Structured Review

Roboklon dna polymerase
Target sets and workflow of the <t>PCR-based,</t> multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer <t>DNA</t> (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.
Dna Polymerase, supplied by Roboklon, used in various techniques. Bioz Stars score: 98/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/Roboklon
Average 98 stars, based on 2 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-04
98/100 stars

Images

1) Product Images from "Loss-of-function uORF mutations in human malignancies"

Article Title: Loss-of-function uORF mutations in human malignancies

Journal: Scientific Reports

doi: 10.1038/s41598-018-19201-8

Target sets and workflow of the PCR-based, multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer DNA (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.
Figure Legend Snippet: Target sets and workflow of the PCR-based, multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer DNA (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.

Techniques Used: Polymerase Chain Reaction, Multiplex Assay, Sequencing, Flow Cytometry, Amplification, Labeling, Generated

Related Articles

Clone Assay:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs). .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: 3′ UTRs of Prr7 , Src , Cnih2 ( ) and Dlgap3 ( ) were amplified either from mouse genomic DNA or from mouse cDNA and cloned into the pmirGLO dual‐luciferase expression vector. .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites ( Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Amplification:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR amplification of TLSs was performed using the Pfu Plus! .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: 3′ UTRs of Prr7 , Src , Cnih2 ( ) and Dlgap3 ( ) were amplified either from mouse genomic DNA or from mouse cDNA and cloned into the pmirGLO dual‐luciferase expression vector. .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR amplification of TLSs was performed using the Pfu Plus! .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Synthesized:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs). .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Generation of constructs for luciferase reporter assays TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Construct:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Paragraph title: Generation of constructs for luciferase reporter assays ... DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: Paragraph title: DNA constructs ... DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Incubation:

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. To digest template DNA, 1 µl DpnI (20 U/µl, New England Biolabs) was added and incubated for 2 h at 37 °C prior to inactivation for 20 min at 80 °C.

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. To digest template DNA, 1 µl DpnI (20 U/µl, New England Biolabs) was added and incubated for 2 h at 37 °C prior to inactivation for 20 min at 80 °C.

Luciferase:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Paragraph title: Generation of constructs for luciferase reporter assays ... DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Expressing:

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: 3′ UTRs of Prr7 , Src , Cnih2 ( ) and Dlgap3 ( ) were amplified either from mouse genomic DNA or from mouse cDNA and cloned into the pmirGLO dual‐luciferase expression vector. .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Genome Wide:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: We designed and established 367 customized PCR primer pairs (Supplementary Table ) to amplify 404 uORF initiation sites (including the uKozak context) as mapped by a previous genome-wide sequence analysis using the Pfu Plus! .. DNA Polymerase (Roboklon).

Transformation Assay:

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. Chemically competent E. coli Top10 were transformed with 2.5 µl of the mixture and plated on LB agar supplemented with 50 µg/ml kanamycin for selection.

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. Chemically competent E. coli Top10 were transformed with 2.5 µl of the mixture and plated on LB agar supplemented with 50 µg/ml kanamycin for selection.

Derivative Assay:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon). .. Based on semi-quantitative gel analysis, similar amounts of uAUG-specific amplicons derived from individual cancer samples were pooled and purified using the Invisorb Spin DNA extraction Kit (Stratec).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites ( Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Generated:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs). .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Generation of constructs for luciferase reporter assays TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Polymerase Chain Reaction:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg). .. Luciferase reporter assays Firefly (custom-made Firefly luciferase vectors with inserted TLSs) and Renilla (pRL-CMV vector, Promega) luciferase activities and mRNA levels were measured in luciferase reporter assays and real-time PCR analysis (Firefly for: ATCCATCTTGCTCCAACACC, Firefly rev: TCGCGGTTGTTACTTGACTG; Renilla for: GGAATTATAATGCTTATCTACGTGC, Renilla rev: CTTGCGAAAAATGAAGACCTTTTAC) as described previously .

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Paragraph title: Multiplex identifier-tagged PCR deep sequencing approach ... DNA Polymerase (Roboklon).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites ( Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Binding Assay:

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: Mutants of conserved miRNA binding sites were produced by site‐directed mutagenesis using Pfu Plus! .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

DNA Extraction:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs). .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon). .. Based on semi-quantitative gel analysis, similar amounts of uAUG-specific amplicons derived from individual cancer samples were pooled and purified using the Invisorb Spin DNA extraction Kit (Stratec).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites ( Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Mutagenesis:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Site directed mutagenesis of uORFs was performed using the Pfu Plus! .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions. ..

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Generation of constructs for luciferase reporter assays TLSs containing wild-type (wt) or mutant uORF start sites were synthesized (GeneArt, ThermoFisher Scientific) or generated by PCR amplification and subsequent mutagenesis (Supplementary Table ). .. DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg.

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: Paragraph title: Mutagenesis ... DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl.

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: Paragraph title: Mutagenesis ... DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl.

Labeling:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon). .. All primers contained a 5′-extending universal linker sequence (CTCGAGATCT) to facilitate subsequent patient-specific labeling of individual amplicons. uAUG-specific PCRs were prepared using the Tecan Evo Pipetting Workstation equipped with a 384 multichannel pipetting head with disposable tips (Tecan AG, Switzerland).

Purification:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites (Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs). .. DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon). .. Based on semi-quantitative gel analysis, similar amounts of uAUG-specific amplicons derived from individual cancer samples were pooled and purified using the Invisorb Spin DNA extraction Kit (Stratec).

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: DNA Polymerase (Roboklon) on genomic DNA derived from the HEK293 cell line for EPHA3 , EPHB1 and MAP2K6 and on HEK-derived cDNA for BLK together with customized PCR primers harboring overhangs for enzymatic restriction (in capital letters): BLK for: ACGGCTAGCcacacagatggcacatggca, BLK rev: GTGCCGCGGCCATccttggcaatgcttca; EPHA3 for: CACGCTAGCcccgctctgcttcagcgcac, EPHA3 rev: GGACCGCGGCCATgttgctggtgcagagg; EPHB1 for: TGCCCCGGGgtcagtctggccggctccgt, EPHB1 rev: CCCAGATCTCCATcgccggccgacggccc; MAP2K6 for: TTTGCTAGCagttccaagtttggagcttt, MAP2K6 rev: GTTCCGCGGACATtttcccctttcctttg. .. PCR-amplified or synthesized TLSs excised from purchased vectors were purified using the Invisorb Spin DNA extraction Kit (Stratec) and cloned via flanking restriction sites ( Bgl II–AGATCT, Nhe I–GCTAGC, Sac II–CCGCGG, Sma I–CCCGGG) into a previously generated, custom-made Firefly luciferase reporter system using T4 DNA ligase (New England Biolabs).

Sequencing:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Paragraph title: Multiplex identifier-tagged PCR deep sequencing approach ... DNA Polymerase (Roboklon).

Plasmid Preparation:

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: 3′ UTRs of Prr7 , Src , Cnih2 ( ) and Dlgap3 ( ) were amplified either from mouse genomic DNA or from mouse cDNA and cloned into the pmirGLO dual‐luciferase expression vector. .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Multiplex Assay:

Article Title: Loss-of-function uORF mutations in human malignancies
Article Snippet: Paragraph title: Multiplex identifier-tagged PCR deep sequencing approach ... DNA Polymerase (Roboklon).

Selection:

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. Chemically competent E. coli Top10 were transformed with 2.5 µl of the mixture and plated on LB agar supplemented with 50 µg/ml kanamycin for selection.

Article Title: Specificity and mechanism of carbohydrate demethylation by cytochrome P450 monooxygenases
Article Snippet: DNA polymerase (5.0 U/µl; roboklon), 2.5 µl 10× Pfu -buffer, 1.25 µl forward and reverse primer (10 µM), 0.5 µl dNTPs (10 mM each), ∼40 ng template DNA and water added to a total volume of 25 µl. .. Chemically competent E. coli Top10 were transformed with 2.5 µl of the mixture and plated on LB agar supplemented with 50 µg/ml kanamycin for selection.

Produced:

Article Title: A placental mammal‐specific microRNA cluster acts as a natural brake for sociability in mice
Article Snippet: Mutants of conserved miRNA binding sites were produced by site‐directed mutagenesis using Pfu Plus! .. DNA Polymerase (Roboklon) or with the QuikChange Site‐Directed Mutagenesis kit (Stratagene) according to manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Roboklon dna polymerase
    Target sets and workflow of the <t>PCR-based,</t> multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer <t>DNA</t> (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.
    Dna Polymerase, supplied by Roboklon, used in various techniques. Bioz Stars score: 98/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Roboklon
    Average 98 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    92
    Roboklon taq dna polymerase
    Target sets and workflow of the <t>PCR-based,</t> multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer <t>DNA</t> (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.
    Taq Dna Polymerase, supplied by Roboklon, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Roboklon
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Target sets and workflow of the PCR-based, multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer DNA (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.

    Journal: Scientific Reports

    Article Title: Loss-of-function uORF mutations in human malignancies

    doi: 10.1038/s41598-018-19201-8

    Figure Lengend Snippet: Target sets and workflow of the PCR-based, multiplex identifier-tagged deep sequencing approach. ( A ) Composition of the cancer sample set with numbers indicating sample sizes of investigated malignant entities: ALL – acute lymphoblastic leukemia, AML – acute myeloid leukemia, NHL – non-Hodgkin lymphoma, OS – osteosarcoma, CA – colon adenocarcinoma, CX – colon xenograft, LA – lung adenocarcinoma, LX – lung xenograft, MC – mammary carcinoma. ( B ) Composition of the target gene set consisting of indicated numbers of uORF-bearing tyrosine kinases 5 , previously validated proto-oncogenes 18 and genes post-transcriptionally induced in cancer cell lines 19 (see also Supplementary Table 1 ). ( C ) Flow chart displaying amplification and normalization steps allowing simultaneous deep sequencing of 404 uORF initiation sites of 132 target genes in 308 individual cancer samples. Briefly, genomic regions of uAUG targets were amplified individually from every cancer DNA (see also Supplementary Table 7 ). uAUG-specific amplicons of each cancer sample were pooled and labeled with cancer-specific MID-tags in a second round of PCR (see also Supplementary Table 8 ). After normalization and pooling of all MID-tagged amplicons, a deep sequencing library was generated and analyzed using the Illumina® HiSeq2000 sequencing system.

    Article Snippet: DNA Polymerase (Roboklon) and customized PCR primers (BLK-mut for: gtggcgttccgctccTTGactgtcgcgcggccg, BLK-mut rev: cggccgcgcgacagtCAAggagcggaacgccac; EPHA3-mut for: tcagtggcatgcttcTTGgagatatgctcctct, EPHA3-mut rev: agaggagcatatctcCAAgaagcatgccactga; EPHB1-mut for: aacacacacacacacGTGcacacccacacccac, EPHB1-mut rev: gtgggtgtgggtgtgCACgtgtgtgtgtgtgtt; MAP2K6-mut for: cagccctggcccatcACGtagctgcagcacagc, MAP2K6-mut rev: gctgtgctgcagctaCGTgatgggccagggctg).

    Techniques: Polymerase Chain Reaction, Multiplex Assay, Sequencing, Flow Cytometry, Amplification, Labeling, Generated

    XopH phytase activity affects plant hormone pathways. a qRT-PCR analysis of N. benthamiana leaves transiently expressing XopH and mutant derivatives, untreated or 20 min post wounding. ev empty T-DNA. Asterisks indicate statistically significant differences to corresponding ev samples (Mann–Whitney test; * p

    Journal: Nature Communications

    Article Title: A 1-phytase type III effector interferes with plant hormone signaling

    doi: 10.1038/s41467-017-02195-8

    Figure Lengend Snippet: XopH phytase activity affects plant hormone pathways. a qRT-PCR analysis of N. benthamiana leaves transiently expressing XopH and mutant derivatives, untreated or 20 min post wounding. ev empty T-DNA. Asterisks indicate statistically significant differences to corresponding ev samples (Mann–Whitney test; * p

    Article Snippet: XopH derivatives and controls Generally, DNA fragments were amplified using Hybrid DNA Polymerase (Roboklon, Berlin, Germany) unless stated otherwise.

    Techniques: Activity Assay, Quantitative RT-PCR, Expressing, Mutagenesis, MANN-WHITNEY