dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs dna polymerase
    Generation and characterization of conditional Rbm47 knockout mice. ( A ) Endogenous mouse Rbm47 gene and targeting construct. Schematic illustration of genomic structure of Rbm47 allele containing nine exons (orange boxes). Schematic of Rbm47 tm1a composition. (Numbered oranges boxes) Rbm47 exons; (blue boxes) Lac Z and neo cassettes; (green triangles) FRT sites; (purple triangles) LoxP sites. FLP recombination eliminates the LacZ and neo cassettes. Exon 6 containing transcriptional start codon and sequences encoding RNA recognition motifs was targeted for Cre-dependent homologous recombination. ( B ) Representative <t>DNA</t> electrophoresis showing genotype of WT and targeted alleles using primers P1 and P2 surrounding the 3′arm LoxP site. Analysis of the WT allele results in a 490 bp <t>PCR</t> product (lane 1 ) whereas recombination at the floxed allele generates a 530 bp product (f/f) (lane 3 ). Cre activation resuts in the loss of exon 6, evidenced by the absence of PCR amplification (lane 5 ). Molecular weights (bp) are indicated to the left . ( C ) Western blot detection of RBM47 in liver of floxed and Rbm47 liver-specific knockout ( Rbm47 LKO ) mice with Actin used as loading control. ( D ) Western blot analysis of RBM47 in Rbm47 IKO mice showing no detectable protein in intestinal nuclear extract. ( E ) Hepatic apoB RNA editing profile in Rbm47 LKO mice, representative of three individual livers. Forty-two clones were sequenced, with each clone represented by a circle. Solid circles indicate editing at the specified position. We examined an apoB region encompassing nucleotides 6563–7210, with editing only at the canonical cytidine (6666) detected. ( F ) Intestinal apoB RNA editing profile in Rbm47 IKO mice. Representative distribution of RNA editing sites from the same region (6563–7210) revealing only 2/19 clones exhibiting RNA editing. ( G ) Western blot analysis of hepatic apoB100 and apoB48 isoforms (three to five mice per genotype) with actin as loading control. (Panel to the right ) Quantitation of apoB100 isoform as a fraction of total apoB showing significant increase of apoB100 in liver of Rbm47 LKO mice. ( H ) Western blot analysis of RBM47 and A1CF in Rbm47 LKO mice at baseline and following adenoviral APOBEC1 overexpression. ( I ) Editing and hyperediting profile of hepatic apoB RNA following adenoviral overexpression of APOBEC1 in two Rbm47 LKO mice. Representative distribution of edited sites from nucleotide 6563 to nucleotide 7210.
    Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 389 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/New England Biolabs
    Average 99 stars, based on 389 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver"

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver

    Journal: RNA

    doi: 10.1261/rna.068395.118

    Generation and characterization of conditional Rbm47 knockout mice. ( A ) Endogenous mouse Rbm47 gene and targeting construct. Schematic illustration of genomic structure of Rbm47 allele containing nine exons (orange boxes). Schematic of Rbm47 tm1a composition. (Numbered oranges boxes) Rbm47 exons; (blue boxes) Lac Z and neo cassettes; (green triangles) FRT sites; (purple triangles) LoxP sites. FLP recombination eliminates the LacZ and neo cassettes. Exon 6 containing transcriptional start codon and sequences encoding RNA recognition motifs was targeted for Cre-dependent homologous recombination. ( B ) Representative DNA electrophoresis showing genotype of WT and targeted alleles using primers P1 and P2 surrounding the 3′arm LoxP site. Analysis of the WT allele results in a 490 bp PCR product (lane 1 ) whereas recombination at the floxed allele generates a 530 bp product (f/f) (lane 3 ). Cre activation resuts in the loss of exon 6, evidenced by the absence of PCR amplification (lane 5 ). Molecular weights (bp) are indicated to the left . ( C ) Western blot detection of RBM47 in liver of floxed and Rbm47 liver-specific knockout ( Rbm47 LKO ) mice with Actin used as loading control. ( D ) Western blot analysis of RBM47 in Rbm47 IKO mice showing no detectable protein in intestinal nuclear extract. ( E ) Hepatic apoB RNA editing profile in Rbm47 LKO mice, representative of three individual livers. Forty-two clones were sequenced, with each clone represented by a circle. Solid circles indicate editing at the specified position. We examined an apoB region encompassing nucleotides 6563–7210, with editing only at the canonical cytidine (6666) detected. ( F ) Intestinal apoB RNA editing profile in Rbm47 IKO mice. Representative distribution of RNA editing sites from the same region (6563–7210) revealing only 2/19 clones exhibiting RNA editing. ( G ) Western blot analysis of hepatic apoB100 and apoB48 isoforms (three to five mice per genotype) with actin as loading control. (Panel to the right ) Quantitation of apoB100 isoform as a fraction of total apoB showing significant increase of apoB100 in liver of Rbm47 LKO mice. ( H ) Western blot analysis of RBM47 and A1CF in Rbm47 LKO mice at baseline and following adenoviral APOBEC1 overexpression. ( I ) Editing and hyperediting profile of hepatic apoB RNA following adenoviral overexpression of APOBEC1 in two Rbm47 LKO mice. Representative distribution of edited sites from nucleotide 6563 to nucleotide 7210.
    Figure Legend Snippet: Generation and characterization of conditional Rbm47 knockout mice. ( A ) Endogenous mouse Rbm47 gene and targeting construct. Schematic illustration of genomic structure of Rbm47 allele containing nine exons (orange boxes). Schematic of Rbm47 tm1a composition. (Numbered oranges boxes) Rbm47 exons; (blue boxes) Lac Z and neo cassettes; (green triangles) FRT sites; (purple triangles) LoxP sites. FLP recombination eliminates the LacZ and neo cassettes. Exon 6 containing transcriptional start codon and sequences encoding RNA recognition motifs was targeted for Cre-dependent homologous recombination. ( B ) Representative DNA electrophoresis showing genotype of WT and targeted alleles using primers P1 and P2 surrounding the 3′arm LoxP site. Analysis of the WT allele results in a 490 bp PCR product (lane 1 ) whereas recombination at the floxed allele generates a 530 bp product (f/f) (lane 3 ). Cre activation resuts in the loss of exon 6, evidenced by the absence of PCR amplification (lane 5 ). Molecular weights (bp) are indicated to the left . ( C ) Western blot detection of RBM47 in liver of floxed and Rbm47 liver-specific knockout ( Rbm47 LKO ) mice with Actin used as loading control. ( D ) Western blot analysis of RBM47 in Rbm47 IKO mice showing no detectable protein in intestinal nuclear extract. ( E ) Hepatic apoB RNA editing profile in Rbm47 LKO mice, representative of three individual livers. Forty-two clones were sequenced, with each clone represented by a circle. Solid circles indicate editing at the specified position. We examined an apoB region encompassing nucleotides 6563–7210, with editing only at the canonical cytidine (6666) detected. ( F ) Intestinal apoB RNA editing profile in Rbm47 IKO mice. Representative distribution of RNA editing sites from the same region (6563–7210) revealing only 2/19 clones exhibiting RNA editing. ( G ) Western blot analysis of hepatic apoB100 and apoB48 isoforms (three to five mice per genotype) with actin as loading control. (Panel to the right ) Quantitation of apoB100 isoform as a fraction of total apoB showing significant increase of apoB100 in liver of Rbm47 LKO mice. ( H ) Western blot analysis of RBM47 and A1CF in Rbm47 LKO mice at baseline and following adenoviral APOBEC1 overexpression. ( I ) Editing and hyperediting profile of hepatic apoB RNA following adenoviral overexpression of APOBEC1 in two Rbm47 LKO mice. Representative distribution of edited sites from nucleotide 6563 to nucleotide 7210.

    Techniques Used: Knock-Out, Mouse Assay, Construct, Homologous Recombination, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Activation Assay, Amplification, Western Blot, Clone Assay, Quantitation Assay, Over Expression

    Related Articles

    Clone Assay:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs). .. Amplified PCR product was then topo cloned into Gateway compatible entry vector pENTR™/D-TOPO® Cloning Kit (Life Technologies), then inserted into pLenti-CMV-Puro-Dest(w118-1) by Gibson Assembly (New England Biolabs) using Gateway LR Clonase II (Thermo Fisher). pgLAP6-SETD3 plasmid was provided by Dr. Peter Jackson.

    Article Title: Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site.
    Article Snippet: The PCR-generated frag ments were digested with Sall and BamHl and cloned into theXhol and BamHl sites of pNoUp. .. The unique TtHllll site was blunted with DNA polymerase I large fragment and joined to Sall 8-mer linkers (New England Biolabs).

    Article Title: Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms.
    Article Snippet: (b) RT-PCR amplification The sequences of the cDNA clones suggested that splicing events occurred on the primary Bgp transcript(s), resulting in the deletion of the Al and Bl domains (McCuaig et al., 1992) . .. 1% Triton X-100/0.1 ug BSA/0.2 mM of each dNTP/40 pmol of phosphorylated primers, using 2 units of Vent@ DNA polymerase (New England Biolabs), to decrease possible proofreading errors (Frohman et al., 1988; Mattila et al., 1991) .

    Centrifugation:

    Article Title: Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms.
    Article Snippet: Methods: Total RNA from CD-l mouse colon was prepared by guanidium isothiocyanate extraction and centrifugation . .. 1% Triton X-100/0.1 ug BSA/0.2 mM of each dNTP/40 pmol of phosphorylated primers, using 2 units of Vent@ DNA polymerase (New England Biolabs), to decrease possible proofreading errors (Frohman et al., 1988; Mattila et al., 1991) .

    Amplification:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: Paragraph title: Amplicon sequencing ... The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions.

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: Amplified PCR product using primers 5’- TGTGGTGGAATTCTGCAGATACCATGCAGGAAGCAATCATTCTC −3’ and 5’- CGGCCGCCACTGTGCTGGATTTACTTTCCTGGGTGTGGT −3’ was then inserted into the EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). .. DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs).

    Article Title: Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms.
    Article Snippet: Paragraph title: (b) RT-PCR amplification ... 1% Triton X-100/0.1 ug BSA/0.2 mM of each dNTP/40 pmol of phosphorylated primers, using 2 units of Vent@ DNA polymerase (New England Biolabs), to decrease possible proofreading errors (Frohman et al., 1988; Mattila et al., 1991) .

    Agarose Gel Electrophoresis:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. Ligated products were purified using PCR Purification kit and ligation was confirmed by running aliquot of ligation on a 1% agarose gel.

    DNA Ligation:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: .. DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs). .. To generate a lentiviral construct expressing SETD3, SETD3 cDNA was purchased from OriGene (catalog #RC214566).

    Ligation:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. Ligated products were purified using PCR Purification kit and ligation was confirmed by running aliquot of ligation on a 1% agarose gel.

    Mutagenesis:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: C529Y point mutation was introduced with primers 5’- GTAACTAAAGTGGACTATGAAACAACCCCCATC −3’ and 5’- GATGGGGGTTGTTTCATAGTCCACTTTAGTTAC −3’. .. DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs).

    Construct:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: Paragraph title: Engineering of lentiviral constructs ... DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs).

    Purification:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. After purification using PCR Purification kit (Qiagen), the PCR products were ligated overnight at room temperature using a mix of T4 DNA ligase and T4 polynucleotide kinase in the presence of 50% PEG-8000.

    Sequencing:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: Paragraph title: Amplicon sequencing ... The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms.
    Article Snippet: Paragraph title: (b) RT-PCR amplification ... 1% Triton X-100/0.1 ug BSA/0.2 mM of each dNTP/40 pmol of phosphorylated primers, using 2 units of Vent@ DNA polymerase (New England Biolabs), to decrease possible proofreading errors (Frohman et al., 1988; Mattila et al., 1991) .

    Incubation:

    Article Title: Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms.
    Article Snippet: The amplification reactions were incubated at an annealing temperature of 44°C for 2 min, at an elongation temperature of 72°C for 3 min and at a denaturing temperature of 94°C for 1 min for 40 cycles in a total volume of 100 ul containing 20 mM TrisCl pH 8.8 (at 24"C)/lO mM KClj2 mM MgSO mM ammonium sulfate/O. .. 1% Triton X-100/0.1 ug BSA/0.2 mM of each dNTP/40 pmol of phosphorylated primers, using 2 units of Vent@ DNA polymerase (New England Biolabs), to decrease possible proofreading errors (Frohman et al., 1988; Mattila et al., 1991) .

    Polymerase Chain Reaction:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: .. The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. After purification using PCR Purification kit (Qiagen), the PCR products were ligated overnight at room temperature using a mix of T4 DNA ligase and T4 polynucleotide kinase in the presence of 50% PEG-8000.

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: Amplified PCR product using primers 5’- TGTGGTGGAATTCTGCAGATACCATGCAGGAAGCAATCATTCTC −3’ and 5’- CGGCCGCCACTGTGCTGGATTTACTTTCCTGGGTGTGGT −3’ was then inserted into the EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). .. DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs).

    Article Title: Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site.
    Article Snippet: The PCR-generated frag ments were digested with Sall and BamHl and cloned into theXhol and BamHl sites of pNoUp. .. The unique TtHllll site was blunted with DNA polymerase I large fragment and joined to Sall 8-mer linkers (New England Biolabs).

    DNA Sequencing:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. Concatemerized amplicons were then submitted for automated high-throughput DNA sequencing (Washington University Genome Center).

    Expressing:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: To generate a lentiviral construct expressing CDHR3, human CDHR3 cDNA was purchased from Dharmacon (clone ID: 40037942). .. DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs).

    High Throughput Screening Assay:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: The PCR products (∼12 ng) were treated with DNA polymerase I, Large Klenow Fragment (NEB) for 30 min at 37° C following manufacturer's instructions. .. Concatemerized amplicons were then submitted for automated high-throughput DNA sequencing (Washington University Genome Center).

    Plasmid Preparation:

    Article Title: Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3
    Article Snippet: DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs) was then used to generate blunt ends for T4 DNA ligation (New England BioLabs). .. Amplified PCR product was then topo cloned into Gateway compatible entry vector pENTR™/D-TOPO® Cloning Kit (Life Technologies), then inserted into pLenti-CMV-Puro-Dest(w118-1) by Gibson Assembly (New England Biolabs) using Gateway LR Clonase II (Thermo Fisher). pgLAP6-SETD3 plasmid was provided by Dr. Peter Jackson.

    Article Title: Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site.
    Article Snippet: Plasmld Constructlonr end Ollgonucleotldes The plasmid used to overexpress tRNA was pMB3E9merWT This plasmid contains the missense oligonucleotide depicted above with the wild-type 9 nucleotide frameshift site. .. The unique TtHllll site was blunted with DNA polymerase I large fragment and joined to Sall 8-mer linkers (New England Biolabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t7 helicase
    Helicase displacement of a single nucleosome. ( a ) Experimental configuration. A single dsDNA molecule was unwound by a <t>T7</t> helicase as the two strands of the DNA were held under 12 pN of force by an optical trap, which assisted helicase unwinding but was insufficient to mechanically separate the dsDNA ( Supplementary Fig. 1B ). The nucleosomal DNA template is specified in Supplementary Fig. 2A , Supplementary Table 1 and Methods. ( b ) Representative helicase-unwinding traces on a nucleosomal (black) or naked (grey) template. Helicase unwinding was interrupted by discrete pauses along the DNA template. Dashed lines indicate the dyad locations of the initial positioned nucleosome and the transferred nucleosome. N =49 traces. ( c ) Histogram of nucleosome transfer distance. A transfer distance was obtained from the first transfer event of each trace as indicated by the arrow in Fig. 2b . The histogram was obtained by pooling data from 49 traces. The prediction (not a fit) from the DNA looping model is plotted for comparison. The resulting Pearson test gives a reduced χ 2 of 0.31 with a P value of 0.95 (Methods; Supplementary Fig. 4A ).
    T7 Helicase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 helicase/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    t7 helicase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    New England Biolabs general information bst dna polymerase large fragment
    Verification of UIMA using different <t>DNA</t> polymerases. All reactions shared the same primer (RL) and template (F*R*) and were incubated for 180 min. The sequences of RL and F*R* were shown in Table S1 . ( A ) Real-time fluorescence change in reactions using a series of <t>Bst</t> DNA polymerases ( Bst LF, Bst 2.0, Bst 2.0 WS, and Bst 3.0) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( B ) Real-time fluorescence change in reactions using non- Bst polymerases (Bsm, BcaBEST, Vent(exo-), and z-Taq) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( C ) Temperature gradients assay for the products of reactions using the polymerases with negative results in ( B ). The products were analyzed by 2.5% agarose gel electrophoresis. NTC and NPC for Bsm were performed at 56 °C. NTCs and NPCs for Vent (exo-) and z-Taq were performed at 63 °C. The groping of gels cropped from different gels. Exposure time is 5 s. ( D ) Temperature gradients assay for the products of reactions using the polymerases of Klenow(exo-) and Klenow. The products were analyzed by 2.5% agarose gel electrophoresis. Their NTCs and NPCs were performed at 43 °C. M1 and M2: DNA Marker. NTC: no-target control; NPC: no-primer control. The groping of gels cropped from different gels. Exposure time is 5 s. The full-length gels are presented in Supplementary Figure S7 .
    General Information Bst Dna Polymerase Large Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/general information bst dna polymerase large fragment/product/New England Biolabs
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    general information bst dna polymerase large fragment - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    86
    New England Biolabs target dna fragments taq dna polymerase
    Robust PCR-amplification of insert <t>DNA</t> fragments using deoxyinosine-containing primers. Analytical agarose gel electrophoresis of PCR products produced by <t>Taq</t> polymerase using either plasmid DNA (A) or E. coli colonies (B) as template material. Relative to the calculated T m , annealing temperatures used for PCR cycling are indicated for each lane.
    Target Dna Fragments Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/target dna fragments taq dna polymerase/product/New England Biolabs
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    target dna fragments taq dna polymerase - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    96
    New England Biolabs g stearothermophilus bst dna polymerase
    FANA transcription and reverse transcription in vitro. a Constitutional structures for 2’-deoxyribonucleic acid <t>(DNA)</t> and 2’-fluoroarabino nucleic acid (FANA). b FANA transcription activity for wild-type archaeal DNA polymerases (exo−) from 9°N, DV, Kod, and Tgo (left panel). Samples were analyzed after 15 and 30 min at 55 °C. FANA reverse transcriptase activity of <t>Bst</t> DNA polymerase LF, 2.0, 3.0, and LF* (right panel). LF* denotes wild-type Bst DNA polymerase, large fragment, expressed and purified from E. coli . Samples were analyzed after 30 min at 50 °C. All samples were resolved on denaturing PAGE and visualized using a LI-COR Odyssey CLx. c Fidelity profile observed for FANA replication using Tgo and Bst LF* polymerases. The mutation profile reveals a mutation rate of 8 × 10 -4 and an overall fidelity of ~99.9%. d Catalytic rates observed for FANA synthesis with Tgo (left panel) and reverse transcription with Bst LF* (right panel)
    G Stearothermophilus Bst Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/g stearothermophilus bst dna polymerase/product/New England Biolabs
    Average 96 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    g stearothermophilus bst dna polymerase - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    Image Search Results


    Helicase displacement of a single nucleosome. ( a ) Experimental configuration. A single dsDNA molecule was unwound by a T7 helicase as the two strands of the DNA were held under 12 pN of force by an optical trap, which assisted helicase unwinding but was insufficient to mechanically separate the dsDNA ( Supplementary Fig. 1B ). The nucleosomal DNA template is specified in Supplementary Fig. 2A , Supplementary Table 1 and Methods. ( b ) Representative helicase-unwinding traces on a nucleosomal (black) or naked (grey) template. Helicase unwinding was interrupted by discrete pauses along the DNA template. Dashed lines indicate the dyad locations of the initial positioned nucleosome and the transferred nucleosome. N =49 traces. ( c ) Histogram of nucleosome transfer distance. A transfer distance was obtained from the first transfer event of each trace as indicated by the arrow in Fig. 2b . The histogram was obtained by pooling data from 49 traces. The prediction (not a fit) from the DNA looping model is plotted for comparison. The resulting Pearson test gives a reduced χ 2 of 0.31 with a P value of 0.95 (Methods; Supplementary Fig. 4A ).

    Journal: Nature Communications

    Article Title: DNA looping mediates nucleosome transfer

    doi: 10.1038/ncomms13337

    Figure Lengend Snippet: Helicase displacement of a single nucleosome. ( a ) Experimental configuration. A single dsDNA molecule was unwound by a T7 helicase as the two strands of the DNA were held under 12 pN of force by an optical trap, which assisted helicase unwinding but was insufficient to mechanically separate the dsDNA ( Supplementary Fig. 1B ). The nucleosomal DNA template is specified in Supplementary Fig. 2A , Supplementary Table 1 and Methods. ( b ) Representative helicase-unwinding traces on a nucleosomal (black) or naked (grey) template. Helicase unwinding was interrupted by discrete pauses along the DNA template. Dashed lines indicate the dyad locations of the initial positioned nucleosome and the transferred nucleosome. N =49 traces. ( c ) Histogram of nucleosome transfer distance. A transfer distance was obtained from the first transfer event of each trace as indicated by the arrow in Fig. 2b . The histogram was obtained by pooling data from 49 traces. The prediction (not a fit) from the DNA looping model is plotted for comparison. The resulting Pearson test gives a reduced χ 2 of 0.31 with a P value of 0.95 (Methods; Supplementary Fig. 4A ).

    Article Snippet: Replisomes were formed by pre-incubating 1 unit per μl T7 DNA polymerase (NEB) and 1 μM T7 helicase in reaction buffer on ice for 5 min, and then were added to a final concentration of 0.1 unit per μl T7 DNA polymerase (NEB) and 100 nM T7 helicase and incubated at 37 °C for 10 min.

    Techniques:

    Verification of UIMA using different DNA polymerases. All reactions shared the same primer (RL) and template (F*R*) and were incubated for 180 min. The sequences of RL and F*R* were shown in Table S1 . ( A ) Real-time fluorescence change in reactions using a series of Bst DNA polymerases ( Bst LF, Bst 2.0, Bst 2.0 WS, and Bst 3.0) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( B ) Real-time fluorescence change in reactions using non- Bst polymerases (Bsm, BcaBEST, Vent(exo-), and z-Taq) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( C ) Temperature gradients assay for the products of reactions using the polymerases with negative results in ( B ). The products were analyzed by 2.5% agarose gel electrophoresis. NTC and NPC for Bsm were performed at 56 °C. NTCs and NPCs for Vent (exo-) and z-Taq were performed at 63 °C. The groping of gels cropped from different gels. Exposure time is 5 s. ( D ) Temperature gradients assay for the products of reactions using the polymerases of Klenow(exo-) and Klenow. The products were analyzed by 2.5% agarose gel electrophoresis. Their NTCs and NPCs were performed at 43 °C. M1 and M2: DNA Marker. NTC: no-target control; NPC: no-primer control. The groping of gels cropped from different gels. Exposure time is 5 s. The full-length gels are presented in Supplementary Figure S7 .

    Journal: Scientific Reports

    Article Title: Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities

    doi: 10.1038/s41598-017-13324-0

    Figure Lengend Snippet: Verification of UIMA using different DNA polymerases. All reactions shared the same primer (RL) and template (F*R*) and were incubated for 180 min. The sequences of RL and F*R* were shown in Table S1 . ( A ) Real-time fluorescence change in reactions using a series of Bst DNA polymerases ( Bst LF, Bst 2.0, Bst 2.0 WS, and Bst 3.0) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( B ) Real-time fluorescence change in reactions using non- Bst polymerases (Bsm, BcaBEST, Vent(exo-), and z-Taq) at 63 °C. No-primer controls (NPCs) were shown in Fig. S5 . ( C ) Temperature gradients assay for the products of reactions using the polymerases with negative results in ( B ). The products were analyzed by 2.5% agarose gel electrophoresis. NTC and NPC for Bsm were performed at 56 °C. NTCs and NPCs for Vent (exo-) and z-Taq were performed at 63 °C. The groping of gels cropped from different gels. Exposure time is 5 s. ( D ) Temperature gradients assay for the products of reactions using the polymerases of Klenow(exo-) and Klenow. The products were analyzed by 2.5% agarose gel electrophoresis. Their NTCs and NPCs were performed at 43 °C. M1 and M2: DNA Marker. NTC: no-target control; NPC: no-primer control. The groping of gels cropped from different gels. Exposure time is 5 s. The full-length gels are presented in Supplementary Figure S7 .

    Article Snippet: General information Bst DNA polymerase Large fragment (Bst LF), Bst 2.0 DNA polymerase (Bst 2.0), Bst 2.0 WarmStart DNA polymerase (Bst 2.0 WS), Bst 3.0 DNA polymerase (Bst 3.0), Klenow fragment polymerase (Klenow), Klenow fragment exo- polymerase (Klenow (exo-)), Vent exo- DNA polymerase (Vent (exo-)), and dNTP Mix were purchased from New England Biolabs.

    Techniques: Incubation, Fluorescence, Agarose Gel Electrophoresis, Marker

    Real-time fluorescence and electrophoresis analysis of UIMA. All reactions shared the same primer (RL) or template (F*R*), and were incubated for 180 min. The sequences of RL and F*R* were shown in Table S1 . ( A ) The results of real-time fluorescence obtained from the reactions that contained 10 nM template, 1.6 μM primer, and 3.2 U Bst WS DNA polymerase at 63 °C for 180 min. Each test was in triplicate. ( B ) Time course of the UIMA assay. 2.5% agarose gel electrophoresis shows the products of UIMA. The assay time was varied from 30–120 minutes as indicated above each lane. M1 and M2: DNA marker; NEC, NTC and NPC were all incubated for 120 min. Exposure time is 5 s. ( C ) Extension status of template and primer. Template and primer were labeled with the FAM fluorophore. 1: reaction with FAM-labeled primer and template but no Bst ; 2: with FAM-labeled primer, non-labeled template, and Bst ; 3: with FAM-labeled primer and template and Bst ; 4: with FAM-labeled primer and Bst but no template; 5: with non-labeled primer and template, and Bst ; 6: with non-labeled primer, FAM-labeled template, and Bst ; 7: with non-labeled primer and Bst but no template; 8: with non-labeled template and Bst but no primer; 9: with FAM-labeled template and Bst but no primer. All the reactions were incubated at 63 °C for 180 min. Their products were analyzed by 17% denatured polyacrylamide gel electrophoresis (DPAGE). NEC (no-enzyme control): the reaction without Bst 2.0 WS DNA polymerase. NTC (no-template control): control reaction just lacked the template; NPC (no-primer control): control reaction lacked primer RL. Horizontal arrows denoted the 5′-3′ direction of sequences. Exposure time is 5 s. The full-length gels are presented in Supplementary Figure S1 .

    Journal: Scientific Reports

    Article Title: Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities

    doi: 10.1038/s41598-017-13324-0

    Figure Lengend Snippet: Real-time fluorescence and electrophoresis analysis of UIMA. All reactions shared the same primer (RL) or template (F*R*), and were incubated for 180 min. The sequences of RL and F*R* were shown in Table S1 . ( A ) The results of real-time fluorescence obtained from the reactions that contained 10 nM template, 1.6 μM primer, and 3.2 U Bst WS DNA polymerase at 63 °C for 180 min. Each test was in triplicate. ( B ) Time course of the UIMA assay. 2.5% agarose gel electrophoresis shows the products of UIMA. The assay time was varied from 30–120 minutes as indicated above each lane. M1 and M2: DNA marker; NEC, NTC and NPC were all incubated for 120 min. Exposure time is 5 s. ( C ) Extension status of template and primer. Template and primer were labeled with the FAM fluorophore. 1: reaction with FAM-labeled primer and template but no Bst ; 2: with FAM-labeled primer, non-labeled template, and Bst ; 3: with FAM-labeled primer and template and Bst ; 4: with FAM-labeled primer and Bst but no template; 5: with non-labeled primer and template, and Bst ; 6: with non-labeled primer, FAM-labeled template, and Bst ; 7: with non-labeled primer and Bst but no template; 8: with non-labeled template and Bst but no primer; 9: with FAM-labeled template and Bst but no primer. All the reactions were incubated at 63 °C for 180 min. Their products were analyzed by 17% denatured polyacrylamide gel electrophoresis (DPAGE). NEC (no-enzyme control): the reaction without Bst 2.0 WS DNA polymerase. NTC (no-template control): control reaction just lacked the template; NPC (no-primer control): control reaction lacked primer RL. Horizontal arrows denoted the 5′-3′ direction of sequences. Exposure time is 5 s. The full-length gels are presented in Supplementary Figure S1 .

    Article Snippet: General information Bst DNA polymerase Large fragment (Bst LF), Bst 2.0 DNA polymerase (Bst 2.0), Bst 2.0 WarmStart DNA polymerase (Bst 2.0 WS), Bst 3.0 DNA polymerase (Bst 3.0), Klenow fragment polymerase (Klenow), Klenow fragment exo- polymerase (Klenow (exo-)), Vent exo- DNA polymerase (Vent (exo-)), and dNTP Mix were purchased from New England Biolabs.

    Techniques: Fluorescence, Electrophoresis, Incubation, Agarose Gel Electrophoresis, Marker, Labeling, Polyacrylamide Gel Electrophoresis

    Robust PCR-amplification of insert DNA fragments using deoxyinosine-containing primers. Analytical agarose gel electrophoresis of PCR products produced by Taq polymerase using either plasmid DNA (A) or E. coli colonies (B) as template material. Relative to the calculated T m , annealing temperatures used for PCR cycling are indicated for each lane.

    Journal: BMC Biotechnology

    Article Title: Directional cloning of DNA fragments using deoxyinosine-containing oligonucleotides and endonuclease V

    doi: 10.1186/1472-6750-13-81

    Figure Lengend Snippet: Robust PCR-amplification of insert DNA fragments using deoxyinosine-containing primers. Analytical agarose gel electrophoresis of PCR products produced by Taq polymerase using either plasmid DNA (A) or E. coli colonies (B) as template material. Relative to the calculated T m , annealing temperatures used for PCR cycling are indicated for each lane.

    Article Snippet: PCR-based amplification of target DNA fragments Taq DNA polymerase and dNTP mix were obtained from New England Biolabs (Frankfurt am Main, Germany).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Produced, Plasmid Preparation

    FANA transcription and reverse transcription in vitro. a Constitutional structures for 2’-deoxyribonucleic acid (DNA) and 2’-fluoroarabino nucleic acid (FANA). b FANA transcription activity for wild-type archaeal DNA polymerases (exo−) from 9°N, DV, Kod, and Tgo (left panel). Samples were analyzed after 15 and 30 min at 55 °C. FANA reverse transcriptase activity of Bst DNA polymerase LF, 2.0, 3.0, and LF* (right panel). LF* denotes wild-type Bst DNA polymerase, large fragment, expressed and purified from E. coli . Samples were analyzed after 30 min at 50 °C. All samples were resolved on denaturing PAGE and visualized using a LI-COR Odyssey CLx. c Fidelity profile observed for FANA replication using Tgo and Bst LF* polymerases. The mutation profile reveals a mutation rate of 8 × 10 -4 and an overall fidelity of ~99.9%. d Catalytic rates observed for FANA synthesis with Tgo (left panel) and reverse transcription with Bst LF* (right panel)

    Journal: Nature Communications

    Article Title: Evolution of a General RNA-Cleaving FANA Enzyme

    doi: 10.1038/s41467-018-07611-1

    Figure Lengend Snippet: FANA transcription and reverse transcription in vitro. a Constitutional structures for 2’-deoxyribonucleic acid (DNA) and 2’-fluoroarabino nucleic acid (FANA). b FANA transcription activity for wild-type archaeal DNA polymerases (exo−) from 9°N, DV, Kod, and Tgo (left panel). Samples were analyzed after 15 and 30 min at 55 °C. FANA reverse transcriptase activity of Bst DNA polymerase LF, 2.0, 3.0, and LF* (right panel). LF* denotes wild-type Bst DNA polymerase, large fragment, expressed and purified from E. coli . Samples were analyzed after 30 min at 50 °C. All samples were resolved on denaturing PAGE and visualized using a LI-COR Odyssey CLx. c Fidelity profile observed for FANA replication using Tgo and Bst LF* polymerases. The mutation profile reveals a mutation rate of 8 × 10 -4 and an overall fidelity of ~99.9%. d Catalytic rates observed for FANA synthesis with Tgo (left panel) and reverse transcription with Bst LF* (right panel)

    Article Snippet: ThermoPol buffer, Taq DNA polymerase, G. stearothermophilus Bst DNA polymerase, LF, and its variants Bst 2.0 DNA polymerase (2.0), and Bst 3.0 DNA polymerase (3.0), DH5α competent cells, and Monarch DNA gel extraction kits were purchased from New England Biolabs (Ipswich, MA).

    Techniques: In Vitro, Activity Assay, Purification, Polyacrylamide Gel Electrophoresis, Mutagenesis