMV 35S promoter using the USER compatible pCAMBIA230035Su vector (35S:CFP). Control: empty pCAMBIA230035Su.

    Journal: Nucleic Acids Research

    Article Title: Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments

    doi: 10.1093/nar/gkl635

    Figure Lengend Snippet: Characteristics and applications of the USER technique. ( a ) A comparison of the ability of DNA polymerases to amplify DNA fragments using uracil-free (-dU) and uracil-containing primers (+dU). Hm Taq: HotMaster™ Taq DNA Polymerase, Taq: Platinum ® Taq DNA Polymerase, Pwo: Pwo DNA Polymerase, Phusion: Phusion™ DNA Polymerase, PfuCx: PfuTurbo ® C x Hotstart DNA polymerase. ( b ) Functional expression of A.thaliana glucose transporter AtSTP1 in X.laevis oocytes from the Xenopus -specific USER compatible vector, pNB1u. H 2 O: control oocytes injected with water; STP1: oocytes injected with AtSTP1 cRNA. ( c ) Functional expression of the cyano fluorescence protein in leaf and root of A.thaliana from the CaMV 35S promoter using the USER compatible pCAMBIA230035Su vector (35S:CFP). Control: empty pCAMBIA230035Su.

    Article Snippet: PCR conditions PCR with the following DNA polymerases: HotMaster™ Taq DNA Polymerase (Eppendorf), Platinum® Taq DNA Polymerase (Invitrogen), Pwo DNA Polymerase (Roche), Phusion™ DNA Polymerase (Finnzymes), and PfuTurbo® Cx Hotstart DNA polymerase (PfuCx) (Stratagene) was performed according to manufacturers' instructions on pBAD-TOPO® (Invitrogen) containing the gene, At5g43440 (Accession no. AY143873).

    Techniques: Functional Assay, Expressing, Plasmid Preparation, Injection, Fluorescence

    POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.

    Journal: PLoS Genetics

    Article Title: Stoichiometry of Base Excision Repair Proteins Correlates with Increased Somatic CAG Instability in Striatum over Cerebellum in Huntington's Disease Transgenic Mice

    doi: 10.1371/journal.pgen.1000749

    Figure Lengend Snippet: POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.

    Article Snippet: PCR reactions were performed using the expand high fidelity DNA polymerase (Roche), according to manufacturer's instructions.

    Techniques: Mouse Assay, Chromatin Immunoprecipitation, Concentration Assay, Real-time Polymerase Chain Reaction

    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse PCR reaction used to recover the allele from genomic DNA. ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele

    Journal: RNA

    Article Title: A novel strategy to identify the location of necessary and sufficient cis-acting regulatory mRNA elements in trypanosomes

    doi: 10.1261/rna.2510505

    Figure Lengend Snippet: ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse PCR reaction used to recover the allele from genomic DNA. ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele

    Article Snippet: The PCR reaction was carried out by using 100 ng of self-ligated genomic DNA in a 50 μL PCR reaction using Expand DNA polymerase (Roche) and the oligonucleotides 5′cgccatcgccttctatcgcc and 5′GCGTGCAATCCATCTTGTTC, both of which prime outward from inside the neoR ORF (Fig. 4a ).

    Techniques: Planar Chromatography, Inverse PCR