Structured Review

Promega dna polymerase
Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of <t>DNA</t> transposable elements in the <t>BFP-ToxAC</t> reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/Promega
Average 99 stars, based on 20 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence"

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.112.004044

Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
Figure Legend Snippet: Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

Techniques Used: HAT Assay, Sequencing

2) Product Images from "Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes"

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2017.01009

Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.
Figure Legend Snippet: Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

3) Product Images from "YqfS from Bacillus subtilis Is a Spore Protein and a New Functional Member of the Type IV Apurinic/Apyrimidinic-Endonuclease Family"

Article Title: YqfS from Bacillus subtilis Is a Spore Protein and a New Functional Member of the Type IV Apurinic/Apyrimidinic-Endonuclease Family

Journal: Journal of Bacteriology

doi: 10.1128/JB.185.18.5380-5390.2003

Determination of 3′-phosphatase (A), 5′-phosphatase (B), and 3′-exonuclease (C) activities for YqfS. (A) The ability of either E. coli Nfo (1 U), His 6 -YqfS (YqfS) (500 ng), or alkaline phosphatase (A.P.) (1 U) to stimulate the nick translation activity of DNA containing 3′-phosphate termini was determined as described in Materials and Methods. Error bars show standard deviation. (B) 5′-Phosphatase activity was determined as described in Materials and Methods to either E. coli Nfo (1 U), His 6 -YqfS (500 ng) or alkaline phosphatase (1 U). (C) 3′-Exonuclease activity was determined as described in Materials and Methods to either, E. coli Nfo (1 U), His 6 -YqfS (500 ng), or ExoIII (100 U). C, no added enzyme. For all three panels, the y axis shows counts per minute incorporated (A, 10 5 ; B, 10 5 ; C, 10 4 ). The data are expressed as averages of two independent duplicate determinations.
Figure Legend Snippet: Determination of 3′-phosphatase (A), 5′-phosphatase (B), and 3′-exonuclease (C) activities for YqfS. (A) The ability of either E. coli Nfo (1 U), His 6 -YqfS (YqfS) (500 ng), or alkaline phosphatase (A.P.) (1 U) to stimulate the nick translation activity of DNA containing 3′-phosphate termini was determined as described in Materials and Methods. Error bars show standard deviation. (B) 5′-Phosphatase activity was determined as described in Materials and Methods to either E. coli Nfo (1 U), His 6 -YqfS (500 ng) or alkaline phosphatase (1 U). (C) 3′-Exonuclease activity was determined as described in Materials and Methods to either, E. coli Nfo (1 U), His 6 -YqfS (500 ng), or ExoIII (100 U). C, no added enzyme. For all three panels, the y axis shows counts per minute incorporated (A, 10 5 ; B, 10 5 ; C, 10 4 ). The data are expressed as averages of two independent duplicate determinations.

Techniques Used: Nick Translation, Activity Assay, Standard Deviation

4) Product Images from "Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae"

Article Title: Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae

Journal: Virology Journal

doi: 10.1186/1743-422X-8-38

Agarose gel electrophoresis of the cDNA obtained by the single-primer amplification technique . (A) Lane St, MassRuler™ DNA Ladder 80-10,000 bp (Fermentas); lanes 1 and 2, PCR fragment corresponding to cDNA obtained from 2.2 kbp dsRNA from B. cinerea CCg378. The numbers on the left side indicate molecular sizes expressed in kilobase pairs (kbp). (B) Analysis of the digestion patterns with restriction enzymes of the recombinant plasmid (pGEM-T easy + cDNA) containing as insert the cDNA shown in (A). Lane St, Lambda DNA/ Eco RI + Hin dIII marker; lane 1, recombinant plasmid treated with Nco I; lane 2, recombinant plasmid treated with Nco I and Spe I; lane 3, recombinant plasmid without treatment. The numbers on the left side indicate molecular sizes expressed in kilobase pairs (kbp).
Figure Legend Snippet: Agarose gel electrophoresis of the cDNA obtained by the single-primer amplification technique . (A) Lane St, MassRuler™ DNA Ladder 80-10,000 bp (Fermentas); lanes 1 and 2, PCR fragment corresponding to cDNA obtained from 2.2 kbp dsRNA from B. cinerea CCg378. The numbers on the left side indicate molecular sizes expressed in kilobase pairs (kbp). (B) Analysis of the digestion patterns with restriction enzymes of the recombinant plasmid (pGEM-T easy + cDNA) containing as insert the cDNA shown in (A). Lane St, Lambda DNA/ Eco RI + Hin dIII marker; lane 1, recombinant plasmid treated with Nco I; lane 2, recombinant plasmid treated with Nco I and Spe I; lane 3, recombinant plasmid without treatment. The numbers on the left side indicate molecular sizes expressed in kilobase pairs (kbp).

Techniques Used: Agarose Gel Electrophoresis, Amplification, Polymerase Chain Reaction, Recombinant, Plasmid Preparation, Lambda DNA Preparation, Marker

5) Product Images from "YqfS from Bacillus subtilis Is a Spore Protein and a New Functional Member of the Type IV Apurinic/Apyrimidinic-Endonuclease Family"

Article Title: YqfS from Bacillus subtilis Is a Spore Protein and a New Functional Member of the Type IV Apurinic/Apyrimidinic-Endonuclease Family

Journal: Journal of Bacteriology

doi: 10.1128/JB.185.18.5380-5390.2003

Determination of 3′-phosphatase (A), 5′-phosphatase (B), and 3′-exonuclease (C) activities for YqfS. (A) The ability of either E. coli Nfo (1 U), His 6 -YqfS (YqfS) (500 ng), or alkaline phosphatase (A.P.) (1 U) to stimulate the nick translation activity of DNA containing 3′-phosphate termini was determined as described in Materials and Methods. Error bars show standard deviation. (B) 5′-Phosphatase activity was determined as described in Materials and Methods to either E. coli Nfo (1 U), His 6 -YqfS (500 ng) or alkaline phosphatase (1 U). (C) 3′-Exonuclease activity was determined as described in Materials and Methods to either, E. coli Nfo (1 U), His 6 -YqfS (500 ng), or ExoIII (100 U). C, no added enzyme. For all three panels, the y axis shows counts per minute incorporated (A, 10 5 ; B, 10 5 ; C, 10 4 ). The data are expressed as averages of two independent duplicate determinations.
Figure Legend Snippet: Determination of 3′-phosphatase (A), 5′-phosphatase (B), and 3′-exonuclease (C) activities for YqfS. (A) The ability of either E. coli Nfo (1 U), His 6 -YqfS (YqfS) (500 ng), or alkaline phosphatase (A.P.) (1 U) to stimulate the nick translation activity of DNA containing 3′-phosphate termini was determined as described in Materials and Methods. Error bars show standard deviation. (B) 5′-Phosphatase activity was determined as described in Materials and Methods to either E. coli Nfo (1 U), His 6 -YqfS (500 ng) or alkaline phosphatase (1 U). (C) 3′-Exonuclease activity was determined as described in Materials and Methods to either, E. coli Nfo (1 U), His 6 -YqfS (500 ng), or ExoIII (100 U). C, no added enzyme. For all three panels, the y axis shows counts per minute incorporated (A, 10 5 ; B, 10 5 ; C, 10 4 ). The data are expressed as averages of two independent duplicate determinations.

Techniques Used: Nick Translation, Activity Assay, Standard Deviation

6) Product Images from "NOD Mice Are Defective in Proteasome Production and Activation of NF-?B"

Article Title: NOD Mice Are Defective in Proteasome Production and Activation of NF-?B

Journal: Molecular and Cellular Biology

doi:

Comparison of the DNA-binding activities of NF-κB in lymphocyte-enriched lung cells of NOD mice and control BALB/c Mice. (A) NF-κB DNA-binding activity in the indicated amounts of nuclear extract (N.E.) of lymphocyte-enriched lung cells from male (M) and female (F) NOD and BALB/c mice, as well as that in nuclear extract of TNF-α-treated Molt-4 cells, was analyzed by EMSA with a 32 P-labeled oligonucleotide (κB1) containing the κB binding motif. Lane 1 corresponds to a negative control in which nuclear extract was not added to the reaction mixture. The arrowhead indicates the putative NF-κB–DNA complexes. (B) NF-κB DNA-binding activity in cytosolic extract (C.E.) prepared from lung lymphocytes of male and female NOD and BALB/c mice, as well as that in cytosolic extract of Molt-4 cells, was analyzed by EMSA with 32 P-labeled κB1 oligonucleotide after incubation with (+) or without (−) NP-40 and deoxycholate detergents. Lane 1 corresponds to a negative control in which extract was not added. (C and D) Supershift analysis of the κB-binding proteins in lung cell nuclear extracts from NOD and BALB/C mice. Nuclear extracts were incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (C) or p65 (D) before EMSA analysis with the κB1 oligonucleotide. Original DNA-protein complexes (NF-κB) and supershifted DNA-protein complexes (S-NF-κB) are indicated by arrows. Lanes 9 and 10 correspond to control incubations performed with nuclear extract of TNF-α-treated Molt-4 cells.
Figure Legend Snippet: Comparison of the DNA-binding activities of NF-κB in lymphocyte-enriched lung cells of NOD mice and control BALB/c Mice. (A) NF-κB DNA-binding activity in the indicated amounts of nuclear extract (N.E.) of lymphocyte-enriched lung cells from male (M) and female (F) NOD and BALB/c mice, as well as that in nuclear extract of TNF-α-treated Molt-4 cells, was analyzed by EMSA with a 32 P-labeled oligonucleotide (κB1) containing the κB binding motif. Lane 1 corresponds to a negative control in which nuclear extract was not added to the reaction mixture. The arrowhead indicates the putative NF-κB–DNA complexes. (B) NF-κB DNA-binding activity in cytosolic extract (C.E.) prepared from lung lymphocytes of male and female NOD and BALB/c mice, as well as that in cytosolic extract of Molt-4 cells, was analyzed by EMSA with 32 P-labeled κB1 oligonucleotide after incubation with (+) or without (−) NP-40 and deoxycholate detergents. Lane 1 corresponds to a negative control in which extract was not added. (C and D) Supershift analysis of the κB-binding proteins in lung cell nuclear extracts from NOD and BALB/C mice. Nuclear extracts were incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (C) or p65 (D) before EMSA analysis with the κB1 oligonucleotide. Original DNA-protein complexes (NF-κB) and supershifted DNA-protein complexes (S-NF-κB) are indicated by arrows. Lanes 9 and 10 correspond to control incubations performed with nuclear extract of TNF-α-treated Molt-4 cells.

Techniques Used: Binding Assay, Mouse Assay, Activity Assay, Labeling, Negative Control, Incubation

Comparison of basal (−) and TNF-α-induced (+) NF-κB DNA-binding activities of and expression of NF-κB subunits and degradation of IκBα by BALB/c and NOD mouse spleen cells. (A) NF-κB DNA-binding activity was examined by EMSA using the κB1 oligonucleotide and nuclear extracts (N.E.) prepared from NOD and BALB/c mouse (male [M] and female [F]) spleen cells after incubation of cells for 4 h in the absence (−) or presence (+) of TNF-α (10 ng/ml). The results of an identical experiment with Molt-4 cells are also shown (lanes 10 and 11). Lane 1 corresponds to a negative control in which no nuclear extract was added to the reaction mixture. The arrowhead indicates specific DNA-protein complexes. The X-ray film was exposed for 12 h at −70°C. (B) NF-κB DNA-binding activity in cytosolic extracts (C.E.) of male and female BALB/c and NOD mouse spleen cells (unstimulated) or of Molt-4 cells was analyzed by EMSA with the κB1 oligonucleotide after incubation of extracts with (+) or without (−) NP-40 and deoxycholate detergent. Lane 1 corresponds to a negative control in which cytosolic extract was not added to the reaction mixture. (C) Spleen cells from male or female BALB/c (upper panel) or NOD (lower panel) mice were treated with TNF-α (10 ng/ml) for 4 h. Nuclear extracts were then prepared and incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (α-p50Ab), to 65 (α-p65Ab), or to C/EBP (α-C/EBPAb) before EMSA with the κB1 oligonucleotide. Lanes 1 represent negative controls in which nuclear extract was not added to the reaction mixtures. Original DNA-protein complexes (NF-κB) and supershifted complexes (S-NF-κB) are indicated by arrowheads. The X-ray films (upper and lower panels) were exposed for 12 h at −70°C. (D) Immunoblot analysis of NF-κB subunits (p50, p52, p105, p65, and p100), c-Re1, IκBα, and CDKs in unstimulated BALB/c and NOD mouse spleen cells. Cytosolic and nuclear extracts of spleen cells from male or female BALB/c or NOD mice were subjected to immunoblot analysis with antibodies to the indicated proteins. (E) Effect of TNF-α on the abundance of IκBα in spleen cells of BALB/c and NOD mice. Spleen cells isolated from BALB/c or NOD mice were incubated with TNF-α (10 ng/ml) for the indicated periods of time, after which cytosolic extracts were prepared and subjected to immunoblot analysis with antibodies to IκBα or to CDKs.
Figure Legend Snippet: Comparison of basal (−) and TNF-α-induced (+) NF-κB DNA-binding activities of and expression of NF-κB subunits and degradation of IκBα by BALB/c and NOD mouse spleen cells. (A) NF-κB DNA-binding activity was examined by EMSA using the κB1 oligonucleotide and nuclear extracts (N.E.) prepared from NOD and BALB/c mouse (male [M] and female [F]) spleen cells after incubation of cells for 4 h in the absence (−) or presence (+) of TNF-α (10 ng/ml). The results of an identical experiment with Molt-4 cells are also shown (lanes 10 and 11). Lane 1 corresponds to a negative control in which no nuclear extract was added to the reaction mixture. The arrowhead indicates specific DNA-protein complexes. The X-ray film was exposed for 12 h at −70°C. (B) NF-κB DNA-binding activity in cytosolic extracts (C.E.) of male and female BALB/c and NOD mouse spleen cells (unstimulated) or of Molt-4 cells was analyzed by EMSA with the κB1 oligonucleotide after incubation of extracts with (+) or without (−) NP-40 and deoxycholate detergent. Lane 1 corresponds to a negative control in which cytosolic extract was not added to the reaction mixture. (C) Spleen cells from male or female BALB/c (upper panel) or NOD (lower panel) mice were treated with TNF-α (10 ng/ml) for 4 h. Nuclear extracts were then prepared and incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (α-p50Ab), to 65 (α-p65Ab), or to C/EBP (α-C/EBPAb) before EMSA with the κB1 oligonucleotide. Lanes 1 represent negative controls in which nuclear extract was not added to the reaction mixtures. Original DNA-protein complexes (NF-κB) and supershifted complexes (S-NF-κB) are indicated by arrowheads. The X-ray films (upper and lower panels) were exposed for 12 h at −70°C. (D) Immunoblot analysis of NF-κB subunits (p50, p52, p105, p65, and p100), c-Re1, IκBα, and CDKs in unstimulated BALB/c and NOD mouse spleen cells. Cytosolic and nuclear extracts of spleen cells from male or female BALB/c or NOD mice were subjected to immunoblot analysis with antibodies to the indicated proteins. (E) Effect of TNF-α on the abundance of IκBα in spleen cells of BALB/c and NOD mice. Spleen cells isolated from BALB/c or NOD mice were incubated with TNF-α (10 ng/ml) for the indicated periods of time, after which cytosolic extracts were prepared and subjected to immunoblot analysis with antibodies to IκBα or to CDKs.

Techniques Used: Binding Assay, Expressing, Activity Assay, Incubation, Negative Control, Mouse Assay, Isolation

Comparison of TNF-α-induced NF-κB DNA-binding activities of and expression of NF-κB subunits and degradation of IκBα by BALB/c and Lmp2 −/− mouse spleen cells. (A) NF-κB DNA-binding activity was examined by EMSA using the κB1 oligonucleotide and nuclear extracts (N.E.) prepared from Lmp2 −/− and BALB/c mouse (male [M] and female [F]) spleen cells after incubation of cells for 4 h in the absence (−) or presence (+) of TNF-α (10 ng/ml). The results of an identical experiment with Molt-4 cells are also shown (lanes 10 and 11). Lane 1 corresponds to a negative control in which no nuclear extract was added to the reaction mixture. The arrowhead indicates specific DNA-protein complexes. (B) NF-κB DNA-binding activity in cytosolic extracts (C.E.) of male or female BALB/c and Lmp2 −/− mouse spleen cells (unstimulated) or of Molt-4 cells was analyzed by EMSA with the κB1 oligonucleotide after incubation of extracts with (+) or without (−) NP-40 and deoxycholate detergent. Lane 1 corresponds to a negative control in which cytosolic extract was not added to the reaction mixture. (C) Spleen cells from male or female BALB/c (upper panel) or Lmp2 −/− (lower panel) mice were treated with TNF-α (10 ng/ml) for 4 h. Nuclear extracts were then prepared and incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (α-p50Ab), to p65 (α-p65Ab), or to C/EBP (α-C/EBPAb) before EMSA with the κB1 oligonucleotide. Lanes 1 represent negative controls in which nuclear extract was not added to the reaction mixtures. Original DNA-protein complexes (NF-κB) and supershifted complexes (S-NF-κB) are indicated by arrowheads. (D) Immunoblot analysis of NF-κB subunits (p50, p52, p105, p65, and p100), c-Rel, IκBα, and CDKs in unstimulated BALB/c and NOD mice spleen cells. Cytosolic and nuclear extracts of spleen cells from male or female BALB/c or Lmp2 −/− mice were subjected to immunoblot analysis with antibodies to the indicated proteins. (E) Effect of TNF-α on the abundance of IκBα in spleen cells of BALB/c and Lmp2 −/− mice. Spleen cells isolated from BALB/c and Lmp2 −/− mice were incubated with TNF-α (10 ng/ml) for the indicated periods of time, after which cytosolic extracts were prepared and subjected to immunoblot analysis with antibodies to IκBα or to CDKs.
Figure Legend Snippet: Comparison of TNF-α-induced NF-κB DNA-binding activities of and expression of NF-κB subunits and degradation of IκBα by BALB/c and Lmp2 −/− mouse spleen cells. (A) NF-κB DNA-binding activity was examined by EMSA using the κB1 oligonucleotide and nuclear extracts (N.E.) prepared from Lmp2 −/− and BALB/c mouse (male [M] and female [F]) spleen cells after incubation of cells for 4 h in the absence (−) or presence (+) of TNF-α (10 ng/ml). The results of an identical experiment with Molt-4 cells are also shown (lanes 10 and 11). Lane 1 corresponds to a negative control in which no nuclear extract was added to the reaction mixture. The arrowhead indicates specific DNA-protein complexes. (B) NF-κB DNA-binding activity in cytosolic extracts (C.E.) of male or female BALB/c and Lmp2 −/− mouse spleen cells (unstimulated) or of Molt-4 cells was analyzed by EMSA with the κB1 oligonucleotide after incubation of extracts with (+) or without (−) NP-40 and deoxycholate detergent. Lane 1 corresponds to a negative control in which cytosolic extract was not added to the reaction mixture. (C) Spleen cells from male or female BALB/c (upper panel) or Lmp2 −/− (lower panel) mice were treated with TNF-α (10 ng/ml) for 4 h. Nuclear extracts were then prepared and incubated in the absence (−) or presence (+) of polyclonal antibodies to p50 (α-p50Ab), to p65 (α-p65Ab), or to C/EBP (α-C/EBPAb) before EMSA with the κB1 oligonucleotide. Lanes 1 represent negative controls in which nuclear extract was not added to the reaction mixtures. Original DNA-protein complexes (NF-κB) and supershifted complexes (S-NF-κB) are indicated by arrowheads. (D) Immunoblot analysis of NF-κB subunits (p50, p52, p105, p65, and p100), c-Rel, IκBα, and CDKs in unstimulated BALB/c and NOD mice spleen cells. Cytosolic and nuclear extracts of spleen cells from male or female BALB/c or Lmp2 −/− mice were subjected to immunoblot analysis with antibodies to the indicated proteins. (E) Effect of TNF-α on the abundance of IκBα in spleen cells of BALB/c and Lmp2 −/− mice. Spleen cells isolated from BALB/c and Lmp2 −/− mice were incubated with TNF-α (10 ng/ml) for the indicated periods of time, after which cytosolic extracts were prepared and subjected to immunoblot analysis with antibodies to IκBα or to CDKs.

Techniques Used: Binding Assay, Expressing, Activity Assay, Incubation, Negative Control, Mouse Assay, Isolation

Effects of TNF-α on survival of spleen cells derived from BALB/c, NOD, and Lmp2 −/− mice. (A) Spleen cells from male or female BALB/c or NOD mice were incubated with various concentrations of TNF-α for 24 h, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± standard deviations (SD) of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding non-TNF-α-exposed cells. (B) Spleen cells from three different male or female BALB/c or NOD mice were incubated for 24 h with (+) or without (−) TNF-α (10 ng/ml), after which DNA fragmentation was analyzed by agarose gel electrophoresis and ethidium bromide staining. (C) Spleen cells from male or female BALB/c or Lmp2 −/− mice were incubated with various concentrations of TNF-α for 24 h, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± SD of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding cells not exposed to TNF-α. (D) Spleen cells from three different male (M) or female (F) BALB/c or Lmp2 −/− mice were incubated for 24 h with or without TNF-α (10 ng/ml), after which DNA fragmentation was analyzed by agarose gel electrophoresis and ethidium bromide staining. (E) Embryonic macrophages obtained from BALB/c, NOD, or Lmp2 −/− 13.5-day fetal livers were treated with various concentrations of TNF-α for 24 h or were treated with TNF-α (10 ng/ml) for various time periods, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± SD of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding cells not exposed to TNF-α.
Figure Legend Snippet: Effects of TNF-α on survival of spleen cells derived from BALB/c, NOD, and Lmp2 −/− mice. (A) Spleen cells from male or female BALB/c or NOD mice were incubated with various concentrations of TNF-α for 24 h, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± standard deviations (SD) of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding non-TNF-α-exposed cells. (B) Spleen cells from three different male or female BALB/c or NOD mice were incubated for 24 h with (+) or without (−) TNF-α (10 ng/ml), after which DNA fragmentation was analyzed by agarose gel electrophoresis and ethidium bromide staining. (C) Spleen cells from male or female BALB/c or Lmp2 −/− mice were incubated with various concentrations of TNF-α for 24 h, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± SD of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding cells not exposed to TNF-α. (D) Spleen cells from three different male (M) or female (F) BALB/c or Lmp2 −/− mice were incubated for 24 h with or without TNF-α (10 ng/ml), after which DNA fragmentation was analyzed by agarose gel electrophoresis and ethidium bromide staining. (E) Embryonic macrophages obtained from BALB/c, NOD, or Lmp2 −/− 13.5-day fetal livers were treated with various concentrations of TNF-α for 24 h or were treated with TNF-α (10 ng/ml) for various time periods, after which cell viability was assessed by the trypan blue exclusion method. Data are means ± SD of four replicates from a representative experiment and are expressed as percentages of the survival values for the corresponding cells not exposed to TNF-α.

Techniques Used: Derivative Assay, Mouse Assay, Incubation, Agarose Gel Electrophoresis, Staining

7) Product Images from "Identification of Hepatocystis species in a macaque monkey in northern Myanmar"

Article Title: Identification of Hepatocystis species in a macaque monkey in northern Myanmar

Journal: Research and Reports in Tropical Medicine

doi: 10.2147/RRTM.S27182

Polymerase chain reaction amplification of 18S SSU rRNA and cytochrome b genes. ( A ) Nested polymerase chain reaction amplification of the 18S SSU rRNA gene using the primers rPLU3 and rPLU4 matched to all pathogenic Plasmodium species. Lane 1 is a positive control. Lanes 2–11 are products of amplification of 10 monkey blood samples, and lane 12 is a negative control without DNA. ( B ) The 18S SSU rRNA and the cytochrome b genes were amplified by nested polymerase chain reaction with specific primers to the sequences of Hepatocystis species. Lanes 1 and 2 were the amplicons of 18S SSU rRNA using the primers CHN18-R and CHN18-F and the cytochrome b genes with the primers CHNb 3 and CHNb 4, respectively.
Figure Legend Snippet: Polymerase chain reaction amplification of 18S SSU rRNA and cytochrome b genes. ( A ) Nested polymerase chain reaction amplification of the 18S SSU rRNA gene using the primers rPLU3 and rPLU4 matched to all pathogenic Plasmodium species. Lane 1 is a positive control. Lanes 2–11 are products of amplification of 10 monkey blood samples, and lane 12 is a negative control without DNA. ( B ) The 18S SSU rRNA and the cytochrome b genes were amplified by nested polymerase chain reaction with specific primers to the sequences of Hepatocystis species. Lanes 1 and 2 were the amplicons of 18S SSU rRNA using the primers CHN18-R and CHN18-F and the cytochrome b genes with the primers CHNb 3 and CHNb 4, respectively.

Techniques Used: Polymerase Chain Reaction, Amplification, Nested PCR, Positive Control, Negative Control

8) Product Images from "Multigene family isoform profiling from blood cell lineages"

Article Title: Multigene family isoform profiling from blood cell lineages

Journal: BMC Genomics

doi: 10.1186/1471-2164-3-22

Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (
Figure Legend Snippet: Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (

Techniques Used: Polymerase Chain Reaction, Diagnostic Assay, Generated

Increasing efficiency of detection of low MW restriction fragments. Using Klenow DNA polymerase and a probe with a sub-family specific 3' end and 10x G residues at the 5' end, the efficiency of the labelling reaction could be increased ten fold. Degenerate sub-family centred PCR was performed using the Kir 2.0 subclones as template, labelled as described in Materials and Methods, and digested with Hinf I. Low molecular weight fragment (
Figure Legend Snippet: Increasing efficiency of detection of low MW restriction fragments. Using Klenow DNA polymerase and a probe with a sub-family specific 3' end and 10x G residues at the 5' end, the efficiency of the labelling reaction could be increased ten fold. Degenerate sub-family centred PCR was performed using the Kir 2.0 subclones as template, labelled as described in Materials and Methods, and digested with Hinf I. Low molecular weight fragment (

Techniques Used: Polymerase Chain Reaction, Molecular Weight

DNase I treatment of template prevents amplification of 500 bp product. Series of PCR reactions were performed on varying concentrations of clonal template DNA. Mass of template DNA (ng) and DNase I treatment (+/-) is indicated above the lanes. DNA ladder was run as molecular weight standard with sizes indicated (bp). Treatment with DNase I as described in Materials and Methods prevented amplification of 500 bp product from 10 μg of DNA. Gel image was scanned and processed using Adobe Photoshop Version 5.5.
Figure Legend Snippet: DNase I treatment of template prevents amplification of 500 bp product. Series of PCR reactions were performed on varying concentrations of clonal template DNA. Mass of template DNA (ng) and DNase I treatment (+/-) is indicated above the lanes. DNA ladder was run as molecular weight standard with sizes indicated (bp). Treatment with DNase I as described in Materials and Methods prevented amplification of 500 bp product from 10 μg of DNA. Gel image was scanned and processed using Adobe Photoshop Version 5.5.

Techniques Used: Amplification, Polymerase Chain Reaction, Molecular Weight

Related Articles

Clone Assay:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: We then compared cloning efficiency, in terms of number of colonies produced after transformation, for optimal ratio of vector and insert during Dpn I enzyme digestion and optimal amount of the vector-insert mixture used in transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. All the cloned sequences were finally confirmed by automated DNA sequencing at the DNA lab of the Arizona State University using primers in the vectors.

Amplification:

Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. To analyse PCR amplified fragments, 15 μL of the final PCR product was run on a 1.5% agarose (UltraPure™ , Invitrogen, Life Technologies, USA), 1 x TBE (50mMTris-Cl pH 8, 50mM Boric Acid, 1mM EDTA) gel.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: The results suggest that the best combination for colony formation is Phusion DNA polymerase amplification with 1:1 vector/insert ratio in Dpn I digestion and 2 μl of vector-insert mix for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

Positive Control:

Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. Negative controls containing RNA template and a positive control containing genomic DNA were subjected to the same procedure to exclude any possible contamination or to detect PCR inhibitors.

Synthesized:

Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
Article Snippet: With a GoScript Reverse Transcription System (Promega), first-strand cDNA was synthesized. .. The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA.

Construct:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

Incubation:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: Vectors and inserts were mixed with three different ratios (1:1, 1:2, and 1:4 with a total volume of 16 μl), and incubated at 37°C for 1 h. Different amounts (2, 4, and 8 μl) of the Dpn I-digested mixtures were then added into 40 μl of chemically competent XL-10 Gold E.coli cells for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

Modification:

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). .. Both UP3-16S-F and P6-16S-R primers were modified by one nucleotide to match the 16S rRNA sequence of U . parvum serovar 3 strain ATCC 27815 and U. urealyticum serovar 10 sequences in GenBank.

Transformation Assay:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: The results suggest that the best combination for colony formation is Phusion DNA polymerase amplification with 1:1 vector/insert ratio in Dpn I digestion and 2 μl of vector-insert mix for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

Generated:

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: Residual DNA was removed by Turbo DNA-free Kit DNase treatment (Ambion), and cDNA was generated from the RNA using the SuperScript III First Strand Synthesis System (Invitrogen) and a polyT primer. .. Subsequent PCR used GoTaq DNA polymerase (Promega).

Polymerase Chain Reaction:

Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
Article Snippet: .. Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. The PCR programme consisted of an initial 2 min step at 94°C, followed by 25 cycles of: 1) 15 sec at 94°C; 2) 15 sec at 50°C; and 3) 1 min and 30 sec at 72°C, followed by a final extension step of 10 min at 72°C.

Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
Article Snippet: .. To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. PCR were performed with denaturation at 95℃ for 30 sec, annealing at 60℃ for 1 min, and extension at 72℃ for 1min in each cycle, followed by a final 10 min extension at 72℃ using Px2 Thermal cycler HBPX2220 (Thermo electron corporation, Waltham, MA, USA).

Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
Article Snippet: .. The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The RPL3 sequence was picked up in two parts (p1 and p2) using following primers (5′-3′): p1_F GCACATCCACTTTCGTCAAG, p1_R CTAGGATGCCATGCTCCAAT, p2_F ACCAAGGGTCGTGGATACAA and p2_R CGCTGTGGCTTTCTCTTCTT.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
Article Snippet: .. The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. The PCR program consisted an initial denaturation phase at 95 °C for 5 min, followed by 40 cycles at 95 °C for 30 s, 57 °C annealing temperature for 20 s, 72 °C for 30 s, and a final extension at 72 °C for 10 min in a thermocycler (Bio-Rad, Hercules, USA).

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

Article Title: Unexpected Diversity of Chloroplast Noncoding RNAs as Revealed by Deep Sequencing of the Arabidopsis Transcriptome
Article Snippet: .. The following cycling protocol was used: initial denaturation at 98° for 30 s, then 35 cycles at 98° for 10 s, 64° for 20 s, and 72° for 60 s, and a final extension at 72° for 5 min. Nested PCR was performed using 1 μl of the initial PCR as a template with 0.2 μM each 3′ nested primer and GeneRacer 5′ nested primer, 200 nM each dNTP, and either 1X Phusion HF buffer with 0.02 U μL-1 Phusion DNA polymerase or 1X GoTaq buffer with 1.25 U GoTaq DNA polymerase in a 50 μL reaction volume. .. The cycling protocol used for nested PCR with Phusion polymerase was the same as above, except the annealing temperature was 65°.

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: .. Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

DNA Sequencing:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. All the cloned sequences were finally confirmed by automated DNA sequencing at the DNA lab of the Arizona State University using primers in the vectors.

Sequencing:

Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
Article Snippet: Primer design and PCR Gene-specific primers were designed using the program PrimerQuest from IDT ( http://eu.idtdna.com/PrimerQuest/Home/Index ) to amplify between 150–1200 bp of genomic sequence ( and Tables). .. Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL.

Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
Article Snippet: The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The RPL3 sequence was picked up in two parts (p1 and p2) using following primers (5′-3′): p1_F GCACATCCACTTTCGTCAAG, p1_R CTAGGATGCCATGCTCCAAT, p2_F ACCAAGGGTCGTGGATACAA and p2_R CGCTGTGGCTTTCTCTTCTT.

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). .. Both UP3-16S-F and P6-16S-R primers were modified by one nucleotide to match the 16S rRNA sequence of U . parvum serovar 3 strain ATCC 27815 and U. urealyticum serovar 10 sequences in GenBank.

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: Primers used were: 3′RACE adapter NV: GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN 3′RACE outer: GCGAGCACAGAATTAATACGACT bORF2-end2, GATGAGTTCATATCCTTTGTAGGG The sequence of the antisense RNA-FISH probe Cy2-MS2 was, Cy3-GTCGACCTGCAGACATGGGTGATCCTCATGTTTTCTAGGCAATTA. .. Subsequent PCR used GoTaq DNA polymerase (Promega).

Size-exclusion Chromatography:

Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. The PCR programme consisted of an initial 2 min step at 94°C, followed by 25 cycles of: 1) 15 sec at 94°C; 2) 15 sec at 50°C; and 3) 1 min and 30 sec at 72°C, followed by a final extension step of 10 min at 72°C.

Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
Article Snippet: To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. PCR were performed with denaturation at 95℃ for 30 sec, annealing at 60℃ for 1 min, and extension at 72℃ for 1min in each cycle, followed by a final 10 min extension at 72℃ using Px2 Thermal cycler HBPX2220 (Thermo electron corporation, Waltham, MA, USA).

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: After heat shock at 42°C for 45 sec, 350 μl of SOC medium was added to the mixture. .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep.

Labeling:

Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
Article Snippet: The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. For each marker, the forward PCR primer was 5̍ fluorescein labeled (Proligo, Cambridge, UK) allowing a precise analysis in an automated DNA sequencer.

Purification:

Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
Article Snippet: The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The remaining product was purified using the E.Z.N.A.

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: Cells were lysed and their RNA initially extracted with Trizol (Life Technologies), followed by further purification using an RNeasy Mini Kit (Qiagen). .. Subsequent PCR used GoTaq DNA polymerase (Promega).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

Lysis:

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

Nested PCR:

Article Title: Unexpected Diversity of Chloroplast Noncoding RNAs as Revealed by Deep Sequencing of the Arabidopsis Transcriptome
Article Snippet: .. The following cycling protocol was used: initial denaturation at 98° for 30 s, then 35 cycles at 98° for 10 s, 64° for 20 s, and 72° for 60 s, and a final extension at 72° for 5 min. Nested PCR was performed using 1 μl of the initial PCR as a template with 0.2 μM each 3′ nested primer and GeneRacer 5′ nested primer, 200 nM each dNTP, and either 1X Phusion HF buffer with 0.02 U μL-1 Phusion DNA polymerase or 1X GoTaq buffer with 1.25 U GoTaq DNA polymerase in a 50 μL reaction volume. .. The cycling protocol used for nested PCR with Phusion polymerase was the same as above, except the annealing temperature was 65°.

Chromatin Immunoprecipitation:

Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

Plasmid Preparation:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

Article Title: Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes
Article Snippet: KOD DNA polymerase was purchased from Merck Millipore and Gotaq was obtained from Promega. .. Plasmid HydGdCTD5 (5.176 kb,PCR template) was provided by Professor Peter Roach at Southampton University School of Chemistry.

Multiplex Assay:

Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
Article Snippet: The PCR amplifications loci: R95529, SMC1, SMBR16, SMD57, SMDO11 are Multiplex1; SMDA28, SMS7, SMD28 are Multiplex2, and SMBR10, L46951, SMD25 are Multiplex 3. .. The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p.

Produced:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: We then compared cloning efficiency, in terms of number of colonies produced after transformation, for optimal ratio of vector and insert during Dpn I enzyme digestion and optimal amount of the vector-insert mixture used in transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

Concentration Assay:

Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

Marker:

Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
Article Snippet: The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. For each marker, the forward PCR primer was 5̍ fluorescein labeled (Proligo, Cambridge, UK) allowing a precise analysis in an automated DNA sequencer.

Staining:

Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
Article Snippet: To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. The histological study also used previously described methods for hematoxylin and eosin (H & E) staining [ ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega dna polymerase
    Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of <t>DNA</t> transposable elements in the <t>BFP-ToxAC</t> reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
    Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Promega
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    87
    Promega thermophilic dna polymerase
    (A) <t>ITS-PCR</t> patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp <t>DNA</t> ladder).
    Thermophilic Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 87/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermophilic dna polymerase/product/Promega
    Average 87 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    thermophilic dna polymerase - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    99
    Promega taq dna polymerase
    Superimposition of the thumb domains of <t>Taq</t> <t>DNA</t> polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
    Taq Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 503 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Promega
    Average 99 stars, based on 503 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

    Journal: G3: Genes|Genomes|Genetics

    Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    doi: 10.1534/g3.112.004044

    Figure Lengend Snippet: Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

    Article Snippet: For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega).

    Techniques: HAT Assay, Sequencing

    Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.

    Journal: Frontiers in Microbiology

    Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes

    doi: 10.3389/fmicb.2017.01009

    Figure Lengend Snippet: Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.

    Article Snippet: For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    (A) ITS-PCR patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp DNA ladder).

    Journal: Applied and Environmental Microbiology

    Article Title: Identification and Characterization of Leuconostoc fallax Strains Isolated from an Industrial Sauerkraut Fermentation †

    doi: 10.1128/AEM.68.6.2877-2884.2002

    Figure Lengend Snippet: (A) ITS-PCR patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp DNA ladder).

    Article Snippet: The typical 100-μl reaction mixture used for ITS-PCR analysis of Leuconostoc strains contained 70 μl of water, 50 pmol of each primer (Genosys Biotechnologies Inc., The Woodlands, Tex.), 10 μl of 25 mM MgCl2 (Promega), 10 μl of thermophilic DNA polymerase, 10× PCR buffer (Promega), 1 μl of a deoxynucleoside triphosphate mixture (Promega), and 0.2 μg of DNA template.

    Techniques: Polymerase Chain Reaction, Molecular Weight

    Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Sequencing

    Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

    Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Incubation

    The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Activity Assay, Labeling, Concentration Assay