Structured Review

Promega dna polymerase
Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of <t>DNA</t> transposable elements in the <t>BFP-ToxAC</t> reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/Promega
Average 95 stars, based on 20 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-02
95/100 stars

Images

1) Product Images from "Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence"

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.112.004044

Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
Figure Legend Snippet: Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

Techniques Used: HAT Assay, Sequencing

2) Product Images from "Multigene family isoform profiling from blood cell lineages"

Article Title: Multigene family isoform profiling from blood cell lineages

Journal: BMC Genomics

doi: 10.1186/1471-2164-3-22

Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (
Figure Legend Snippet: Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (

Techniques Used: Polymerase Chain Reaction, Diagnostic Assay, Generated

Increasing efficiency of detection of low MW restriction fragments. Using Klenow DNA polymerase and a probe with a sub-family specific 3' end and 10x G residues at the 5' end, the efficiency of the labelling reaction could be increased ten fold. Degenerate sub-family centred PCR was performed using the Kir 2.0 subclones as template, labelled as described in Materials and Methods, and digested with Hinf I. Low molecular weight fragment (
Figure Legend Snippet: Increasing efficiency of detection of low MW restriction fragments. Using Klenow DNA polymerase and a probe with a sub-family specific 3' end and 10x G residues at the 5' end, the efficiency of the labelling reaction could be increased ten fold. Degenerate sub-family centred PCR was performed using the Kir 2.0 subclones as template, labelled as described in Materials and Methods, and digested with Hinf I. Low molecular weight fragment (

Techniques Used: Polymerase Chain Reaction, Molecular Weight

DNase I treatment of template prevents amplification of 500 bp product. Series of PCR reactions were performed on varying concentrations of clonal template DNA. Mass of template DNA (ng) and DNase I treatment (+/-) is indicated above the lanes. DNA ladder was run as molecular weight standard with sizes indicated (bp). Treatment with DNase I as described in Materials and Methods prevented amplification of 500 bp product from 10 μg of DNA. Gel image was scanned and processed using Adobe Photoshop Version 5.5.
Figure Legend Snippet: DNase I treatment of template prevents amplification of 500 bp product. Series of PCR reactions were performed on varying concentrations of clonal template DNA. Mass of template DNA (ng) and DNase I treatment (+/-) is indicated above the lanes. DNA ladder was run as molecular weight standard with sizes indicated (bp). Treatment with DNase I as described in Materials and Methods prevented amplification of 500 bp product from 10 μg of DNA. Gel image was scanned and processed using Adobe Photoshop Version 5.5.

Techniques Used: Amplification, Polymerase Chain Reaction, Molecular Weight

Related Articles

Clone Assay:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. The PCR product was cloned into pGEM-T Easy vector and sequenced at the Central Services Lab in the Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR.

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: To remove the leader sequence of the scFv, a 564bp segment of the scFv was PCR amplified using the primers: 5′-CTAGTCTAGACTAGACATTGTACTGACCCAATC-3′ and 5′-TTTACTATTACCATTCGCAG-3′ cloned into XbaI/StuI digested. pGEM-T84.66scFv. .. The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ].

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: .. The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. ..

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The activity of this modified H1 promoter was validated by cloning different hairpin siRNA coding sequences targeting the Renilla luciferase gene into Bgl II and Hin dIII sites of the modified vector pMH and measuring the inhibitory effect of these siRNAs against Renilla luciferase activity by dual luciferase assay (Promega). .. The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid.

Amplification:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: To remove the leader sequence of the scFv, a 564bp segment of the scFv was PCR amplified using the primers: 5′-CTAGTCTAGACTAGACATTGTACTGACCCAATC-3′ and 5′-TTTACTATTACCATTCGCAG-3′ cloned into XbaI/StuI digested. pGEM-T84.66scFv. .. The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ].

Article Title: Key Role of Ser562/661 in Snf1-Dependent Regulation of Cat8p in Saccharomyces cerevisiae and Kluyveromyces lactis
Article Snippet: .. PCR amplification reactions were done with 2 U of DNA polymerase from Pyrococcus furiosus (Promega), 50 pmol of each primer, and 1 μg of genomic DNA with the following cycling procedure: 3 min at 95°C; 35 cycles of 1.5 min at 95°C, 1.5 min at 50°C, and 3 min at 72°C; and 10 min at 72°C. ..

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: .. PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega). .. The PCR was processed in a MyCycler Thermal Cycler and run for 35 cycles: denaturation (95°C, 45 s), annealing (55–56°C), and extension (72°C, 45 s) steps.

Article Title: PURIFICATION, MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF HL15-1-1 (HETEROMETRUS LAOTICUS TOXIN): THE FIRST MEMBER OF A NEW ?-KTX SUBFAMILY
Article Snippet: Second strand synthesis was performed using a degenerate primer R1 (5'-TGCAAAAAGGAGTGTTCTGG-3') and DNA polymerase I Klenow fragment (Promega). .. Primer R1 was designed against the N-terminal AA region CKKECSG. cDNA's were further amplified with primer R1, the oligo(dT) primer and Taq DNA polymerase (Fermentas) using the following PCR conditions: 3 min 95 °C, 30× (30 sec 95 °C, 30 sec 62 °C, 120 sec 72 °C) and 5 min 72 °C.

Article Title: Development of Experimental Genetic Tools for Campylobacter fetus ▿ ▿ †
Article Snippet: PCR products amplified from pSK108-1 with different primer pairs (p108_13f and p108_14r or p108_rep_5f and p108_rep_6r) were used to generate repE -specific probes. .. The DNA was radiolabeled internally with [α32 P]dCTP (3,000 Ci/mmol) and the Klenow fragment of DNA polymerase I by using the random priming kit (Promega).

Synthesized:

Article Title: Human sapovirus GI.2 and GI.3 from children with acute gastroenteritis in northern Brazil
Article Snippet: .. A second strand of cDNA was synthesized using DNA Polymerase I Lar e (Klenow) Fragment (Promega, WI, USA). .. Subsequently, a Nextera XT Sample Preparation Kit (Illumina, CA, USA) was used to construct a DNA library, identified using dual barcodes.

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers. .. PCR was performed using an iCycler (Bio-Rad Laboratories, UK) under the following conditions: Initial denaturation at 94°C for 5 min, followed by 12 cycles of 'touchdown’ PCR consisting of 30 s denaturation at 94°C and 1 min annealing between 72°C and 60°C (decreased 1°C at each cycle), 1 min at 60°C, 1 min elongation at 72°C, followed by 25 cycles denaturation for 30 s at 94°C, 1 min at 60°C, 1 min elongation at 72°C and a final extension of 15 min at 72°C.

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid. .. Oligonucleotides containing N18 C were synthesized, with a Bgl II site and AAAAA at their 5′ ends and TTTTT and a Hin dIII site at their 3′ ends (GAAGATCTAAAAAN18 CTTTTTAAGCTTGGGCCGCCG).

Construct:

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ]. .. All constructs were sequenced through the Lpp-OmpA and scFv regions.

Article Title: Differential virus restriction patterns of rhesus macaque and human APOBEC3A: implications for lentivirus evolution
Article Snippet: A plasmid with the genome of HIV-1 strain NL4-3 (referred to in the text as HIV-1) was used to construct a Δvif version (referred to in text as HIV-1Δ vif ) (pNL4-3; NIH AIDS Research and Reference Reagent Program). .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Article Title: Lentivirus Restriction by Diverse Primate APOBEC3A Proteins
Article Snippet: A plasmid with the genome of HIV-1 strain NL4-3 (referred to in the text as HIV-1) was used to construct a Δ vif version ( ; referred to in text as HIV-1Δ vif ) (pNL4-3; NIH AIDS Research and Reference Reagent Program). .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Article Title: Human sapovirus GI.2 and GI.3 from children with acute gastroenteritis in northern Brazil
Article Snippet: A second strand of cDNA was synthesized using DNA Polymerase I Lar e (Klenow) Fragment (Promega, WI, USA). .. Subsequently, a Nextera XT Sample Preparation Kit (Illumina, CA, USA) was used to construct a DNA library, identified using dual barcodes.

Article Title: First identification of mammalian orthoreovirus type 3 by gut virome analysis in diarrheic child in Brazil
Article Snippet: A second strand cDNA synthesis was performed using a DNA Polymerase I Large (Klenow) Fragment (Promega). .. Subsequently, a Nextera XT Sample Preparation Kit (Illumina, San Diego, CA, USA) was used to construct a DNA library, which was identified using dual barcodes.

Incubation:

Article Title: Human sapovirus GI.2 and GI.3 from children with acute gastroenteritis in northern Brazil
Article Snippet: After incubation, viral nucleic acids were extracted using ZR & ZR-96 Viral DNA/RNA Kit (Zymo Research, CA, USA) according to the manufacturer’s protocol. .. A second strand of cDNA was synthesized using DNA Polymerase I Lar e (Klenow) Fragment (Promega, WI, USA).

Article Title: First identification of mammalian orthoreovirus type 3 by gut virome analysis in diarrheic child in Brazil
Article Snippet: The resulting mixture was subsequently incubated at 37 °C for 2 h. After incubation, viral nucleic acids were extracted using a ZR & ZR-96 Viral DNA/RNA Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. .. A second strand cDNA synthesis was performed using a DNA Polymerase I Large (Klenow) Fragment (Promega).

Luciferase:

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The activity of this modified H1 promoter was validated by cloning different hairpin siRNA coding sequences targeting the Renilla luciferase gene into Bgl II and Hin dIII sites of the modified vector pMH and measuring the inhibitory effect of these siRNAs against Renilla luciferase activity by dual luciferase assay (Promega). .. The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid.

Activity Assay:

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The activity of this modified H1 promoter was validated by cloning different hairpin siRNA coding sequences targeting the Renilla luciferase gene into Bgl II and Hin dIII sites of the modified vector pMH and measuring the inhibitory effect of these siRNAs against Renilla luciferase activity by dual luciferase assay (Promega). .. The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid.

Expressing:

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: Paragraph title: 2.2.2. RNA Extraction and RT-PCR Analysis of Gene Expression ... PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega).

Touchdown PCR:

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers. .. PCR was performed using an iCycler (Bio-Rad Laboratories, UK) under the following conditions: Initial denaturation at 94°C for 5 min, followed by 12 cycles of 'touchdown’ PCR consisting of 30 s denaturation at 94°C and 1 min annealing between 72°C and 60°C (decreased 1°C at each cycle), 1 min at 60°C, 1 min elongation at 72°C, followed by 25 cycles denaturation for 30 s at 94°C, 1 min at 60°C, 1 min elongation at 72°C and a final extension of 15 min at 72°C.

Modification:

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: Restriction and modification enzymes for the constructions were obtained from New England Biolabs. phGHN-CAT : To generate phGHN-BSKSII, the hGH-N gene [2.6-kb Eco RI fragment R2 of Chen et al. ( ) extending 494 bp 5′ to the transcription start site and 530 bp 3′ to the polyadenylation site] was cloned into Bluescript II KS+ (Stratagene). .. The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT.

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The activity of this modified H1 promoter was validated by cloning different hairpin siRNA coding sequences targeting the Renilla luciferase gene into Bgl II and Hin dIII sites of the modified vector pMH and measuring the inhibitory effect of these siRNAs against Renilla luciferase activity by dual luciferase assay (Promega). .. The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid.

Hybridization:

Article Title: Development of Experimental Genetic Tools for Campylobacter fetus ▿ ▿ †
Article Snippet: Paragraph title: Radiolabeling of DNA fragments and hybridization procedure. ... The DNA was radiolabeled internally with [α32 P]dCTP (3,000 Ci/mmol) and the Klenow fragment of DNA polymerase I by using the random priming kit (Promega).

Northern Blot:

Article Title: Key Role of Ser562/661 in Snf1-Dependent Regulation of Cat8p in Saccharomyces cerevisiae and Kluyveromyces lactis
Article Snippet: PCR amplification reactions were done with 2 U of DNA polymerase from Pyrococcus furiosus (Promega), 50 pmol of each primer, and 1 μg of genomic DNA with the following cycling procedure: 3 min at 95°C; 35 cycles of 1.5 min at 95°C, 1.5 min at 50°C, and 3 min at 72°C; and 10 min at 72°C. .. The procedure used for Northern blot analysis has been described previously.

Infection:

Article Title: Lentivirus Restriction by Diverse Primate APOBEC3A Proteins
Article Snippet: The TZM-bl cell line was used as an indicator cell line to measure the infectivity of viruses ( ; ). .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Generated:

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: The extracted RNA was treated by RQ1 DNase (Promega, South Sydney, Australia) to remove any contaminating genomic DNA. cDNA was generated using the superscript III enzyme as described before [ ]. .. PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega).

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. .. Deletion derivatives of pHSI,II-hGHN-BSKSII : These derivatives were generated by PCR using the 1,602-bp HSI,II Bgl II fragment as a template: 5′-deletion termini of F10 (1,217 bp), F12 (816 bp), F13 (614 bp), F14 (405 bp), and 3′-deletion termini of F17 (1,059 bp) and F18 (853 bp).

Article Title: Multigene family isoform profiling from blood cell lineages
Article Snippet: Reagents and materials Kit for DNA isolation from peripheral blood cells, T vector, RQ1 RNase-free DNase I, T4 DNA polymerase I, and DNA polymerase I large (Klenow) fragment were from Promega (Southampton, UK). .. Oligonucleotide primers were generated by the Protein and Nucleic Acid Chemistry Laboratory (Leicester University, UK).

Polymerase Chain Reaction:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: To remove the leader sequence of the scFv, a 564bp segment of the scFv was PCR amplified using the primers: 5′-CTAGTCTAGACTAGACATTGTACTGACCCAATC-3′ and 5′-TTTACTATTACCATTCGCAG-3′ cloned into XbaI/StuI digested. pGEM-T84.66scFv. .. The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ].

Article Title: Key Role of Ser562/661 in Snf1-Dependent Regulation of Cat8p in Saccharomyces cerevisiae and Kluyveromyces lactis
Article Snippet: .. PCR amplification reactions were done with 2 U of DNA polymerase from Pyrococcus furiosus (Promega), 50 pmol of each primer, and 1 μg of genomic DNA with the following cycling procedure: 3 min at 95°C; 35 cycles of 1.5 min at 95°C, 1.5 min at 50°C, and 3 min at 72°C; and 10 min at 72°C. ..

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: .. PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega). .. The PCR was processed in a MyCycler Thermal Cycler and run for 35 cycles: denaturation (95°C, 45 s), annealing (55–56°C), and extension (72°C, 45 s) steps.

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers. .. PCR was performed using an iCycler (Bio-Rad Laboratories, UK) under the following conditions: Initial denaturation at 94°C for 5 min, followed by 12 cycles of 'touchdown’ PCR consisting of 30 s denaturation at 94°C and 1 min annealing between 72°C and 60°C (decreased 1°C at each cycle), 1 min at 60°C, 1 min elongation at 72°C, followed by 25 cycles denaturation for 30 s at 94°C, 1 min at 60°C, 1 min elongation at 72°C and a final extension of 15 min at 72°C.

Article Title: PURIFICATION, MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF HL15-1-1 (HETEROMETRUS LAOTICUS TOXIN): THE FIRST MEMBER OF A NEW ?-KTX SUBFAMILY
Article Snippet: Second strand synthesis was performed using a degenerate primer R1 (5'-TGCAAAAAGGAGTGTTCTGG-3') and DNA polymerase I Klenow fragment (Promega). .. Primer R1 was designed against the N-terminal AA region CKKECSG. cDNA's were further amplified with primer R1, the oligo(dT) primer and Taq DNA polymerase (Fermentas) using the following PCR conditions: 3 min 95 °C, 30× (30 sec 95 °C, 30 sec 62 °C, 120 sec 72 °C) and 5 min 72 °C.

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. .. Deletion derivatives of pHSI,II-hGHN-BSKSII : These derivatives were generated by PCR using the 1,602-bp HSI,II Bgl II fragment as a template: 5′-deletion termini of F10 (1,217 bp), F12 (816 bp), F13 (614 bp), F14 (405 bp), and 3′-deletion termini of F17 (1,059 bp) and F18 (853 bp).

Article Title: Antigenic Heterogeneity of the Hepatitis C Virus NS5A Protein
Article Snippet: As the first step, pairs A1-A2 and B1-B2 were annealed by their 3′-end complementary sequences and converted into a complete double-stranded-form A1A2 or B1B2 by the large fragment of DNA polymerase I from Escherichia coli (Promega, Madison, Wis.). .. The full-size gene was assembled by PCR using A1A2 and B1B2 fragments and two PCR primers.

Article Title: Development of Experimental Genetic Tools for Campylobacter fetus ▿ ▿ †
Article Snippet: PCR products amplified from pSK108-1 with different primer pairs (p108_13f and p108_14r or p108_rep_5f and p108_rep_6r) were used to generate repE -specific probes. .. The DNA was radiolabeled internally with [α32 P]dCTP (3,000 Ci/mmol) and the Klenow fragment of DNA polymerase I by using the random priming kit (Promega).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: Paragraph title: 2.2.2. RNA Extraction and RT-PCR Analysis of Gene Expression ... PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega).

Recombinant:

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: Paragraph title: Construction of Recombinant Plasmids. ... The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT.

DNA Extraction:

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: Paragraph title: DNA extraction and SSR analysis ... The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers.

Article Title: Multigene family isoform profiling from blood cell lineages
Article Snippet: .. Reagents and materials Kit for DNA isolation from peripheral blood cells, T vector, RQ1 RNase-free DNase I, T4 DNA polymerase I, and DNA polymerase I large (Klenow) fragment were from Promega (Southampton, UK). .. AdvanTaq™ polymerase was purchased from Clontech (Hampshire, UK).

Radioactivity:

Article Title: Development of Experimental Genetic Tools for Campylobacter fetus ▿ ▿ †
Article Snippet: Paragraph title: Radiolabeling of DNA fragments and hybridization procedure. ... The DNA was radiolabeled internally with [α32 P]dCTP (3,000 Ci/mmol) and the Klenow fragment of DNA polymerase I by using the random priming kit (Promega).

Isolation:

Article Title: Differential virus restriction patterns of rhesus macaque and human APOBEC3A: implications for lentivirus evolution
Article Snippet: Rhesus macaque PBMCs were obtained from uninfected animals and isolated on Ficoll/Hypaque gradients. .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: .. The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. ..

Size-exclusion Chromatography:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: PURIFICATION, MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF HL15-1-1 (HETEROMETRUS LAOTICUS TOXIN): THE FIRST MEMBER OF A NEW ?-KTX SUBFAMILY
Article Snippet: Second strand synthesis was performed using a degenerate primer R1 (5'-TGCAAAAAGGAGTGTTCTGG-3') and DNA polymerase I Klenow fragment (Promega). .. Primer R1 was designed against the N-terminal AA region CKKECSG. cDNA's were further amplified with primer R1, the oligo(dT) primer and Taq DNA polymerase (Fermentas) using the following PCR conditions: 3 min 95 °C, 30× (30 sec 95 °C, 30 sec 62 °C, 120 sec 72 °C) and 5 min 72 °C.

Labeling:

Article Title: Key Role of Ser562/661 in Snf1-Dependent Regulation of Cat8p in Saccharomyces cerevisiae and Kluyveromyces lactis
Article Snippet: PCR amplification reactions were done with 2 U of DNA polymerase from Pyrococcus furiosus (Promega), 50 pmol of each primer, and 1 μg of genomic DNA with the following cycling procedure: 3 min at 95°C; 35 cycles of 1.5 min at 95°C, 1.5 min at 50°C, and 3 min at 72°C; and 10 min at 72°C. .. DNA probes for KlACT1 , (a 1.1-kb EcoRI fragment of pGICL1) , KlICL1 (a 1.2-kb EcoRI fragment received from J. J. Heinisch), and KlCAT8 (a 4.3-kb XbaI-NotI fragment of pRS306CAT8) were 32 P labeled with the Random Prime labeling kit (Invitrogen).

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers. .. PCR was performed using an iCycler (Bio-Rad Laboratories, UK) under the following conditions: Initial denaturation at 94°C for 5 min, followed by 12 cycles of 'touchdown’ PCR consisting of 30 s denaturation at 94°C and 1 min annealing between 72°C and 60°C (decreased 1°C at each cycle), 1 min at 60°C, 1 min elongation at 72°C, followed by 25 cycles denaturation for 30 s at 94°C, 1 min at 60°C, 1 min elongation at 72°C and a final extension of 15 min at 72°C.

Purification:

Article Title: Differential virus restriction patterns of rhesus macaque and human APOBEC3A: implications for lentivirus evolution
Article Snippet: The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega). .. The resulting Klenow fragment reaction produced blunt ended fragments that were purified and re-ligated.

Article Title: Lentivirus Restriction by Diverse Primate APOBEC3A Proteins
Article Snippet: The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega). .. The resulting Klenow fragment reaction produced blunt ended fragments that were purified and re-ligated.

Article Title: PURIFICATION, MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF HL15-1-1 (HETEROMETRUS LAOTICUS TOXIN): THE FIRST MEMBER OF A NEW ?-KTX SUBFAMILY
Article Snippet: Second strand synthesis was performed using a degenerate primer R1 (5'-TGCAAAAAGGAGTGTTCTGG-3') and DNA polymerase I Klenow fragment (Promega). .. The obtained PCR products were purified with the GenElute™ PCR Clean-up Kit (Sigma-Aldrich).

Sequencing:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: To remove the leader sequence of the scFv, a 564bp segment of the scFv was PCR amplified using the primers: 5′-CTAGTCTAGACTAGACATTGTACTGACCCAATC-3′ and 5′-TTTACTATTACCATTCGCAG-3′ cloned into XbaI/StuI digested. pGEM-T84.66scFv. .. The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ].

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid. .. Preparation of Double-Stranded Random siRNA Library Sequence.

Chloramphenicol Acetyltransferase Assay:

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: .. The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. ..

Rapid Amplification of cDNA Ends:

Article Title: PURIFICATION, MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF HL15-1-1 (HETEROMETRUS LAOTICUS TOXIN): THE FIRST MEMBER OF A NEW ?-KTX SUBFAMILY
Article Snippet: The 3'RACE (Rapid Amplification of cDNA Ends) was performed using the 3'RACE system for rapid amplification of cDNA ends (Invitrogen) following the manufacturer's instructions. .. Second strand synthesis was performed using a degenerate primer R1 (5'-TGCAAAAAGGAGTGTTCTGG-3') and DNA polymerase I Klenow fragment (Promega).

RNA Extraction:

Article Title: Induction of Pluripotency in Adult Equine Fibroblasts without c-MYC
Article Snippet: Paragraph title: 2.2.2. RNA Extraction and RT-PCR Analysis of Gene Expression ... PCR amplification was performed in 50 μ L reaction containing 5 μ L DNA polymerase 10x reaction buffer, 3 μ L MgCl2 (25 mM), 1 μ L dNTP mixture (10 mM), 0.4 μ L GoTaq DNA Polymerase, 1 μ L (10 μ M) from each forward and reverse primer, 1 μ L sample and μ L Milli-Q water (Promega).

Plasmid Preparation:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. The PCR product was cloned into pGEM-T Easy vector and sequenced at the Central Services Lab in the Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR.

Article Title: Improving tumor targeting and therapeutic potential of Salmonella VNP20009 by displaying cell surface CEA-specific antibodies
Article Snippet: Paragraph title: 2.4 Plasmid construction ... The 853bp scFv gene was then were removed from plasmids by digestion with Xba I /Hind III and blunted with DNA polymerase I Klenow fragment (Promega, Madison, WI). pMoPac2 ( ) containing lpp-ompA gene fusion under the control of Plac promoter was based on pMoPac1 [ ].

Article Title: Differential virus restriction patterns of rhesus macaque and human APOBEC3A: implications for lentivirus evolution
Article Snippet: This plasmid was digested with PflM1, phenol: chloroform extracted, and ethanol precipitated. .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Article Title: Lentivirus Restriction by Diverse Primate APOBEC3A Proteins
Article Snippet: This plasmid was digested with PflM1, phenol: chloroform extracted, and ethanol precipitated. .. The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega).

Article Title: DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression
Article Snippet: .. The hGH-N promoter was released as a 494-bp Eco RI/ Bam HI fragment, blunt-ended with the Klenow fragment of DNA polymerase, ligated to Spe I linkers, and cloned in the native orientation at the Xba I site of the pCAT-basic vector (Promega) 5′ to the chloramphenicol acetyltransferase (CAT) coding region, generating phGHN-CAT. pHSI,II-hGHN-CAT : A 1.6-kb Bgl II fragment (coordinates −14.56 to −16.16 kb relative to the hGH-N transcription initiation site) encompassing HSI,II was isolated from the K2B cosmid , ligated to Sal I linkers, and subcloned in the native orientation at the Sal I site of phGHN-CAT 5′ to the hGH-N promoter, generating pHSI,II-hGHN-CAT. ..

Article Title: Multigene family isoform profiling from blood cell lineages
Article Snippet: .. Reagents and materials Kit for DNA isolation from peripheral blood cells, T vector, RQ1 RNase-free DNase I, T4 DNA polymerase I, and DNA polymerase I large (Klenow) fragment were from Promega (Southampton, UK). .. AdvanTaq™ polymerase was purchased from Clontech (Hampshire, UK).

Article Title: A universal plasmid library encoding all permutations of small interfering RNA
Article Snippet: .. The CMV promoter in vector pcDNA3.1(-) was partially deleted by digestion with Mlu I and Sna BI (Promega) or entirely deleted by digestion with Mlu I and Xho I (Promega), followed by making blunt ends with the Klenow fragment of DNA polymerase (Promega) and self-ligation of the plasmid. .. Preparation of Double-Stranded Random siRNA Library Sequence.

Software:

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: Quantity and quality of DNA was assessed by photospectrometry using NanoDrop (Thermo Fisher Scientific, Wilmington, DE, USA) and the ND-1000 software. .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers.

Multiplex Assay:

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: SSR marker analysis was performed in multiplex reactions using 29 primer pairs (Table ) [ , ] on all 1861 D. glomerata individuals. .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers.

Sample Prep:

Article Title: Human sapovirus GI.2 and GI.3 from children with acute gastroenteritis in northern Brazil
Article Snippet: A second strand of cDNA was synthesized using DNA Polymerase I Lar e (Klenow) Fragment (Promega, WI, USA). .. Subsequently, a Nextera XT Sample Preparation Kit (Illumina, CA, USA) was used to construct a DNA library, identified using dual barcodes.

Article Title: First identification of mammalian orthoreovirus type 3 by gut virome analysis in diarrheic child in Brazil
Article Snippet: A second strand cDNA synthesis was performed using a DNA Polymerase I Large (Klenow) Fragment (Promega). .. Subsequently, a Nextera XT Sample Preparation Kit (Illumina, San Diego, CA, USA) was used to construct a DNA library, which was identified using dual barcodes.

Produced:

Article Title: Differential virus restriction patterns of rhesus macaque and human APOBEC3A: implications for lentivirus evolution
Article Snippet: The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega). .. The resulting Klenow fragment reaction produced blunt ended fragments that were purified and re-ligated.

Article Title: Lentivirus Restriction by Diverse Primate APOBEC3A Proteins
Article Snippet: The 5’-protruding ends were filled using DNA Polymerase I Large Fragment (Klenow; Promega). .. The resulting Klenow fragment reaction produced blunt ended fragments that were purified and re-ligated.

Marker:

Article Title: Genetic diversity of natural orchardgrass (Dactylis glomerata L.) populations in three regions in Europe
Article Snippet: SSR marker analysis was performed in multiplex reactions using 29 primer pairs (Table ) [ , ] on all 1861 D. glomerata individuals. .. The PCR assays were conducted in a volume of 20 μl containing 15 ng of genomic DNA, 0.25 U DNA polymerase, 1× GoTag® Flexi Buffer, 3 mM MgCl2 , 200 μM dNTPs (Promega, Madison, WI, USA) and 0.2 μM of fluorescently labeled forward primers (FAM, HEX, ATTO550, synthesized by Microsynth, Balgach, Switzerland) and unlabeled reverse primers.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Promega dna polymerase
    Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of <t>DNA</t> transposable elements in the <t>BFP-ToxAC</t> reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.
    Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Promega
    Average 95 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Promega thermophilic dna polymerase
    (A) <t>ITS-PCR</t> patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp <t>DNA</t> ladder).
    Thermophilic Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermophilic dna polymerase/product/Promega
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    thermophilic dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    98
    Promega taq dna polymerase
    Superimposition of the thumb domains of <t>Taq</t> <t>DNA</t> polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
    Taq Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 98/100, based on 503 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Promega
    Average 98 stars, based on 503 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    Image Search Results


    Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

    Journal: G3: Genes|Genomes|Genetics

    Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    doi: 10.1534/g3.112.004044

    Figure Lengend Snippet: Transduplication of a histone H3-like protein family in the genome of Pyrenophora tritici-repentis . (A) Two representatives of a transduplicating family of DNA transposable elements in the BFP-ToxAC reference genome are shown with the characteristic motifs of the elements indicated (brown box = terminal inverted repeats (TIR); green box = hAT transposon coding regions; purple box = hAT dimerization motif; blue box = central open reading frame (ORF) coding region; yellow box = histone H3 coding region; black boundary box = full-length element). The large, likely autonomous element is approximately 5.6 kb in length. Black lines between elements illustrate a pathogen-specific recombination event that results in a smaller element of approximately 2.3 kb. The graphs show coverage of reads obtained from the pathogenic DW7-ToxB and nonpathogenic SD20-NP isolates. Arrows and lines below the element representation indicate alignments of ESTs detected in various libraries (arrows = poly(A) tails, light gray = introns). (B) Alignment of novel histone H3-like (H3L) proteins identified in Ptr with bona fide histone H3 variants from Ptr , S. nodorum , and N. crassa . Four variants of full-length H3L exist in Ptr , all are different by a single aa change (underlined; also see Table S9 ). Two changes in H3L alleles result in frameshift mutations, yielding 5′ and 3′ truncated versions of H3L. Most (21) copies are identical to PTRG_00559.1 in amino acid and DNA sequence. Completely conserved residues are shown in black, similar residues in green and variable residues in gray.

    Article Snippet: For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega).

    Techniques: HAT Assay, Sequencing

    Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.

    Journal: Frontiers in Microbiology

    Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes

    doi: 10.3389/fmicb.2017.01009

    Figure Lengend Snippet: Expression of At. ferrivorans CF27-specific genes. RT-PCR experiments were performed on RNA extracted from At. ferrivorans CF27 Fe(II)-grown cells (F) or sulfur attached cells (S) without reverse transcriptase (–), with reverse transcriptase (+), and on genomic DNA from At. ferrivorans CF27 (D). AFERRI_v2 (or v1) number of each gene is shown with the corresponding cluster number in square brackets. The size of the expected PCR products is indicated. M is the 1 Kbp plus DNA ladder from Invitrogen.

    Article Snippet: For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    (A) ITS-PCR patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp DNA ladder).

    Journal: Applied and Environmental Microbiology

    Article Title: Identification and Characterization of Leuconostoc fallax Strains Isolated from an Industrial Sauerkraut Fermentation †

    doi: 10.1128/AEM.68.6.2877-2884.2002

    Figure Lengend Snippet: (A) ITS-PCR patterns of Leuconostoc species. (B) Rsa I digestion of the ITS-PCR fragments of Leuconostoc species. Lane 1, W. paramesenteroides ; lane 2, L. citreum ; lane 3, L. lactis ; lane 4, L. mesenteroides subsp. mesenteroides ; lane 5, L. mesenteroides subsp. cremoris ; lane 6, L. mesenteroides subsp. dextranicum ; lane 7, L. amelibiosum ; lane 8, L. fallax ; lanes M, molecular weight markers (100-bp DNA ladder).

    Article Snippet: The typical 100-μl reaction mixture used for ITS-PCR analysis of Leuconostoc strains contained 70 μl of water, 50 pmol of each primer (Genosys Biotechnologies Inc., The Woodlands, Tex.), 10 μl of 25 mM MgCl2 (Promega), 10 μl of thermophilic DNA polymerase, 10× PCR buffer (Promega), 1 μl of a deoxynucleoside triphosphate mixture (Promega), and 0.2 μg of DNA template.

    Techniques: Polymerase Chain Reaction, Molecular Weight

    Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Sequencing

    Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

    Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Incubation

    The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

    Journal: Nucleic Acids Research

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    doi:

    Figure Lengend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

    Article Snippet: A decrease of 4-fold in slippage peak was observed in DNA obtained from processive amplification using Taq DNA pol/TBD compared with Taq DNA polymerase.

    Techniques: Activity Assay, Labeling, Concentration Assay