dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 High-Fidelity DNA Polymerase
    Description:

    Catalog Number:
    M0491L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs dna polymerase
    In vitro reconstitution of the <t>DNA</t> lesion bypass through the template switch mechanism. ( A ) The scheme of the lesion bypass via a mechanism that involves fork regression, DNA synthesis using the resulted chicken foot structure as a template, and fork restoration. The circle indicates the position of iso-C that mimics a DNA lesion at the stalled replication fork. The asterisk indicates the 32 P-label. Shaded regions denote heterologous DNA terminal branches that prevent complete strand separation during fork regression. The numbers indicate the numbers and length (nt) of the DNA fragments in the substrates and the products of the reaction. ( B ) DNA polymerase reactions were carried out using DNA polymerase I <t>Klenow</t> Fragment (10 ng/ml) and the replication fork (#290/417* + #340/341) (32 nM, molecules) (left) or the chicken foot structure (#341/342* + #340/290) (32 nM, molecules) (right) as templates. RAD54 (100 nM), BLM (50 nM) and RAD51 (200 nM) were added to the reactions as indicated in ‘Materials and Methods’ section. The products of DNA synthesis were analyzed by electrophoresis in a 15% denaturing polyacrylamide gel.

    https://www.bioz.com/result/dna polymerase/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Cooperation of RAD51 and RAD54 in regression of a model replication fork"

    Article Title: Cooperation of RAD51 and RAD54 in regression of a model replication fork

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq1139

    In vitro reconstitution of the DNA lesion bypass through the template switch mechanism. ( A ) The scheme of the lesion bypass via a mechanism that involves fork regression, DNA synthesis using the resulted chicken foot structure as a template, and fork restoration. The circle indicates the position of iso-C that mimics a DNA lesion at the stalled replication fork. The asterisk indicates the 32 P-label. Shaded regions denote heterologous DNA terminal branches that prevent complete strand separation during fork regression. The numbers indicate the numbers and length (nt) of the DNA fragments in the substrates and the products of the reaction. ( B ) DNA polymerase reactions were carried out using DNA polymerase I Klenow Fragment (10 ng/ml) and the replication fork (#290/417* + #340/341) (32 nM, molecules) (left) or the chicken foot structure (#341/342* + #340/290) (32 nM, molecules) (right) as templates. RAD54 (100 nM), BLM (50 nM) and RAD51 (200 nM) were added to the reactions as indicated in ‘Materials and Methods’ section. The products of DNA synthesis were analyzed by electrophoresis in a 15% denaturing polyacrylamide gel.
    Figure Legend Snippet: In vitro reconstitution of the DNA lesion bypass through the template switch mechanism. ( A ) The scheme of the lesion bypass via a mechanism that involves fork regression, DNA synthesis using the resulted chicken foot structure as a template, and fork restoration. The circle indicates the position of iso-C that mimics a DNA lesion at the stalled replication fork. The asterisk indicates the 32 P-label. Shaded regions denote heterologous DNA terminal branches that prevent complete strand separation during fork regression. The numbers indicate the numbers and length (nt) of the DNA fragments in the substrates and the products of the reaction. ( B ) DNA polymerase reactions were carried out using DNA polymerase I Klenow Fragment (10 ng/ml) and the replication fork (#290/417* + #340/341) (32 nM, molecules) (left) or the chicken foot structure (#341/342* + #340/290) (32 nM, molecules) (right) as templates. RAD54 (100 nM), BLM (50 nM) and RAD51 (200 nM) were added to the reactions as indicated in ‘Materials and Methods’ section. The products of DNA synthesis were analyzed by electrophoresis in a 15% denaturing polyacrylamide gel.

    Techniques Used: In Vitro, DNA Synthesis, Electrophoresis

    2) Product Images from "Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)"

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    Journal:

    doi: 10.1074/jbc.M110.162925

    Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),
    Figure Legend Snippet: Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),

    Techniques Used: Labeling

    AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32
    Figure Legend Snippet: AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32

    Techniques Used: Labeling

    Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),
    Figure Legend Snippet: Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),

    Techniques Used:

    AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol
    Figure Legend Snippet: AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol

    Techniques Used: Labeling

    Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol
    Figure Legend Snippet: Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol

    Techniques Used: Labeling

    SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of
    Figure Legend Snippet: SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of

    Techniques Used: Labeling

    3) Product Images from "RAD54 controls access to the invading 3?-OH end after RAD51-mediated DNA strand invasion in homologous recombination in Saccharomyces cerevisiae"

    Article Title: RAD54 controls access to the invading 3?-OH end after RAD51-mediated DNA strand invasion in homologous recombination in Saccharomyces cerevisiae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn980

    Rad51–K191R requires higher Rad54 concentrations for efficient D-loop extension. ( A ) Rad51 titration in the D-loop extension assay with Pst I-95-mer: 0.17 µM (lanes 2–4), 0.34 µM (lanes 5–7), 0.5 µM (lanes 8–10), 0.67 µM (lanes 11–13), 1 µM (lanes 14–16), and 2 µM (lanes 18–20). Reactions contain 72 nM Rad54, as determined to be the optimum in Supplementary Figure 4 . Lane 1 shows end-labeled Pst I-linearized pUC19 as a size marker. ( B ) Rad51–K191R titration, otherwise as in (A). The signals labeled by asterisk in A and B are generated by the proofreading activity (3′–5′ exonuclease) of Klenow polymerase as determined in reconstruction experiments and verified using a proofreading-deficient version of Klenow polymerase (data not shown). This signal disappears when Rad51 fully occupies the 95-mer, further validating that Klenow polymerase has no access to the 3′-OH end with Rad51 bound to it. ( C ) Quantitation of the Rad51 and Rad51–K191R protein titration results in (a, b; 20 min time points). A higher stoichiometry (1/2 nt) is optimal for the Rad51–K191R protein compared to the 1/4 nt stoichiometry for the wild-type Rad51 protein. This was expected from previous results showing a DNA-binding defect for the Rad51–K191R protein, requiring higher protein to DNA ratios to assemble saturated protein filaments ( 7 ). ( D ) Titration of Rad54 in D-loop extension assay with Rad51 at optimal 1/4 stoichiometry. ( E ) Titration of Rad54 in D-loop extension assay with Rad51–K191R at optimal 1/2 stoichiometry. ( F ) Quantitation of results in (D, E; 20 min time points). The results were normalized for the amount of linear D-loops captured by psoralen crosslinking under each assay condition. D-loop extension with wild-type Rad51 reaches an optimum at 36 nM Rad54, whereas the optimum with Rad51–K191R is reached at 54 nM. Shown are the means from three determinations; error bars represent 1 SD.
    Figure Legend Snippet: Rad51–K191R requires higher Rad54 concentrations for efficient D-loop extension. ( A ) Rad51 titration in the D-loop extension assay with Pst I-95-mer: 0.17 µM (lanes 2–4), 0.34 µM (lanes 5–7), 0.5 µM (lanes 8–10), 0.67 µM (lanes 11–13), 1 µM (lanes 14–16), and 2 µM (lanes 18–20). Reactions contain 72 nM Rad54, as determined to be the optimum in Supplementary Figure 4 . Lane 1 shows end-labeled Pst I-linearized pUC19 as a size marker. ( B ) Rad51–K191R titration, otherwise as in (A). The signals labeled by asterisk in A and B are generated by the proofreading activity (3′–5′ exonuclease) of Klenow polymerase as determined in reconstruction experiments and verified using a proofreading-deficient version of Klenow polymerase (data not shown). This signal disappears when Rad51 fully occupies the 95-mer, further validating that Klenow polymerase has no access to the 3′-OH end with Rad51 bound to it. ( C ) Quantitation of the Rad51 and Rad51–K191R protein titration results in (a, b; 20 min time points). A higher stoichiometry (1/2 nt) is optimal for the Rad51–K191R protein compared to the 1/4 nt stoichiometry for the wild-type Rad51 protein. This was expected from previous results showing a DNA-binding defect for the Rad51–K191R protein, requiring higher protein to DNA ratios to assemble saturated protein filaments ( 7 ). ( D ) Titration of Rad54 in D-loop extension assay with Rad51 at optimal 1/4 stoichiometry. ( E ) Titration of Rad54 in D-loop extension assay with Rad51–K191R at optimal 1/2 stoichiometry. ( F ) Quantitation of results in (D, E; 20 min time points). The results were normalized for the amount of linear D-loops captured by psoralen crosslinking under each assay condition. D-loop extension with wild-type Rad51 reaches an optimum at 36 nM Rad54, whereas the optimum with Rad51–K191R is reached at 54 nM. Shown are the means from three determinations; error bars represent 1 SD.

    Techniques Used: Titration, Labeling, Marker, Generated, Activity Assay, Quantitation Assay, Binding Assay

    Rad54 is required for D-loop extension. D-loop extension assays. The Pst I-95-mer is homologous to the terminal sequence of the Pst I-linearized pUC19 DNA (2686 bp). Reaction products are identified either by end-labeling the 95-mer ( A , B , F ) or by incorporation of α- 32 P-dGTP ( C – E , G ). (A) D-loop extension assay with end-labeled Pst I-95-mer. Rad51 nucleoprotein filaments were incubated either in the presence of Rad54 (72 nM, lanes 9–11), or absence of Rad54 (lanes 6–8), or absence of DNA polymerase I (Klenow fragment 24 nM, lanes 12–14). Protein-free 95-mer was also incubated either in the presence of Rad54 (72 nM, lanes 3–5), or absence of Rad54 (lanes 15–17). Lane 1 shows end-labeled Pst I-linearized pUC19 as a size marker, and lane 2 the end-labeled 95-mer. (B) Quantification of the results for D-loop extension in (A). (C) D-loop extension assay with α- 32 P-dGTP and unlabeled Pst I-95-mer. Reactions were as in (A), except lane 2 contains unlabeled Pst I-95-mer and lanes 18–20 show Pst I-linearized pUC19 with DNA polymerase I (Klenow fragment, 24 nM). (D) Quantification of the stable extension product from (C). Stable extension products are D-loops of sufficient length to be stable under electrophoresis conditions. (E) Quantification of the unstable extension product from (C). Unstable extension products are extended 95-mers with insufficient length to result in stable D-loops under electrophoresis conditions. For (B)–(E) shown are means from three determinations; error bars represent 1 SD. (F) Analysis of extension products on denaturing gel from reactions with end-labeled 95-mer and (G) with α- 32 P-dGTP. The signals labeled by asterisk are due to a combination of 3′–5′ exonuclease (proofreading) and/or polymerase activity of Klenow polymerase on the 95-mer or the linear dsDNA.
    Figure Legend Snippet: Rad54 is required for D-loop extension. D-loop extension assays. The Pst I-95-mer is homologous to the terminal sequence of the Pst I-linearized pUC19 DNA (2686 bp). Reaction products are identified either by end-labeling the 95-mer ( A , B , F ) or by incorporation of α- 32 P-dGTP ( C – E , G ). (A) D-loop extension assay with end-labeled Pst I-95-mer. Rad51 nucleoprotein filaments were incubated either in the presence of Rad54 (72 nM, lanes 9–11), or absence of Rad54 (lanes 6–8), or absence of DNA polymerase I (Klenow fragment 24 nM, lanes 12–14). Protein-free 95-mer was also incubated either in the presence of Rad54 (72 nM, lanes 3–5), or absence of Rad54 (lanes 15–17). Lane 1 shows end-labeled Pst I-linearized pUC19 as a size marker, and lane 2 the end-labeled 95-mer. (B) Quantification of the results for D-loop extension in (A). (C) D-loop extension assay with α- 32 P-dGTP and unlabeled Pst I-95-mer. Reactions were as in (A), except lane 2 contains unlabeled Pst I-95-mer and lanes 18–20 show Pst I-linearized pUC19 with DNA polymerase I (Klenow fragment, 24 nM). (D) Quantification of the stable extension product from (C). Stable extension products are D-loops of sufficient length to be stable under electrophoresis conditions. (E) Quantification of the unstable extension product from (C). Unstable extension products are extended 95-mers with insufficient length to result in stable D-loops under electrophoresis conditions. For (B)–(E) shown are means from three determinations; error bars represent 1 SD. (F) Analysis of extension products on denaturing gel from reactions with end-labeled 95-mer and (G) with α- 32 P-dGTP. The signals labeled by asterisk are due to a combination of 3′–5′ exonuclease (proofreading) and/or polymerase activity of Klenow polymerase on the 95-mer or the linear dsDNA.

    Techniques Used: Sequencing, End Labeling, Labeling, Incubation, Marker, Electrophoresis, Activity Assay

    4) Product Images from "Integrating gene synthesis and microfluidic protein analysis for rapid protein engineering"

    Article Title: Integrating gene synthesis and microfluidic protein analysis for rapid protein engineering

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1497

    APE-MITOMI applied to ZF TF module combinatorics. ( A ) Cartoon model of canonical Cys 2 His 2 ZF TF binding to DNA with residues −1, 2, 3 and 6 of the recognition helix primarily encoding DNA specificity. Residue 2 makes a cross-strand contact, which creates ‘context dependent’ effects. ( B ) Schematic of the APE solid-phase gene assembly technique, showing assembly through the first two extension steps. ( C ) Process timeline from gene assembly to protein characterization. ( D ) Comparison of APE error rate with values from previously published gene assembly techniques. A line between two points indicates a range of error rates from different experimental conditions. ( E ) Overview of experimental results obtained from combinatoric assembly of ZF TFs demonstrating protein expression and functional DNA binding success rates. ( F ) Heatmap of relative binding affinities for each assembled ZF TF ( y -axis) to 64 predicted consensus DNA targets ( x -axis). Protein naming convention indicates ZF domain from C-to-N (F3 to F1), where AAA (A f3 A f2 A f1 ) = Zif268, BBB = 37–12, CCC = 92–1, DDD = 158–2 ( 14 ); for example, protein ABC = F3 from Zif268, F2 from 37–12, F1 from 92–1; target ABC = Zif268 F3 binding consensus triplet GCG, 37–12 F2 binding consensus GAC, 92–1 F1 binding consensus triplet GCC (5′-GCG GAC GCC). The values represent averages of multiple measurements and the precise number of technical repeats and a histogram thereof are shown in Supplementary Figures S7 and S8, respectively. Oligomer assembly and target sequences are given in Supplementary Tables S7 and S8.
    Figure Legend Snippet: APE-MITOMI applied to ZF TF module combinatorics. ( A ) Cartoon model of canonical Cys 2 His 2 ZF TF binding to DNA with residues −1, 2, 3 and 6 of the recognition helix primarily encoding DNA specificity. Residue 2 makes a cross-strand contact, which creates ‘context dependent’ effects. ( B ) Schematic of the APE solid-phase gene assembly technique, showing assembly through the first two extension steps. ( C ) Process timeline from gene assembly to protein characterization. ( D ) Comparison of APE error rate with values from previously published gene assembly techniques. A line between two points indicates a range of error rates from different experimental conditions. ( E ) Overview of experimental results obtained from combinatoric assembly of ZF TFs demonstrating protein expression and functional DNA binding success rates. ( F ) Heatmap of relative binding affinities for each assembled ZF TF ( y -axis) to 64 predicted consensus DNA targets ( x -axis). Protein naming convention indicates ZF domain from C-to-N (F3 to F1), where AAA (A f3 A f2 A f1 ) = Zif268, BBB = 37–12, CCC = 92–1, DDD = 158–2 ( 14 ); for example, protein ABC = F3 from Zif268, F2 from 37–12, F1 from 92–1; target ABC = Zif268 F3 binding consensus triplet GCG, 37–12 F2 binding consensus GAC, 92–1 F1 binding consensus triplet GCC (5′-GCG GAC GCC). The values represent averages of multiple measurements and the precise number of technical repeats and a histogram thereof are shown in Supplementary Figures S7 and S8, respectively. Oligomer assembly and target sequences are given in Supplementary Tables S7 and S8.

    Techniques Used: Binding Assay, Expressing, Functional Assay, Countercurrent Chromatography

    5) Product Images from "Motif programming: a microgene-based method for creating synthetic proteins containing multiple functional motifs"

    Article Title: Motif programming: a microgene-based method for creating synthetic proteins containing multiple functional motifs

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm017

    Mixing four BH motifs. ( A ) Structure of human Bcl-xL, an anti-apoptotic multidomain protein (based on the [1R2D]). The core regions of the BH1, BH2, BH3 and BH4 motifs focused on in this study are shown in cyan, orange, red and green, respectively, though we used the BH3 motif from Noxa instead of Bcl-xL. ( B ) Core microgenes that encode BH peptides in their first reading frames; the color scheme is the same as in (A). ( C ) MPR primers used in this study. CACC tetranucleotides that facilitated directional cloning into pcDNA were added at the 5′ end of the sense primers (BH3 S and BH4 S ). Six base pairs were formed in the 3′-regions between the sense and antisense primers. They also have mismatched adenosines at their 3′-OH ends (shown in purple). Derivatives of antisense primers (BH1 AS+ , BH2 AS+ and BH3 AS+ ) had an extra CC at their 5′ termini so that the reconstituted microgenes would have lengths that were multiples of three. To monitor incorporation of the corresponding blocks into polymers, the recognition sequences for SalI, XhoI, HindIII, BglII and EcoRI were introduced into BH4 S , BH3 S , BH3 AS(+) , BH2 AS(+) and BH1 AS(+) , respectively (shown by italics). ( D) The designed microgenes used in this study. They generated the BH1 core –BH4 core peptide motifs, which consisted of arranged blocks. ( E ) Microgenes polymers prepared from combinations of the primers shown in Table 1 . The DNA polymers obtained from pools a–d were digested with the motif-specific restriction enzymes and electrophoresed through 1% agarose.
    Figure Legend Snippet: Mixing four BH motifs. ( A ) Structure of human Bcl-xL, an anti-apoptotic multidomain protein (based on the [1R2D]). The core regions of the BH1, BH2, BH3 and BH4 motifs focused on in this study are shown in cyan, orange, red and green, respectively, though we used the BH3 motif from Noxa instead of Bcl-xL. ( B ) Core microgenes that encode BH peptides in their first reading frames; the color scheme is the same as in (A). ( C ) MPR primers used in this study. CACC tetranucleotides that facilitated directional cloning into pcDNA were added at the 5′ end of the sense primers (BH3 S and BH4 S ). Six base pairs were formed in the 3′-regions between the sense and antisense primers. They also have mismatched adenosines at their 3′-OH ends (shown in purple). Derivatives of antisense primers (BH1 AS+ , BH2 AS+ and BH3 AS+ ) had an extra CC at their 5′ termini so that the reconstituted microgenes would have lengths that were multiples of three. To monitor incorporation of the corresponding blocks into polymers, the recognition sequences for SalI, XhoI, HindIII, BglII and EcoRI were introduced into BH4 S , BH3 S , BH3 AS(+) , BH2 AS(+) and BH1 AS(+) , respectively (shown by italics). ( D) The designed microgenes used in this study. They generated the BH1 core –BH4 core peptide motifs, which consisted of arranged blocks. ( E ) Microgenes polymers prepared from combinations of the primers shown in Table 1 . The DNA polymers obtained from pools a–d were digested with the motif-specific restriction enzymes and electrophoresed through 1% agarose.

    Techniques Used: Clone Assay, Generated

    Mixing four short DNAs using the new protocol. ( A ) MPR primers A S (sense), B AS , C AS and D AS (all antisense) were designed so that they contained a restriction endonuclease recognition site (red, orange, green or cyan). The sense and antisense primers overlap at the 3′-region, forming six base pairs (shown by black bars). All of the primers had a mismatched adenosine residue at the 3′-OH end (represented by a purple A with asterisks). ( B ) Polymerization of four microgenes. The four MPR primers described in (A) were polymerized to yield a large DNA fragment; note that a pair of MPR primers (both sense and antisense) was necessary for the polymerization (compare lane 1 with lanes 2–6). The sense primer A S (0.4 µM) and antisense primers (B AS , C AS and D AS ; 0.4 µM total) were mixed as shown in the figure. ( C ) The MPR products obtained were digested with the indicated restriction enzymes and analyzed by gel electrophoresis (1% agarose). The primers used and their concentrations were same as in (B): lanes 1–4, A S (0.4 µM) + B AS (0.4 µM); lanes 5–8, A S (0.4 µM) + C AS (0.4 µM); lanes 9–12, A S (0.4 µM) + D AS (0.4 µM); lanes 13–16, A S (0.4 µM) + B AS (0.2 µM) + C AS (0.2 µM); lanes 17–20, A S (0.4 µM) + B AS (0.134 µM) + C AS (0.134 µM) + D AS (0.134 µM); lane M, size standards.
    Figure Legend Snippet: Mixing four short DNAs using the new protocol. ( A ) MPR primers A S (sense), B AS , C AS and D AS (all antisense) were designed so that they contained a restriction endonuclease recognition site (red, orange, green or cyan). The sense and antisense primers overlap at the 3′-region, forming six base pairs (shown by black bars). All of the primers had a mismatched adenosine residue at the 3′-OH end (represented by a purple A with asterisks). ( B ) Polymerization of four microgenes. The four MPR primers described in (A) were polymerized to yield a large DNA fragment; note that a pair of MPR primers (both sense and antisense) was necessary for the polymerization (compare lane 1 with lanes 2–6). The sense primer A S (0.4 µM) and antisense primers (B AS , C AS and D AS ; 0.4 µM total) were mixed as shown in the figure. ( C ) The MPR products obtained were digested with the indicated restriction enzymes and analyzed by gel electrophoresis (1% agarose). The primers used and their concentrations were same as in (B): lanes 1–4, A S (0.4 µM) + B AS (0.4 µM); lanes 5–8, A S (0.4 µM) + C AS (0.4 µM); lanes 9–12, A S (0.4 µM) + D AS (0.4 µM); lanes 13–16, A S (0.4 µM) + B AS (0.2 µM) + C AS (0.2 µM); lanes 17–20, A S (0.4 µM) + B AS (0.134 µM) + C AS (0.134 µM) + D AS (0.134 µM); lane M, size standards.

    Techniques Used: Nucleic Acid Electrophoresis

    Schematic diagram of a motif-mixing protocol used in this study. Initially, we designed DNA sequences for microgenes core that each encode a peptide motif to be mixed in their first reading frames, after which sense and antisense MPR primers were synthesized based on these microgenes core . These primers share 3′ sequences that enable base-pair formation between the sense and antisense primers, but contain mismatched bases at their 3′-OH ends (shown by red letters with dots). In the polymerization step, motifs can be embedded either in the sense or antisense primer. In the figure, motifs A and B are embedded in the sense primers, producing primers A S and B S , while motifs C and D are in the antisense primers, producing primers C AS and D AS . The thermal cycle reaction is carried out in the presence of these MPR primers, a thermostable, a DNA polymerase and dNTP. The resultant high molecular weight DNAs are combinatorial polymers of multiple microgenes created by stochastic base paring of the MPR primers. In some clones, nucleotide insertions or deletions allow frame shift mutations (denoted by FS), so that peptide sequences encoded by the second and third reading frames appear in the translated products.
    Figure Legend Snippet: Schematic diagram of a motif-mixing protocol used in this study. Initially, we designed DNA sequences for microgenes core that each encode a peptide motif to be mixed in their first reading frames, after which sense and antisense MPR primers were synthesized based on these microgenes core . These primers share 3′ sequences that enable base-pair formation between the sense and antisense primers, but contain mismatched bases at their 3′-OH ends (shown by red letters with dots). In the polymerization step, motifs can be embedded either in the sense or antisense primer. In the figure, motifs A and B are embedded in the sense primers, producing primers A S and B S , while motifs C and D are in the antisense primers, producing primers C AS and D AS . The thermal cycle reaction is carried out in the presence of these MPR primers, a thermostable, a DNA polymerase and dNTP. The resultant high molecular weight DNAs are combinatorial polymers of multiple microgenes created by stochastic base paring of the MPR primers. In some clones, nucleotide insertions or deletions allow frame shift mutations (denoted by FS), so that peptide sequences encoded by the second and third reading frames appear in the translated products.

    Techniques Used: Synthesized, Molecular Weight, Clone Assay

    ( A ) Primary structure of synthetic proteins generated from four libraries (pools a–d) prepared under different conditions (see also Table 1 ). Forty-one clones were sequenced, and their expression was investigated in MCF-7 cells. Transient protein expression in MCF-7 cells was observed for 28 of the 41 clones (68%, shown by bold black bars), which was detected immunohistochemically using anti-c-myc antibody; all of the synthetic proteins contained a myc epitope (EQKLISEEDL) and a poly-histidine tag at their C-terminus. The lengths of the bars correspond to the relative number of amino acids (e.g. d29 has 221 amino acid residues). The order and arrangement of BH1–BH4 core in each protein are shown by squares (the color coding of each motif is the same as in Figure 4 ). In pools-a and -b, MPR primers were designed so that the reconstituted microgenes would have lengths that were not multiples of three. The reading frame of the microgene polymers was altered at every junction between the microgene units, unless the junction contained insertion/deletion mutations. In contrast, the microgenes in pools-c and -d were designed to maintain the reading frame throughout the polymers. Reflecting this design, clones obtained from pools-c and -d contained fewer frameshifts than those from pools-a and -b. ( B ) MCF-7 cells were transfected with DNA encoding a8, a10, a12 or empty vector (control), and after 24 h, the clones were analyzed by western blotting using anti-myc antibody. Predicted sizes of synthetic proteins were detected.
    Figure Legend Snippet: ( A ) Primary structure of synthetic proteins generated from four libraries (pools a–d) prepared under different conditions (see also Table 1 ). Forty-one clones were sequenced, and their expression was investigated in MCF-7 cells. Transient protein expression in MCF-7 cells was observed for 28 of the 41 clones (68%, shown by bold black bars), which was detected immunohistochemically using anti-c-myc antibody; all of the synthetic proteins contained a myc epitope (EQKLISEEDL) and a poly-histidine tag at their C-terminus. The lengths of the bars correspond to the relative number of amino acids (e.g. d29 has 221 amino acid residues). The order and arrangement of BH1–BH4 core in each protein are shown by squares (the color coding of each motif is the same as in Figure 4 ). In pools-a and -b, MPR primers were designed so that the reconstituted microgenes would have lengths that were not multiples of three. The reading frame of the microgene polymers was altered at every junction between the microgene units, unless the junction contained insertion/deletion mutations. In contrast, the microgenes in pools-c and -d were designed to maintain the reading frame throughout the polymers. Reflecting this design, clones obtained from pools-c and -d contained fewer frameshifts than those from pools-a and -b. ( B ) MCF-7 cells were transfected with DNA encoding a8, a10, a12 or empty vector (control), and after 24 h, the clones were analyzed by western blotting using anti-myc antibody. Predicted sizes of synthetic proteins were detected.

    Techniques Used: Generated, Clone Assay, Expressing, Transfection, Plasmid Preparation, Western Blot

    6) Product Images from "ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes"

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1249

    Concerted action of in vitro assembly and full length RecE/RecT improves the efficiency of direct cloning. ( A ) A schematic diagram illustrating direct cloning of the 14-kb lux gene cluster from Photobacterium phosphoreum ANT-2200. The linear p15A-cm vector and target genomic segment have identical sequences at both ends. ( B ) Longer homology arms increase the cloning efficiency of ExoCET. The linear vector flanked by 25-, 40- or 80-bp homology arms was mixed with genomic DNA and treated with 0.02 U μl −1 T4pol at 25°C for 20 min before annealing and electroporation into arabinose induced Escherichia coli GB05-dir. Error bars, s.d.; n = 3. ( C ) Titration of T4pol amount for ExoCET. The linear vector with 80-bp homology arms and genomic DNA were treated as in (B) except the amount of T4pol was altered as indicated. ( D ) Incubation time of T4pol on cloning efficiency. As for (C) using 0.02 U μl −1 T4pol except the incubation time was altered as indicated. ( E ) Higher copy number of ETgA increases ExoCET cloning efficiency. As for (D) using 1 h and electroporation into arabinose induced E. coli GB05-dir (one copy of ETgA on the chromosome), GB2005 harboring pSC101-BAD-ETgA-tet (approximately five copies of ETgA on pSC101 plasmids) or GB05-dir harboring pSC101-BAD-ETgA-tet (approximately six copies of ETgA ) as indicated. ( F ) ExoCET increases direct cloning efficiency. As for (E) using E. coli GB05-dir harboring pSC101-BAD-ETgA-tet (ExoCET) or omission of T4pol from the in vitro assembly (ETgA) or omission of the arabinose induction of pSC101-BAD-ETgA-tet (T4pol). ( G ) As for (F) except the 53 kb plu2670 gene cluster was directly cloned. Accuracy denotes the success of direct cloning as evaluated by restriction digestions ( Supplementary Figure S4 ). Each experiment was performed in triplicate ( n = 3) and error bars show standard deviation (s.d).
    Figure Legend Snippet: Concerted action of in vitro assembly and full length RecE/RecT improves the efficiency of direct cloning. ( A ) A schematic diagram illustrating direct cloning of the 14-kb lux gene cluster from Photobacterium phosphoreum ANT-2200. The linear p15A-cm vector and target genomic segment have identical sequences at both ends. ( B ) Longer homology arms increase the cloning efficiency of ExoCET. The linear vector flanked by 25-, 40- or 80-bp homology arms was mixed with genomic DNA and treated with 0.02 U μl −1 T4pol at 25°C for 20 min before annealing and electroporation into arabinose induced Escherichia coli GB05-dir. Error bars, s.d.; n = 3. ( C ) Titration of T4pol amount for ExoCET. The linear vector with 80-bp homology arms and genomic DNA were treated as in (B) except the amount of T4pol was altered as indicated. ( D ) Incubation time of T4pol on cloning efficiency. As for (C) using 0.02 U μl −1 T4pol except the incubation time was altered as indicated. ( E ) Higher copy number of ETgA increases ExoCET cloning efficiency. As for (D) using 1 h and electroporation into arabinose induced E. coli GB05-dir (one copy of ETgA on the chromosome), GB2005 harboring pSC101-BAD-ETgA-tet (approximately five copies of ETgA on pSC101 plasmids) or GB05-dir harboring pSC101-BAD-ETgA-tet (approximately six copies of ETgA ) as indicated. ( F ) ExoCET increases direct cloning efficiency. As for (E) using E. coli GB05-dir harboring pSC101-BAD-ETgA-tet (ExoCET) or omission of T4pol from the in vitro assembly (ETgA) or omission of the arabinose induction of pSC101-BAD-ETgA-tet (T4pol). ( G ) As for (F) except the 53 kb plu2670 gene cluster was directly cloned. Accuracy denotes the success of direct cloning as evaluated by restriction digestions ( Supplementary Figure S4 ). Each experiment was performed in triplicate ( n = 3) and error bars show standard deviation (s.d).

    Techniques Used: In Vitro, Clone Assay, Plasmid Preparation, Electroporation, Titration, Incubation, Standard Deviation

    7) Product Images from "Disclosing early steps of protein-primed genome replication of the Gram-positive tectivirus Bam35"

    Article Title: Disclosing early steps of protein-primed genome replication of the Gram-positive tectivirus Bam35

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw673

    Role of conserved residue Y172 in the interaction with the DNAP. ( A ) Template-independent initiation products of increasing concentrations of wild type and Y172F and Y172A TP mutants. Reactions were carried out with the indicated concentrations of TP and triggered with 1 mM MnCl 2 . ( B ) Comparative analysis of wild type and Y172A and Y172F mutant TPs interaction with the DNA polymerase. Shown are mean and standard error of three independent experiments. See Materials and Methods for details. ( C ) TP-primed replication of 29-mer single stranded oligonucleotide template containing the Bam35 genome origin sequence, using either wild type or Y172F TPs as primer. Time-course of full-length replication, relative to the initial events. Shown are mean and standard error of three independent experiments. The inset panel shows a representative SDS-PAGE of initiation (with dTTP) and replication (with all 4 dNTPs) products primed by the wild type or Y172F TPs after 30 min of reaction.
    Figure Legend Snippet: Role of conserved residue Y172 in the interaction with the DNAP. ( A ) Template-independent initiation products of increasing concentrations of wild type and Y172F and Y172A TP mutants. Reactions were carried out with the indicated concentrations of TP and triggered with 1 mM MnCl 2 . ( B ) Comparative analysis of wild type and Y172A and Y172F mutant TPs interaction with the DNA polymerase. Shown are mean and standard error of three independent experiments. See Materials and Methods for details. ( C ) TP-primed replication of 29-mer single stranded oligonucleotide template containing the Bam35 genome origin sequence, using either wild type or Y172F TPs as primer. Time-course of full-length replication, relative to the initial events. Shown are mean and standard error of three independent experiments. The inset panel shows a representative SDS-PAGE of initiation (with dTTP) and replication (with all 4 dNTPs) products primed by the wild type or Y172F TPs after 30 min of reaction.

    Techniques Used: Mutagenesis, Sequencing, SDS Page

    Mapping Bam35 TP priming residue. ( A ) Multiple sequence alignment of Bam35 TP and related TPs. Sequences used were from putative TPs (proteins encoded by ORF4) of representative related Gram-positive tectiviruses Bam35 (NCBI ID NP_943750.1, 10), GIL16 (YP_224102.1, 47), AP50 (YP_002302516.1, 30), as well as other BLAST-retrieved orthologous sequences from NR protein database and tentatively annotated as bacterial proteins from Bacillus cereus (WP_001085581.1), Streptococcus pneumoniae (WP_050224775.1), Exiguobacerium antarticum (WP_026829749.1), Bacillus flexus (WP_025907183.1) and Brevibacillus sp. CF112 (WP_007784052.1). These bacterial proteins may correspond to TPs from uncharacterized tectivirus-like prophages or linear plasmids from Gram-positive hosts. Sequences were aligned with MUSCLE algorithm implemented in Geneious R8 software ( 48 ). The C-terminal fragment of all proteins that corresponds with the bromide cyanogen cleavage product is shadowed in blue and the tyrosine residues present in the Bam35 portion are highlighted in pink. Conserved Y172 and Y194 residues are marked with an asterisk above the sequences. ( B ) Determination of the nature of the Bam35 TP priming residue by alkali treatment. Control initiation reactions with Φ29 DNA polymerase and TP were performed in parallel. After the initiation reaction, samples were incubated for 6 min at 95°C in the absence or presence of 100 mM NaOH, and subsequently neutralized and analyzed by SDS-PAGE and autoradiography. ( C ) Mapping the Bam35 TP priming residue. The TP-AMP complexes were performed as described and afterward treated with 1.2 mM of cyanogen bromide (CNBr) and 200 mM HCl for 20 h at room temperature. Finally, the samples were neutralized and analyzed by SDS-18% polyacrylamide electrophoresis. ( D ) Identification of Y194 as the priming residue by TP-deoxyadenylation assays with 0.5 or 2 μl of cell-free extracts of bacterial cultures expressing the TP variants. Extracts prepared from bacteria harboring the empty plasmid (lanes 1, 2) and the wild type TP expression vector (lanes 3, 4) were also used as negative or positive controls, respectively. See Materials and Methods for details.
    Figure Legend Snippet: Mapping Bam35 TP priming residue. ( A ) Multiple sequence alignment of Bam35 TP and related TPs. Sequences used were from putative TPs (proteins encoded by ORF4) of representative related Gram-positive tectiviruses Bam35 (NCBI ID NP_943750.1, 10), GIL16 (YP_224102.1, 47), AP50 (YP_002302516.1, 30), as well as other BLAST-retrieved orthologous sequences from NR protein database and tentatively annotated as bacterial proteins from Bacillus cereus (WP_001085581.1), Streptococcus pneumoniae (WP_050224775.1), Exiguobacerium antarticum (WP_026829749.1), Bacillus flexus (WP_025907183.1) and Brevibacillus sp. CF112 (WP_007784052.1). These bacterial proteins may correspond to TPs from uncharacterized tectivirus-like prophages or linear plasmids from Gram-positive hosts. Sequences were aligned with MUSCLE algorithm implemented in Geneious R8 software ( 48 ). The C-terminal fragment of all proteins that corresponds with the bromide cyanogen cleavage product is shadowed in blue and the tyrosine residues present in the Bam35 portion are highlighted in pink. Conserved Y172 and Y194 residues are marked with an asterisk above the sequences. ( B ) Determination of the nature of the Bam35 TP priming residue by alkali treatment. Control initiation reactions with Φ29 DNA polymerase and TP were performed in parallel. After the initiation reaction, samples were incubated for 6 min at 95°C in the absence or presence of 100 mM NaOH, and subsequently neutralized and analyzed by SDS-PAGE and autoradiography. ( C ) Mapping the Bam35 TP priming residue. The TP-AMP complexes were performed as described and afterward treated with 1.2 mM of cyanogen bromide (CNBr) and 200 mM HCl for 20 h at room temperature. Finally, the samples were neutralized and analyzed by SDS-18% polyacrylamide electrophoresis. ( D ) Identification of Y194 as the priming residue by TP-deoxyadenylation assays with 0.5 or 2 μl of cell-free extracts of bacterial cultures expressing the TP variants. Extracts prepared from bacteria harboring the empty plasmid (lanes 1, 2) and the wild type TP expression vector (lanes 3, 4) were also used as negative or positive controls, respectively. See Materials and Methods for details.

    Techniques Used: Sequencing, Software, Incubation, SDS Page, Autoradiography, Electrophoresis, Expressing, Plasmid Preparation

    Bam35 protein-primed genome replication. Alkaline agarose gel electrophoresis of TP-DNA replication products. Samples contained 11 nM B35DNAP and 133 nM TP, as indicated, and 100 ng of Bam35 TP-DNA. See Materials and Methods for details. ( A ) Reactions were triggered by addition of 10 mM MgCl 2 and incubated for 1, 2 and 4 h (lanes 3–5). ( B ) Reactions were triggered by 10 mM MgCl 2 and/or 1 mM MnCl 2 as indicated and incubated for 2 h. A λ-HindIII DNA ladder was loaded as a size marker, and the expected size of the Bam35 TP-DNA product is also indicated.
    Figure Legend Snippet: Bam35 protein-primed genome replication. Alkaline agarose gel electrophoresis of TP-DNA replication products. Samples contained 11 nM B35DNAP and 133 nM TP, as indicated, and 100 ng of Bam35 TP-DNA. See Materials and Methods for details. ( A ) Reactions were triggered by addition of 10 mM MgCl 2 and incubated for 1, 2 and 4 h (lanes 3–5). ( B ) Reactions were triggered by 10 mM MgCl 2 and/or 1 mM MnCl 2 as indicated and incubated for 2 h. A λ-HindIII DNA ladder was loaded as a size marker, and the expected size of the Bam35 TP-DNA product is also indicated.

    Techniques Used: Agarose Gel Electrophoresis, Incubation, Marker

    Deoxynucleotide specificity for Bam35 TP initiation reaction. B35DNAP and TP were incubated in template-independent ( A ) or TP-DNA directed ( B ) initiation assays. Template sequence determination of Bam35 TP initiation reaction is shown in ( C ). Initiation assays either in the absence of template (panel C, lanes 1, 8, 15 and 22) or with single stranded 29-mer oligonucleotide template containing the sequence of the genome left end or variants of this sequence (Supplementary Table S1). The deoxynucleotide used as well as the first six nucleotides of the template oligonucleotide sequence (in the 3′-5′ direction) are indicated above the gels. Reactions were triggered with MnCl 2 (see Materials and Methods). Longer autoradiography exposition times, related to the dATP assays, are indicated for each provided deoxynucleotide.
    Figure Legend Snippet: Deoxynucleotide specificity for Bam35 TP initiation reaction. B35DNAP and TP were incubated in template-independent ( A ) or TP-DNA directed ( B ) initiation assays. Template sequence determination of Bam35 TP initiation reaction is shown in ( C ). Initiation assays either in the absence of template (panel C, lanes 1, 8, 15 and 22) or with single stranded 29-mer oligonucleotide template containing the sequence of the genome left end or variants of this sequence (Supplementary Table S1). The deoxynucleotide used as well as the first six nucleotides of the template oligonucleotide sequence (in the 3′-5′ direction) are indicated above the gels. Reactions were triggered with MnCl 2 (see Materials and Methods). Longer autoradiography exposition times, related to the dATP assays, are indicated for each provided deoxynucleotide.

    Techniques Used: Incubation, Sequencing, Autoradiography

    8) Product Images from "Nucleic acid evolution and minimization by nonhomologous random recombination"

    Article Title: Nucleic acid evolution and minimization by nonhomologous random recombination

    Journal: Nature biotechnology

    doi: 10.1038/nbt736

    Overview of the nonhomologous random recombination (NRR) method. (A) Starting DNA sequences are randomly digested with DNase I, blunt-ended with T4 DNA polymerase, and recombined with T4 DNA ligase under conditions that strongly favor intermolecular ligation over intramolecular circularization. (B) A defined stoichiometry of hairpin DNA added to the ligation reaction controls the average length of the recombined products. The completed ligation reaction is digested with a restriction endonuclease to provide a library of double-stranded recombined DNA flanked by defined primer-binding sequences.
    Figure Legend Snippet: Overview of the nonhomologous random recombination (NRR) method. (A) Starting DNA sequences are randomly digested with DNase I, blunt-ended with T4 DNA polymerase, and recombined with T4 DNA ligase under conditions that strongly favor intermolecular ligation over intramolecular circularization. (B) A defined stoichiometry of hairpin DNA added to the ligation reaction controls the average length of the recombined products. The completed ligation reaction is digested with a restriction endonuclease to provide a library of double-stranded recombined DNA flanked by defined primer-binding sequences.

    Techniques Used: Ligation, Binding Assay

    9) Product Images from "In vitro selection of tRNAs for efficient four-base decoding to incorporate non-natural amino acids into proteins in an Escherichia coli cell-free translation system"

    Article Title: In vitro selection of tRNAs for efficient four-base decoding to incorporate non-natural amino acids into proteins in an Escherichia coli cell-free translation system

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl087

    ( A ) Schematic illustration of the formation of streptavidin–tRNA fusion using puromycin–tRNA, which contains a puromycin moiety in the place of 3′ terminal aminoacyl-adenosine and a four-base anticodon CCCG. The puromycin–tRNA binds to ribosomal A site and accepts a streptavidin polypeptide chain as an analog of aminoacyl-tRNA in response to a four-base CGGG codon at 3′ terminus of streptavidin mRNA in a cell-free translation. The resulting streptavidin–puromycin–tRNA may be translocated to the P-site. In this case, the next aminoacyl-tRNA binds to the vacant ribosomal A site, but can not accept the polypeptide chain because of the amide bond of puromycin–tRNA. The resulting streptavidin–tRNA fusion is released from the ribosome complex by the addition of EDTA. ( B ) Schematic illustration of the in vitro selection system of tRNAs. Step 1, a DNA pool encoding tRNAs containing a four-base anticodon CCCG is transcribed by T7 RNA polymerase to tRNA(-CA) pool. Step 2, the tRNA(-CA) pool is ligated with pdCp-Puromycin by T4 RNA ligase to generate puromycin–tRNA. Step 3, a streptavidin mRNA containing a four-base CGGG codon at C-terminus is translated in an E.coli cell-free translation system in the presence of the puromycin–tRNA. Puromycin–tRNAs that successfully decode the CGGG codon form ribosome–mRNA–streptavidin–tRNA complex. Step 4, the streptavidin–tRNA fusion is dissociated from the complex by the addition of EDTA. Step 5, the streptavidin–tRNA fusion is recovered with biotin-coated magnetic beads. Step 6, the streptavidin–tRNA fusion is dissociated from the beads, and then the tRNA moiety is subjected to RT–PCR. Step 7, the tRNA genes are regenerated by overlap-extension PCR with a T7 promoter primer, which are used as template DNAs in the next round of selection.
    Figure Legend Snippet: ( A ) Schematic illustration of the formation of streptavidin–tRNA fusion using puromycin–tRNA, which contains a puromycin moiety in the place of 3′ terminal aminoacyl-adenosine and a four-base anticodon CCCG. The puromycin–tRNA binds to ribosomal A site and accepts a streptavidin polypeptide chain as an analog of aminoacyl-tRNA in response to a four-base CGGG codon at 3′ terminus of streptavidin mRNA in a cell-free translation. The resulting streptavidin–puromycin–tRNA may be translocated to the P-site. In this case, the next aminoacyl-tRNA binds to the vacant ribosomal A site, but can not accept the polypeptide chain because of the amide bond of puromycin–tRNA. The resulting streptavidin–tRNA fusion is released from the ribosome complex by the addition of EDTA. ( B ) Schematic illustration of the in vitro selection system of tRNAs. Step 1, a DNA pool encoding tRNAs containing a four-base anticodon CCCG is transcribed by T7 RNA polymerase to tRNA(-CA) pool. Step 2, the tRNA(-CA) pool is ligated with pdCp-Puromycin by T4 RNA ligase to generate puromycin–tRNA. Step 3, a streptavidin mRNA containing a four-base CGGG codon at C-terminus is translated in an E.coli cell-free translation system in the presence of the puromycin–tRNA. Puromycin–tRNAs that successfully decode the CGGG codon form ribosome–mRNA–streptavidin–tRNA complex. Step 4, the streptavidin–tRNA fusion is dissociated from the complex by the addition of EDTA. Step 5, the streptavidin–tRNA fusion is recovered with biotin-coated magnetic beads. Step 6, the streptavidin–tRNA fusion is dissociated from the beads, and then the tRNA moiety is subjected to RT–PCR. Step 7, the tRNA genes are regenerated by overlap-extension PCR with a T7 promoter primer, which are used as template DNAs in the next round of selection.

    Techniques Used: In Vitro, Selection, Magnetic Beads, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    10) Product Images from "Molecular Factors of Hypochlorite Tolerance in the Hypersaline Archaeon Haloferax volcanii"

    Article Title: Molecular Factors of Hypochlorite Tolerance in the Hypersaline Archaeon Haloferax volcanii

    Journal: Genes

    doi: 10.3390/genes9110562

    Schematic diagram of the inverted-nested two-step PCR (INT-PCR, left) and the semi-random two-step PCR (ST-PCR, right) strategies to identify the transposon insertion sites in Haloferax volcanii . The transposable (Tn) element includes the following: two Mu repeats (MuR), a chloramphenicol acetyltransferase ( cat ) gene, a P cat promoter, a tryptophan synthase ( trpA ) gene, and a ferredoxin promoter (P fdx ). NdeI and HindIII are examples of the restriction enzyme (RE) sites used to cleave the genomic DNA prior to blunt-end ligation to form the circular DNA template used in the INT-PCR method. Primer pairs used for the two PCR steps (PCR1 and PCR2) and the DNA sequencing are color coded (red, blue, and purple) and numbered according to Table S1 . See Methods for details.
    Figure Legend Snippet: Schematic diagram of the inverted-nested two-step PCR (INT-PCR, left) and the semi-random two-step PCR (ST-PCR, right) strategies to identify the transposon insertion sites in Haloferax volcanii . The transposable (Tn) element includes the following: two Mu repeats (MuR), a chloramphenicol acetyltransferase ( cat ) gene, a P cat promoter, a tryptophan synthase ( trpA ) gene, and a ferredoxin promoter (P fdx ). NdeI and HindIII are examples of the restriction enzyme (RE) sites used to cleave the genomic DNA prior to blunt-end ligation to form the circular DNA template used in the INT-PCR method. Primer pairs used for the two PCR steps (PCR1 and PCR2) and the DNA sequencing are color coded (red, blue, and purple) and numbered according to Table S1 . See Methods for details.

    Techniques Used: Polymerase Chain Reaction, Ligation, DNA Sequencing

    11) Product Images from "Disclosing early steps of protein-primed genome replication of the Gram-positive tectivirus Bam35"

    Article Title: Disclosing early steps of protein-primed genome replication of the Gram-positive tectivirus Bam35

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw673

    Functional characterization of mutants in the Y194 priming residue. ( A ) Template-independent TP-deoxyadenylation products of wild type (lane 1) and increasing concentrations of Y194F and Y194A TP mutants. Reactions were carried out triggered with 1 mM MnCl 2 and incubated for 30 min. ( B ) Comparative analysis of wild type and Y194A and Y194F mutant TPs interaction with the DNA polymerase. The reactions were triggered with 1 mM MnCl 2 in the presence of the indicated TP variant and, after 2.5 min, the competitor YFPTP fusion protein was added and the samples were incubated again for 2.5 min. See Materials and Methods for details. The effect of the TP variants concentration on the relative YFPTP deoxyadenylation, from three independent experiments (mean and standard error), is shown in panel C.
    Figure Legend Snippet: Functional characterization of mutants in the Y194 priming residue. ( A ) Template-independent TP-deoxyadenylation products of wild type (lane 1) and increasing concentrations of Y194F and Y194A TP mutants. Reactions were carried out triggered with 1 mM MnCl 2 and incubated for 30 min. ( B ) Comparative analysis of wild type and Y194A and Y194F mutant TPs interaction with the DNA polymerase. The reactions were triggered with 1 mM MnCl 2 in the presence of the indicated TP variant and, after 2.5 min, the competitor YFPTP fusion protein was added and the samples were incubated again for 2.5 min. See Materials and Methods for details. The effect of the TP variants concentration on the relative YFPTP deoxyadenylation, from three independent experiments (mean and standard error), is shown in panel C.

    Techniques Used: Functional Assay, Incubation, Mutagenesis, Variant Assay, Concentration Assay

    Mapping Bam35 TP priming residue. ( A ) Multiple sequence alignment of Bam35 TP and related TPs. Sequences used were from putative TPs (proteins encoded by ORF4) of representative related Gram-positive tectiviruses Bam35 (NCBI ID NP_943750.1, 10), GIL16 (YP_224102.1, 47), AP50 (YP_002302516.1, 30), as well as other BLAST-retrieved orthologous sequences from NR protein database and tentatively annotated as bacterial proteins from Bacillus cereus (WP_001085581.1), Streptococcus pneumoniae (WP_050224775.1), Exiguobacerium antarticum (WP_026829749.1), Bacillus flexus (WP_025907183.1) and Brevibacillus sp. CF112 (WP_007784052.1). These bacterial proteins may correspond to TPs from uncharacterized tectivirus-like prophages or linear plasmids from Gram-positive hosts. Sequences were aligned with MUSCLE algorithm implemented in Geneious R8 software ( 48 ). The C-terminal fragment of all proteins that corresponds with the bromide cyanogen cleavage product is shadowed in blue and the tyrosine residues present in the Bam35 portion are highlighted in pink. Conserved Y172 and Y194 residues are marked with an asterisk above the sequences. ( B ) Determination of the nature of the Bam35 TP priming residue by alkali treatment. Control initiation reactions with Φ29 DNA polymerase and TP were performed in parallel. After the initiation reaction, samples were incubated for 6 min at 95°C in the absence or presence of 100 mM NaOH, and subsequently neutralized and analyzed by SDS-PAGE and autoradiography. ( C ) Mapping the Bam35 TP priming residue. The TP-AMP complexes were performed as described and afterward treated with 1.2 mM of cyanogen bromide (CNBr) and 200 mM HCl for 20 h at room temperature. Finally, the samples were neutralized and analyzed by SDS-18% polyacrylamide electrophoresis. ( D ) Identification of Y194 as the priming residue by TP-deoxyadenylation assays with 0.5 or 2 μl of cell-free extracts of bacterial cultures expressing the TP variants. Extracts prepared from bacteria harboring the empty plasmid (lanes 1, 2) and the wild type TP expression vector (lanes 3, 4) were also used as negative or positive controls, respectively. See Materials and Methods for details.
    Figure Legend Snippet: Mapping Bam35 TP priming residue. ( A ) Multiple sequence alignment of Bam35 TP and related TPs. Sequences used were from putative TPs (proteins encoded by ORF4) of representative related Gram-positive tectiviruses Bam35 (NCBI ID NP_943750.1, 10), GIL16 (YP_224102.1, 47), AP50 (YP_002302516.1, 30), as well as other BLAST-retrieved orthologous sequences from NR protein database and tentatively annotated as bacterial proteins from Bacillus cereus (WP_001085581.1), Streptococcus pneumoniae (WP_050224775.1), Exiguobacerium antarticum (WP_026829749.1), Bacillus flexus (WP_025907183.1) and Brevibacillus sp. CF112 (WP_007784052.1). These bacterial proteins may correspond to TPs from uncharacterized tectivirus-like prophages or linear plasmids from Gram-positive hosts. Sequences were aligned with MUSCLE algorithm implemented in Geneious R8 software ( 48 ). The C-terminal fragment of all proteins that corresponds with the bromide cyanogen cleavage product is shadowed in blue and the tyrosine residues present in the Bam35 portion are highlighted in pink. Conserved Y172 and Y194 residues are marked with an asterisk above the sequences. ( B ) Determination of the nature of the Bam35 TP priming residue by alkali treatment. Control initiation reactions with Φ29 DNA polymerase and TP were performed in parallel. After the initiation reaction, samples were incubated for 6 min at 95°C in the absence or presence of 100 mM NaOH, and subsequently neutralized and analyzed by SDS-PAGE and autoradiography. ( C ) Mapping the Bam35 TP priming residue. The TP-AMP complexes were performed as described and afterward treated with 1.2 mM of cyanogen bromide (CNBr) and 200 mM HCl for 20 h at room temperature. Finally, the samples were neutralized and analyzed by SDS-18% polyacrylamide electrophoresis. ( D ) Identification of Y194 as the priming residue by TP-deoxyadenylation assays with 0.5 or 2 μl of cell-free extracts of bacterial cultures expressing the TP variants. Extracts prepared from bacteria harboring the empty plasmid (lanes 1, 2) and the wild type TP expression vector (lanes 3, 4) were also used as negative or positive controls, respectively. See Materials and Methods for details.

    Techniques Used: Sequencing, Software, Incubation, SDS Page, Autoradiography, Electrophoresis, Expressing, Plasmid Preparation

    12) Product Images from "Metal transcription factor-1 regulation via MREs in the transcribed regions of selenoprotein H and other metal- responsive genes"

    Article Title: Metal transcription factor-1 regulation via MREs in the transcribed regions of selenoprotein H and other metal- responsive genes

    Journal:

    doi: 10.1016/j.bbagen.2009.11.003

    Metal response elements in Selh genes from nine species A. Position of MREs predicted in the Selh genes from nine species. Genomic DNA from the indicated species (dashed lines) was analyzed over the region spanning 1000bp upstream and downstream from the translational start (TrSS) sites, indicated by bent arrows below the dashed lines. Gray ovals above and below the dashed lines represent predicted MREs on the plus and minus strand, respectively. Experimentally verified MTF-1 binding sites are marked by asterisks. MRE type a through f indicates the mouse metallothionein MRE with which the given MRE shows identity in the core sequence. MREx indicates that those sequences do not have a corresponding counterpart among the mouse metallothionein MREs. The conserved MREs located 200–350bp downstream of the TSS are encircled in the vertical box. Scale is shown at the lower left. B. Predicted MRE sequences in the human Selh gene. MRE1 through 4 predicted in the human Selh gene share identical core sequences (in bold) with MREs from the mouse metallothionein gene. MRE types are given in parentheses.
    Figure Legend Snippet: Metal response elements in Selh genes from nine species A. Position of MREs predicted in the Selh genes from nine species. Genomic DNA from the indicated species (dashed lines) was analyzed over the region spanning 1000bp upstream and downstream from the translational start (TrSS) sites, indicated by bent arrows below the dashed lines. Gray ovals above and below the dashed lines represent predicted MREs on the plus and minus strand, respectively. Experimentally verified MTF-1 binding sites are marked by asterisks. MRE type a through f indicates the mouse metallothionein MRE with which the given MRE shows identity in the core sequence. MREx indicates that those sequences do not have a corresponding counterpart among the mouse metallothionein MREs. The conserved MREs located 200–350bp downstream of the TSS are encircled in the vertical box. Scale is shown at the lower left. B. Predicted MRE sequences in the human Selh gene. MRE1 through 4 predicted in the human Selh gene share identical core sequences (in bold) with MREs from the mouse metallothionein gene. MRE types are given in parentheses.

    Techniques Used: Binding Assay, Sequencing

    13) Product Images from "Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro"

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro

    Journal:

    doi:

    Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).
    Figure Legend Snippet: Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).

    Techniques Used: Plasmid Preparation, Ligation, Generated

    14) Product Images from "Recognition of native DNA methylation by the PvuII restriction endonuclease"

    Article Title: Recognition of native DNA methylation by the PvuII restriction endonuclease

    Journal:

    doi:

    Cleavage of unmethylated or fully methylated oligonucleotide duplexes by wild-type R· Pvu II. 5
    Figure Legend Snippet: Cleavage of unmethylated or fully methylated oligonucleotide duplexes by wild-type R· Pvu II. 5"-End-labeled duplex oligonucleotides (0.5 pmol, 10 nM) were digested with R· Pvu II (0.15 U, ∼1 fmol, 20 pM, or 0.02 U for the unmodified substrate) and electrophoresed through a 20% acrylamide sequencing gel. The upper and lower strands (whether or not filled-in with Klenow polymerase) yield 22 and 18 nt labeled cleavage products, respectively (see Fig. ). ( A ) Surface plot (generated by NIH Image) of the digestion time course for unmethylated DNA; peak height is proportional to phosphorimager signal strength. ( B ) Fraction of unmethylated DNA that had been cleaved. Filled symbols represent data from Klenow-filled duplexes, while open symbols represent data from unfilled duplexes. Squares represent upper strands and circles represent lower strands. ( C ) Surface plot of the digestion time course for DNA having N4m C on both strands. Only the region containing the cleavage products is shown. For comparison, cleaved unmethylated DNA was run in adjacent lanes. ( D ) Fraction of fully methylated DNA that had been cleaved. Only the Klenow-filled substrate was cleaved sufficiently to allow reliable quantitation and even then only as the summed signal from both strands. The dotted line is from linear regression of the data, not including the earliest point.

    Techniques Used: Methylation, Labeling, Sequencing, Generated, Quantitation Assay

    15) Product Images from "A Tudor Domain Protein SPINDLIN1 Interacts with the mRNA-Binding Protein SERBP1 and Is Involved in Mouse Oocyte Meiotic Resumption"

    Article Title: A Tudor Domain Protein SPINDLIN1 Interacts with the mRNA-Binding Protein SERBP1 and Is Involved in Mouse Oocyte Meiotic Resumption

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0069764

    Spin1 mutant undergoes normal folliculogenesis and oocyte growth, but exhibit defective meiotic resumption. (A) Haematoxylin and eosin staining of ovarian sections grafted under the kidney capsules. Left panel: wild type; right panel: Spin1 mutant. Scale bar represents 500µm. (B) Fully grown oocytes harvested from wild type and Spin1 mutant ovaries after stimulation by PMSG. Scale bar represents 50µm. (C) Immunofluorescence staining of fully grown oocytes by anti-SPIN1 (green) and anti-Tubulin (red) antibodies. DNA (blue) was visualized by Hoechst 33342 dye. Scale bar represents 50µm. (D) Quantification of the percentage of fully grown oocytes with GV after release from the phosphodiesterase inhibitor IBMX. Data are mean ± SEM, Student’s t-tests.
    Figure Legend Snippet: Spin1 mutant undergoes normal folliculogenesis and oocyte growth, but exhibit defective meiotic resumption. (A) Haematoxylin and eosin staining of ovarian sections grafted under the kidney capsules. Left panel: wild type; right panel: Spin1 mutant. Scale bar represents 500µm. (B) Fully grown oocytes harvested from wild type and Spin1 mutant ovaries after stimulation by PMSG. Scale bar represents 50µm. (C) Immunofluorescence staining of fully grown oocytes by anti-SPIN1 (green) and anti-Tubulin (red) antibodies. DNA (blue) was visualized by Hoechst 33342 dye. Scale bar represents 50µm. (D) Quantification of the percentage of fully grown oocytes with GV after release from the phosphodiesterase inhibitor IBMX. Data are mean ± SEM, Student’s t-tests.

    Techniques Used: Mutagenesis, Staining, Immunofluorescence

    Expression profiles of Spin1 , Serbp1 , and Habp4 . (A) Expression of Spin1 , Serbp1 , Habp4 , and Gapdh in pre-implantation embryos and ovaries. OO: ovulated oocyte; Zyg: zygote; 2c: 2-cell stage embryo; 8c: 8-cell stage embryo; Bl: blastocyst. Each lane is the RT-PCR product of two embryos or two oocytes. Gapdh serves as controls. (B) Immunostaining of SPIN1 (red) and SERBP1 (green) on wild type ovarian sections by anti-SPIN1 and anti-SERBP1 as primary antibodies. Preimmune serum were used as controls. DNA (blue) was visualized by Hoechst 33342 dye.
    Figure Legend Snippet: Expression profiles of Spin1 , Serbp1 , and Habp4 . (A) Expression of Spin1 , Serbp1 , Habp4 , and Gapdh in pre-implantation embryos and ovaries. OO: ovulated oocyte; Zyg: zygote; 2c: 2-cell stage embryo; 8c: 8-cell stage embryo; Bl: blastocyst. Each lane is the RT-PCR product of two embryos or two oocytes. Gapdh serves as controls. (B) Immunostaining of SPIN1 (red) and SERBP1 (green) on wild type ovarian sections by anti-SPIN1 and anti-SERBP1 as primary antibodies. Preimmune serum were used as controls. DNA (blue) was visualized by Hoechst 33342 dye.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Immunostaining

    16) Product Images from "Directed evolution of protein enzymes using nonhomologous random recombination"

    Article Title: Directed evolution of protein enzymes using nonhomologous random recombination

    Journal:

    doi: 10.1073/pnas.0402202101

    Protein NRR. One or more parental genes are digested with DNase I. Fragments are blunt-ended with T4 DNA polymerase, size-selected, and ligated under conditions that favor intermolecular ligation. Two hairpin sequences are added in a defined stoichiometry
    Figure Legend Snippet: Protein NRR. One or more parental genes are digested with DNase I. Fragments are blunt-ended with T4 DNA polymerase, size-selected, and ligated under conditions that favor intermolecular ligation. Two hairpin sequences are added in a defined stoichiometry

    Techniques Used: Ligation

    17) Product Images from "Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage"

    Article Title: Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gni058

    Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).
    Figure Legend Snippet: Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).

    Techniques Used: Functional Assay, Clone Assay, Activity Assay, Amplification, Incubation

    Related Articles

    Clone Assay:

    Article Title: Development of a dual-expression vector facilitated with selection-free PCR recombination cloning strategy
    Article Snippet: All forward primers and reverse primers contain 5′CAGCCACCATCATCACCACCAC3′ and 5′TGCACGTAATTTTTGACGCACG3′ at the 5′ termini respectively, which are homologous to correspondent sequences flanking the lysis gene E expression cassette in pOmni (Fig. ). .. Individual PCR product was cloned into pOmni through a 20 μl recombination PCR using Q5 high-fidelity DNA polymerase, which contained 5 ng pOmni as template and 100–200 folds (molar ratio) gel-purified PCR product as primer. .. All recombination PCRs were conducted with the same thermal cycling parameter (95 °C 30 s, 60 °C 45 s, 72 °C 3 min).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. Finally the hygromycin resistance marker gene hph was amplified from plasmid pCAMB-HPT-Hind ( ) with the primer pair Hygro_MDR6_F/Hygro_ipo323_R or Hygro_MDR7_F/Hygro_ipo323_R, respectively.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The P2 form of HNF4A (α7; NP_001025174) ) and HNF1A were amplified from human liver cDNA and cloned in pLVX. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Centrifugation:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The Zymolyase solution was removed by centrifugation, and the pellet resuspended in distilled water (500 μl). .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Amplification:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Fifteen days after genome editing, genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicenter) following the manufacturer’s protocol. .. Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: This suggests that Musashi-1 is a potential CRC therapeutic target. .. Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA). .. For subcloning full length FLAGMusashi-1 into Hind III and Xba I sites of p3xFLAG-CMV-10 (E7658, Sigma, St. Louis, MO).

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: To introduce the various MFS1 MDR alleles into the sensitive IPO323 strain, the following replacement cassettes were constructed. .. The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The P2 form of HNF4A (α7; NP_001025174) ) and HNF1A were amplified from human liver cDNA and cloned in pLVX. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Paragraph title: Nucleic acid extraction and amplification of 16S rRNA genes for Illumina sequencing ... After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: Paragraph title: 16S rRNA gene amplification and sequencing. ... The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: Paragraph title: Tetrad dissection and MAT locus PCR amplification ... Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The resulting constructs encode dynein-2 (amino acids 1,091 – 4,307) with an N-terminal ZZ tag, TEV cleavage cassette, SNAPf tag, GST tag (as indicated), and an intervening glycine-serine spacer, within the pFastBac vector.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Mass Spectrometry:

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. The PCR product was purified with Ampure XP beads at a ratio of 1:1, and 1–10 ng used to add Illumina Index with Nextera XT kit (Illumina).

    Synthesized:

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The human cytoplasmic dynein-1 holoenzyme construct was as described .

    Picogreen Assay:

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Construct:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: Paragraph title: MFS1 gene replacement constructs. ... The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: Paragraph title: Expression constructs ... PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Paragraph title: DNA constructs ... Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    cDNA Library Assay:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: This suggests that Musashi-1 is a potential CRC therapeutic target. .. Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA). .. For subcloning full length FLAGMusashi-1 into Hind III and Xba I sites of p3xFLAG-CMV-10 (E7658, Sigma, St. Louis, MO).

    Incubation:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The YPD plate was incubated for 2 days at 30°C. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Gel Extraction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    Expressing:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: Paragraph title: Expression constructs ... PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: Paragraph title: Protein expression ... Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    Modification:

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    Transformation Assay:

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Over Expression:

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of S. aureus ferrochelatase ... The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Derivative Assay:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Gas Chromatography:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The CEBPA coding sequence, corresponding to the p42 form (Uniprot identifier P49715-2) was optimized to reduce its GC content using IDT’s ( http://www.idtdna.com/site ) proprietary tool. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Dissection:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: Paragraph title: Tetrad dissection and MAT locus PCR amplification ... Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Introduce:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: To introduce the various MFS1 MDR alleles into the sensitive IPO323 strain, the following replacement cassettes were constructed. .. The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France).

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Double-stranded cDNA was washed three times in 10 mM tris–HCl to remove the remaining primers, and the entire sample was used as template for PCR amplification in 10 µl using Q5 Polymerase with universal FW primer and mix of reverse isotype specific primer (98°C 30 s; 10 cycles of 98°C 10 s, 58°C 15 s, and 72°C 1 min; 72°C 10 min).

    Hemagglutination Assay:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Generated:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    DNA Sequencing:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Paragraph title: Nested-PCR, T7E1 assay and DNA sequencing ... Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Sequencing:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were purified with QIAguick Gel Extraction Kit, normalized in concentration, pooled together, phosphorylated at 5′ end, added dA-Tailing and Y-Shape adapter.

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. .. Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL.

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The CEBPA coding sequence, corresponding to the p42 form (Uniprot identifier P49715-2) was optimized to reduce its GC content using IDT’s ( http://www.idtdna.com/site ) proprietary tool. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Paragraph title: Nucleic acid extraction and amplification of 16S rRNA genes for Illumina sequencing ... After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: Paragraph title: High-throughput sequence of nrfA gene ... The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: Paragraph title: 16S rRNA gene amplification and sequencing. ... The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Double-stranded cDNA was washed three times in 10 mM tris–HCl to remove the remaining primers, and the entire sample was used as template for PCR amplification in 10 µl using Q5 Polymerase with universal FW primer and mix of reverse isotype specific primer (98°C 30 s; 10 cycles of 98°C 10 s, 58°C 15 s, and 72°C 1 min; 72°C 10 min).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Sonication:

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    DNA Extraction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Fifteen days after genome editing, genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicenter) following the manufacturer’s protocol. .. Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table .

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA).

    Marker:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Mutagenesis:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions. .. For the BirA system, the mycBioID plasmid was a gift from Kyle Roux obtained via Addgene (Addgene plasmid 35700).

    Isolation:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min).

    Microscopy:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: A 10-μl drop was placed in the middle of a YPD plate, and dumbbell-shaped asci were dissected using a Singer Sporeplay dissection microscope. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Purification:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Nucleic acid was extracted from each sample using a direct lysis protocol involving bead beating (Noll et al. ). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. Amplification of the V4 region of 16S rRNA genes was performed using the universal primers 515F and 806R, both of which were modified to contain an Illumina adapter region, and the latter of which contained a 12 bp barcode for multiplex sequencing (Caporaso et al. ).

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA).

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Two microliters of the PCR product were used for a semi-nested PCR with inner RV primers for the constant region, which also introduce partial Illumina adaptors.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The resulting constructs encode dynein-2 (amino acids 1,091 – 4,307) with an N-terminal ZZ tag, TEV cleavage cassette, SNAPf tag, GST tag (as indicated), and an intervening glycine-serine spacer, within the pFastBac vector.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of S. aureus ferrochelatase ... The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Polymerase Chain Reaction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    Article Title: Development of a dual-expression vector facilitated with selection-free PCR recombination cloning strategy
    Article Snippet: All forward primers and reverse primers contain 5′CAGCCACCATCATCACCACCAC3′ and 5′TGCACGTAATTTTTGACGCACG3′ at the 5′ termini respectively, which are homologous to correspondent sequences flanking the lysis gene E expression cassette in pOmni (Fig. ). .. Individual PCR product was cloned into pOmni through a 20 μl recombination PCR using Q5 high-fidelity DNA polymerase, which contained 5 ng pOmni as template and 100–200 folds (molar ratio) gel-purified PCR product as primer. .. All recombination PCRs were conducted with the same thermal cycling parameter (95 °C 30 s, 60 °C 45 s, 72 °C 3 min).

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Bacterial DNA was identified by PCR targeting the 16S rRNA gene with the following primers: 5′-CCAGACTCCTACGGGAGGCAG-3′ (V3 region), 5′-ACATTTCACAACACGAGCTGACGA-3′ (V6 region) [ , ]. .. Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions. .. For the BirA system, the mycBioID plasmid was a gift from Kyle Roux obtained via Addgene (Addgene plasmid 35700).

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Nucleic acid was extracted from each sample using a direct lysis protocol involving bead beating (Noll et al. ). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. Amplification of the V4 region of 16S rRNA genes was performed using the universal primers 515F and 806R, both of which were modified to contain an Illumina adapter region, and the latter of which contained a 12 bp barcode for multiplex sequencing (Caporaso et al. ).

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions. .. The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The YPD plate was incubated for 2 days at 30°C. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C. .. Sequences of PCR primers A–F are given in .

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR
    Article Snippet: However, the concentrations of template plasmids will need to be reduced further (e.g., 1 fg/μL) to maintain zero background from parental plasmids. .. A 2-consecutive PCR procedure using Q5 DNA polymerase has been developed to prepare high quality DNA fragments up to 12 kb and reduce template plasmid concentrations below 10 fg/μL. .. Directtransformation of a mixture of PCR DNA fragments containing overlapping ends into DH5α cells yields correctly assembled plasmids with a zero background from template plasmids.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: The CY2, Venus and mCherry DNA constructs were purchased from Addgene. .. Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Small Interfering RNA:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: Paragraph title: Plasmid constructions and small interfering RNA knockdown ... Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA).

    CRISPR:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study are shown as follow: sgRNA1, 5′-TCGTACGGGGAGATGTCCGG GGG -3′; gRNA2. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Nested PCR:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: A nested PCR protocol was used to decrease the potential bias introduced by the use of barcoded primers by only including primers with Illumina adaptor sequences and barcodes in the second PCR round ( ). .. The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Plasmid Preparation:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: Paragraph title: Plasmid constructions and small interfering RNA knockdown ... Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Paragraph title: Generation of input plasmid library ... Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR
    Article Snippet: However, the concentrations of template plasmids will need to be reduced further (e.g., 1 fg/μL) to maintain zero background from parental plasmids. .. A 2-consecutive PCR procedure using Q5 DNA polymerase has been developed to prepare high quality DNA fragments up to 12 kb and reduce template plasmid concentrations below 10 fg/μL. .. Directtransformation of a mixture of PCR DNA fragments containing overlapping ends into DH5α cells yields correctly assembled plasmids with a zero background from template plasmids.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Software:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: We used the online software (MIT CRISPR Design Tool: http://crispr.mit.edu ) to design sgRNAs targeting common sequence of pig and cow PDX1 gene. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Agarose Gel Electrophoresis:

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. .. Amplification was performed on a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA).

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    In Vitro:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: Paragraph title: sgRNA design and in vitro transcription ... The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Sampling:

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Fifty bioreactor samples from the five sampling ports were stored at −20 °C as pellets until use. .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Concentration Assay:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    High Throughput Screening Assay:

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: Paragraph title: High-throughput sequence of nrfA gene ... The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Lysis:

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs t7 rna polymerase
    Operation of cotranscriptionally generated RNA CHA circuits without any downstream purification and design optimization for detection of DNA target. ( a ) Fifty nanograms each of the indicated pairs of hairpin 1 and 2 transcription templates was cotranscribed with or without 10 ng of C1 transcription template for 1 h at 42°C using T7 RNA polymerase. Following transcription, 2 µl of the reaction mix was directly incubated in 1× TNaK buffer containing 20 U of RNaseOUT and 0.5 µM ROX reference dye along with 400 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52°C. ( b ) Schematic depicting SDA of DNA. The single-stranded template DNA (black arrow) consists of a sequence (C*) complementary to the RNA CHA catalyst followed by the nicking enzyme recognition sequence (NE) that is present on the non-cleaved DNA strand and a primer binding site. Following primer binding (step 1), the DNA polymerase synthesizes the complementary strand that now completes the duplex NE site and contains the RNA CHA catalyst sequence (C). Nicking enzyme then binds the duplex NE site (step 2) and cleaves the newly synthesized strand at the NE site. The new 3′-OH group generated at the nick site is then extended by the DNA polymerase (step 3) while displacing the previously synthesized strand. The displaced ssDNA amplicon can then catalyze RNA CHA. ( c ) Schematic of DNA target sequence design for catalysis of RNA CHA. Single toehold (domain 1*) DNA target C1 (generated by SDA from the template TLTRSDA) with the same domain architecture as the RNA C1 is an inefficient catalyst of RNA CHA. Extended DNA target C1234 (generated by SDA from the template 1234LTRSDA) presenting two toeholds for RNA H1 successfully catalyzes RNA CHA.
    T7 Rna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/New England Biolabs
    Average 98 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs high fidelity dna polymerase
    Specific and non-specific binding of <t>DNA</t> by <t>ParB:</t> a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).
    High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs dnmt1
    <t>DNMT1</t> and PKCζ colocalize in the nucleus of HeLa cells . HeLa cells are shown with ( A ), DsRed.DNMT1 (red) ( B ), GFP-phosphorylated-PKCζ (green) ( C ), DsRed.DNMT1 and GFP-phosphorylated-PKCζ (merged yellow) ( D ), nucleus (blue) ( E ), merge nucleus and DsRed.DNMT1 ( F ), merge nucleus and GFP-phosphorylated-PKCζ ( G ), merge nucleus, DsRed.DNMT1, and GFP-phosphorylated-PKCζ ( H ). The construct DsRed.DNMT1 was transfected in HeLa cells 48 hours before cells fixation and permeabilization. An anti-phosphorylated-PKCζ rabbit antibody was used in combination with an anti-rabbit antibody coupled with GFP to detect endogenous activated form of PKCζ.
    Dnmt1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnmt1/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    dnmt1 - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Operation of cotranscriptionally generated RNA CHA circuits without any downstream purification and design optimization for detection of DNA target. ( a ) Fifty nanograms each of the indicated pairs of hairpin 1 and 2 transcription templates was cotranscribed with or without 10 ng of C1 transcription template for 1 h at 42°C using T7 RNA polymerase. Following transcription, 2 µl of the reaction mix was directly incubated in 1× TNaK buffer containing 20 U of RNaseOUT and 0.5 µM ROX reference dye along with 400 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52°C. ( b ) Schematic depicting SDA of DNA. The single-stranded template DNA (black arrow) consists of a sequence (C*) complementary to the RNA CHA catalyst followed by the nicking enzyme recognition sequence (NE) that is present on the non-cleaved DNA strand and a primer binding site. Following primer binding (step 1), the DNA polymerase synthesizes the complementary strand that now completes the duplex NE site and contains the RNA CHA catalyst sequence (C). Nicking enzyme then binds the duplex NE site (step 2) and cleaves the newly synthesized strand at the NE site. The new 3′-OH group generated at the nick site is then extended by the DNA polymerase (step 3) while displacing the previously synthesized strand. The displaced ssDNA amplicon can then catalyze RNA CHA. ( c ) Schematic of DNA target sequence design for catalysis of RNA CHA. Single toehold (domain 1*) DNA target C1 (generated by SDA from the template TLTRSDA) with the same domain architecture as the RNA C1 is an inefficient catalyst of RNA CHA. Extended DNA target C1234 (generated by SDA from the template 1234LTRSDA) presenting two toeholds for RNA H1 successfully catalyzes RNA CHA.

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Operation of cotranscriptionally generated RNA CHA circuits without any downstream purification and design optimization for detection of DNA target. ( a ) Fifty nanograms each of the indicated pairs of hairpin 1 and 2 transcription templates was cotranscribed with or without 10 ng of C1 transcription template for 1 h at 42°C using T7 RNA polymerase. Following transcription, 2 µl of the reaction mix was directly incubated in 1× TNaK buffer containing 20 U of RNaseOUT and 0.5 µM ROX reference dye along with 400 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52°C. ( b ) Schematic depicting SDA of DNA. The single-stranded template DNA (black arrow) consists of a sequence (C*) complementary to the RNA CHA catalyst followed by the nicking enzyme recognition sequence (NE) that is present on the non-cleaved DNA strand and a primer binding site. Following primer binding (step 1), the DNA polymerase synthesizes the complementary strand that now completes the duplex NE site and contains the RNA CHA catalyst sequence (C). Nicking enzyme then binds the duplex NE site (step 2) and cleaves the newly synthesized strand at the NE site. The new 3′-OH group generated at the nick site is then extended by the DNA polymerase (step 3) while displacing the previously synthesized strand. The displaced ssDNA amplicon can then catalyze RNA CHA. ( c ) Schematic of DNA target sequence design for catalysis of RNA CHA. Single toehold (domain 1*) DNA target C1 (generated by SDA from the template TLTRSDA) with the same domain architecture as the RNA C1 is an inefficient catalyst of RNA CHA. Extended DNA target C1234 (generated by SDA from the template 1234LTRSDA) presenting two toeholds for RNA H1 successfully catalyzes RNA CHA.

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Generated, Purification, Incubation, Sequencing, Binding Assay, Synthesized, Amplification

    Synthesis and execution of RNA CHA circuit. ( a ) LHRz and RHRz-mediated cotranscriptional RNA cleavage releases the internal circuit components H1, H2 and C1. Fifity nanograms of PCR-generated transcription templates for H1, H2 and C1 was transcribed in 50 µl of reactions by T7 RNA polymerase for 2 h at 42°C. Two microliters of the resulting transcripts was analyzed by electrophoresis on a 10% denaturing polyacrylamide gel. Single-stranded DNA oligonucleotides were used as size markers. ( b ) RNA hairpins undergo catalyzed assembly into RNA duplexes. Gel-purified RNA catalyst C1 and the hairpins H1 and H2 were combined as indicated and incubated in 1× TNaK buffer containing 20 U of RNaseOUT for 150 min at 42°C (lanes 1–4), 52°C (lanes 5–8) or 62°C (lanes 9–12). The reactions were then analyzed on a 10% native polyacrylamide gel. Fifteen nanograms of C1 RNA was included in lane 13 as a control. Single-stranded DNA oligonucleotides were used as size markers.

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Synthesis and execution of RNA CHA circuit. ( a ) LHRz and RHRz-mediated cotranscriptional RNA cleavage releases the internal circuit components H1, H2 and C1. Fifity nanograms of PCR-generated transcription templates for H1, H2 and C1 was transcribed in 50 µl of reactions by T7 RNA polymerase for 2 h at 42°C. Two microliters of the resulting transcripts was analyzed by electrophoresis on a 10% denaturing polyacrylamide gel. Single-stranded DNA oligonucleotides were used as size markers. ( b ) RNA hairpins undergo catalyzed assembly into RNA duplexes. Gel-purified RNA catalyst C1 and the hairpins H1 and H2 were combined as indicated and incubated in 1× TNaK buffer containing 20 U of RNaseOUT for 150 min at 42°C (lanes 1–4), 52°C (lanes 5–8) or 62°C (lanes 9–12). The reactions were then analyzed on a 10% native polyacrylamide gel. Fifteen nanograms of C1 RNA was included in lane 13 as a control. Single-stranded DNA oligonucleotides were used as size markers.

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Polymerase Chain Reaction, Generated, Electrophoresis, Purification, Incubation

    Cotranscriptionally generated RNA CHA as signal transducer for nucleic acid diagnostics. ( a ) End-point sequence-specific detection of SDA-generated ssDNA targets by RNA CHA. Samples with or without 10 nM template 1234LTRSDA were amplified by SDA for 90 min at 37°C in 25 µl of reaction volumes. Reactions were then incubated at 95°C for 5 min and stored at room temperature before assay by RNA CHA. Five microliters of these SDA products was then probed with 2 µl of Sephadex G25 column-purified cotranscribed mH1:H2 RNA CHA circuit. RNA CHA cotranscriptions were performed with T7 RNA polymerase using 50 ng each of the mH1 and H2 transcription templates for 1 h at 42°C. End-point RNA CHA detection reactions were assembled in 1× TNaK buffer containing 20 U of RNaseOUT, 0.5 µM ROX reference dye and 100 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52°C. Negative control reactions lacking RNA CHA components or containing 2 µl of either only mH1 or H2 were also tested. ( b ) Real-time signal transduction of ssDNA-generating SDA by cotranscribed mH1:H2 RNA CHA. High temperature (55°C) SDA reactions were set up with or without 10 nM 1234HTRSDA template in 20 µl of volume containing 0.5 µM ROX reference dye and 75 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time. Real-time sequence-specific signal transduction was achieved by adding 2 µl of unpurified mH1:H2 RNA CHA circuits cotranscribed from 50 ng of each transcription template to the SDA reactions. Control SDA reactions containing no RNA CHA components or 2 µl of either only mH1 or H2 were also tested.

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Cotranscriptionally generated RNA CHA as signal transducer for nucleic acid diagnostics. ( a ) End-point sequence-specific detection of SDA-generated ssDNA targets by RNA CHA. Samples with or without 10 nM template 1234LTRSDA were amplified by SDA for 90 min at 37°C in 25 µl of reaction volumes. Reactions were then incubated at 95°C for 5 min and stored at room temperature before assay by RNA CHA. Five microliters of these SDA products was then probed with 2 µl of Sephadex G25 column-purified cotranscribed mH1:H2 RNA CHA circuit. RNA CHA cotranscriptions were performed with T7 RNA polymerase using 50 ng each of the mH1 and H2 transcription templates for 1 h at 42°C. End-point RNA CHA detection reactions were assembled in 1× TNaK buffer containing 20 U of RNaseOUT, 0.5 µM ROX reference dye and 100 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52°C. Negative control reactions lacking RNA CHA components or containing 2 µl of either only mH1 or H2 were also tested. ( b ) Real-time signal transduction of ssDNA-generating SDA by cotranscribed mH1:H2 RNA CHA. High temperature (55°C) SDA reactions were set up with or without 10 nM 1234HTRSDA template in 20 µl of volume containing 0.5 µM ROX reference dye and 75 nM RepF (annealed with 5× excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time. Real-time sequence-specific signal transduction was achieved by adding 2 µl of unpurified mH1:H2 RNA CHA circuits cotranscribed from 50 ng of each transcription template to the SDA reactions. Control SDA reactions containing no RNA CHA components or 2 µl of either only mH1 or H2 were also tested.

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Generated, Sequencing, Amplification, Incubation, Purification, Negative Control, Transduction

    Design of non-enzymatic catalyzed RNA hairpin assembly circuit. ( a ) Schematic of catalyzed nucleic acid hairpin assembly circuit adapted from (  2 ). The circuit composed of hairpins H1 and H2 is turned on in the presence of the input sequence (C1). C1 catalyzes the assembly of H1 and H2 into an H1:H2 duplex and is itself recycled. Circuit output (H1:H2 duplex) is quantitated as increasing fluorescence intensity of a labeled oligonucleotide probe (RepF) on displacement of its complementary quencher oligonucleotide (RepQ) by the H1:H2 duplex. ( b ) Design of T7 RNA polymerase-driven transcription templates for enzymatic synthesis of RNA CHA circuit components with precise 5′- and 3′-ends. Transcription template for each component, H1, H2 and C1, is flanked on both the left (L) and the right (R) sides by hammerhead ribozymes (HRz). The size (in nucleotides) of each component and its ribozyme flanks is indicated under each schematic. Secondary structures of the resulting chimeric RNA at 42°C before ribozyme processing are depicted (green, A; blue, C; black, G; red, U). The RNA structures were generated using NUPACK (  13–16 ).

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Design of non-enzymatic catalyzed RNA hairpin assembly circuit. ( a ) Schematic of catalyzed nucleic acid hairpin assembly circuit adapted from ( 2 ). The circuit composed of hairpins H1 and H2 is turned on in the presence of the input sequence (C1). C1 catalyzes the assembly of H1 and H2 into an H1:H2 duplex and is itself recycled. Circuit output (H1:H2 duplex) is quantitated as increasing fluorescence intensity of a labeled oligonucleotide probe (RepF) on displacement of its complementary quencher oligonucleotide (RepQ) by the H1:H2 duplex. ( b ) Design of T7 RNA polymerase-driven transcription templates for enzymatic synthesis of RNA CHA circuit components with precise 5′- and 3′-ends. Transcription template for each component, H1, H2 and C1, is flanked on both the left (L) and the right (R) sides by hammerhead ribozymes (HRz). The size (in nucleotides) of each component and its ribozyme flanks is indicated under each schematic. Secondary structures of the resulting chimeric RNA at 42°C before ribozyme processing are depicted (green, A; blue, C; black, G; red, U). The RNA structures were generated using NUPACK ( 13–16 ).

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Sequencing, Fluorescence, Labeling, Generated

    Application of RNA CHA circuit as an OR logic processor. ( a ) Schematic of RNA CHA circuit operation in response to either catalyst C1 OR C2. The RNA hairpin H1B serves as the OR gate, and circuit output is measured fluorimetrically using Spinach.ST1 RNA aptamer beacon. ( b ) Circuit components (H1B and H2 RNA hairpins), reporter RNA (Spinach.ST1) and the inputs C1 and C2 were transcribed from 500 ng of duplex DNA transcription templates using T7 RNA polymerase. Transcription templates were prepared using the same procedure as   Figure 8 . Following filtration through Sephadex G25, 3 µl/transcript (or 1.5 µl each of C1 and C2 when added together in a reaction) was mixed in the indicated combinations in 1× TNaK buffer containing 70 µM DFHBI and 20 U of RNaseOUT. Circuits were operated at 37°C, and outputs were measured fluorimetrically.

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Application of RNA CHA circuit as an OR logic processor. ( a ) Schematic of RNA CHA circuit operation in response to either catalyst C1 OR C2. The RNA hairpin H1B serves as the OR gate, and circuit output is measured fluorimetrically using Spinach.ST1 RNA aptamer beacon. ( b ) Circuit components (H1B and H2 RNA hairpins), reporter RNA (Spinach.ST1) and the inputs C1 and C2 were transcribed from 500 ng of duplex DNA transcription templates using T7 RNA polymerase. Transcription templates were prepared using the same procedure as Figure 8 . Following filtration through Sephadex G25, 3 µl/transcript (or 1.5 µl each of C1 and C2 when added together in a reaction) was mixed in the indicated combinations in 1× TNaK buffer containing 70 µM DFHBI and 20 U of RNaseOUT. Circuits were operated at 37°C, and outputs were measured fluorimetrically.

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Filtration

    Cotranscriptional RNA CHA and circuit design optimization for cotranscription. ( a ) Cotranscribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. Fifty nanograms each of H1 and H2 transcription templates, along with titrating amounts of C1 transcription template, was cotranscribed for 1 h at 42°C using T7 RNA polymerase followed by passage through Illustra MicroSpin Sephadex G25 columns. Transcription templates were amplified from cloned inserts using primers pCR2.1.F and pCR2.1.R specific to plasmid sequences flanking the inserts. Two microliter aliquots of the cotranscribed RNA mixtures were then incubated in 15 µl of volume with 400 nM RepF annealed with 5× excess (2 µM) RepQ fluorescent DNA reporter duplex in 1× TNaK buffer containing 20 U of RNaseOUT and 0.5 µM ROX reference dye to quantitate formation of H1:H2 RNA duplexes at 52°C. Average data from triplicate experiments are represented. ( b  and  c ) Schematic depicting sequences of RNA hairpins H1 and H2 with one- or two-base engineered mismatches. Mismatched H1 (mH1) presents a two-base mismatch between its domain 4* and domain 4 of H2. The hairpins mAH1 and mGH1 each contain a single mismatched base between their domain 4* and the domain 4 of H2. The mutated H2 hairpin m2H2 presents two mismatched bases between its domain 2* and the H1 domain 2.

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: Cotranscriptional RNA CHA and circuit design optimization for cotranscription. ( a ) Cotranscribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. Fifty nanograms each of H1 and H2 transcription templates, along with titrating amounts of C1 transcription template, was cotranscribed for 1 h at 42°C using T7 RNA polymerase followed by passage through Illustra MicroSpin Sephadex G25 columns. Transcription templates were amplified from cloned inserts using primers pCR2.1.F and pCR2.1.R specific to plasmid sequences flanking the inserts. Two microliter aliquots of the cotranscribed RNA mixtures were then incubated in 15 µl of volume with 400 nM RepF annealed with 5× excess (2 µM) RepQ fluorescent DNA reporter duplex in 1× TNaK buffer containing 20 U of RNaseOUT and 0.5 µM ROX reference dye to quantitate formation of H1:H2 RNA duplexes at 52°C. Average data from triplicate experiments are represented. ( b and c ) Schematic depicting sequences of RNA hairpins H1 and H2 with one- or two-base engineered mismatches. Mismatched H1 (mH1) presents a two-base mismatch between its domain 4* and domain 4 of H2. The hairpins mAH1 and mGH1 each contain a single mismatched base between their domain 4* and the domain 4 of H2. The mutated H2 hairpin m2H2 presents two mismatched bases between its domain 2* and the H1 domain 2.

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Gel Purification, Amplification, Clone Assay, Plasmid Preparation, Incubation

    An entirely RNA-based CHA circuit operation and fluorimetric detection. ( a ) CHA circuit components (hairpins H1B and H2 and catalyst C1) and the RNA reporter Spinach.ST1 were separately transcribed by T7 RNA polymerase from 500 ng of PCR-generated duplex DNA transcription templates. H1B, H2 and C1 transcription templates were amplified using primers complementary to the exact ends of the cloned inserts (H1B.amp.F:H1B.amp.R, H2.amp.F:H2.amp.R and C1.amp.F:C1.amp.R, respectively) rather than the flanking plasmid. Spinach.ST transcription templates were amplified using primers specific to the flanking plasmid sequence at the 5′-end (pCR2.1.F) and the primer sphT.U.R specific to the 3′-end sequence of Spinach.ST. Transcription reactions were filtered through Sephadex G25 columns before circuit assembly. Three microliters of H1B, H2, C1 and Spinach.ST1 transcripts was mixed in indicated combinations and incubated in 1× TNaK buffer containing 70 µM DFHBI and 20 U of RNaseOUT. Circuit output was measured as increasing fluorescence intensity over time at 37°C. ( b–d ) Performance of DNA reporter duplex H1BF:H1BQ (b) versus Spinach.ST1 (c) in measuring RNA CHA circuit output. Indicated concentrations of gel-purified RNA hairpins H1B and H2 were incubated with equal concentration of H1BF:H1BQ or gel-purified Spinach.ST1 (+ 70 µM DFHBI) in the presence of titrating concentrations of pure C1 RNA. All circuits were operated in 1× TNaK buffer containing 20 U of RNaseOUT at 37°C, and average data from triplicate experiments are represented. Signal-to-noise ratio of H1BF:H1BQ versus Spinach.ST1 over the time course of RNA CHA detection is plotted in (d).

    Journal: Nucleic Acids Research

    Article Title: Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

    doi: 10.1093/nar/gku074

    Figure Lengend Snippet: An entirely RNA-based CHA circuit operation and fluorimetric detection. ( a ) CHA circuit components (hairpins H1B and H2 and catalyst C1) and the RNA reporter Spinach.ST1 were separately transcribed by T7 RNA polymerase from 500 ng of PCR-generated duplex DNA transcription templates. H1B, H2 and C1 transcription templates were amplified using primers complementary to the exact ends of the cloned inserts (H1B.amp.F:H1B.amp.R, H2.amp.F:H2.amp.R and C1.amp.F:C1.amp.R, respectively) rather than the flanking plasmid. Spinach.ST transcription templates were amplified using primers specific to the flanking plasmid sequence at the 5′-end (pCR2.1.F) and the primer sphT.U.R specific to the 3′-end sequence of Spinach.ST. Transcription reactions were filtered through Sephadex G25 columns before circuit assembly. Three microliters of H1B, H2, C1 and Spinach.ST1 transcripts was mixed in indicated combinations and incubated in 1× TNaK buffer containing 70 µM DFHBI and 20 U of RNaseOUT. Circuit output was measured as increasing fluorescence intensity over time at 37°C. ( b–d ) Performance of DNA reporter duplex H1BF:H1BQ (b) versus Spinach.ST1 (c) in measuring RNA CHA circuit output. Indicated concentrations of gel-purified RNA hairpins H1B and H2 were incubated with equal concentration of H1BF:H1BQ or gel-purified Spinach.ST1 (+ 70 µM DFHBI) in the presence of titrating concentrations of pure C1 RNA. All circuits were operated in 1× TNaK buffer containing 20 U of RNaseOUT at 37°C, and average data from triplicate experiments are represented. Signal-to-noise ratio of H1BF:H1BQ versus Spinach.ST1 over the time course of RNA CHA detection is plotted in (d).

    Article Snippet: In all, 100 pg to 1000 ng of double-stranded DNA transcription templates was transcribed using 100 U of T7 RNA polymerase (NEB) in 50 µl reactions containing 40 mM Tris–HCl, pH 7.9, 30 mM MgCl2 , 10 mM DTT, 2 mM spermidine, 4 mM ribonucleotide (rNTP) mix and 20 U of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

    Techniques: Polymerase Chain Reaction, Generated, Amplification, Clone Assay, Plasmid Preparation, Sequencing, Incubation, Fluorescence, Purification, Concentration Assay

    Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay

    Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Titration

    Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Molecular Weight, Sequencing

    Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Incubation

    The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Size-exclusion Chromatography, Mass Spectrometry, Sequencing

    The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Fluorescence, Titration

    ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Flow Cytometry, Concentration Assay, Protein Concentration, Standard Deviation

    ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection

    ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques:

    DNMT1 and PKCζ colocalize in the nucleus of HeLa cells . HeLa cells are shown with ( A ), DsRed.DNMT1 (red) ( B ), GFP-phosphorylated-PKCζ (green) ( C ), DsRed.DNMT1 and GFP-phosphorylated-PKCζ (merged yellow) ( D ), nucleus (blue) ( E ), merge nucleus and DsRed.DNMT1 ( F ), merge nucleus and GFP-phosphorylated-PKCζ ( G ), merge nucleus, DsRed.DNMT1, and GFP-phosphorylated-PKCζ ( H ). The construct DsRed.DNMT1 was transfected in HeLa cells 48 hours before cells fixation and permeabilization. An anti-phosphorylated-PKCζ rabbit antibody was used in combination with an anti-rabbit antibody coupled with GFP to detect endogenous activated form of PKCζ.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: DNMT1 and PKCζ colocalize in the nucleus of HeLa cells . HeLa cells are shown with ( A ), DsRed.DNMT1 (red) ( B ), GFP-phosphorylated-PKCζ (green) ( C ), DsRed.DNMT1 and GFP-phosphorylated-PKCζ (merged yellow) ( D ), nucleus (blue) ( E ), merge nucleus and DsRed.DNMT1 ( F ), merge nucleus and GFP-phosphorylated-PKCζ ( G ), merge nucleus, DsRed.DNMT1, and GFP-phosphorylated-PKCζ ( H ). The construct DsRed.DNMT1 was transfected in HeLa cells 48 hours before cells fixation and permeabilization. An anti-phosphorylated-PKCζ rabbit antibody was used in combination with an anti-rabbit antibody coupled with GFP to detect endogenous activated form of PKCζ.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Construct, Transfection

    Phosphorylation of DNMT1 by PKCζ reduces its methyltransferase activity . Quantitative measurements of S -adenosyl-l-( methyl - 3 H)methionine integration in a DNA matrix poly(dI-dC).poly(dI-dC) by 20 nM of recombinant DNMT1 in the presence 100 ng of recombinant PKCζ incubated with or without 50 μM of ATP for different times. Data are representative of three independent experiments. Bars, S.D.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: Phosphorylation of DNMT1 by PKCζ reduces its methyltransferase activity . Quantitative measurements of S -adenosyl-l-( methyl - 3 H)methionine integration in a DNA matrix poly(dI-dC).poly(dI-dC) by 20 nM of recombinant DNMT1 in the presence 100 ng of recombinant PKCζ incubated with or without 50 μM of ATP for different times. Data are representative of three independent experiments. Bars, S.D.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Activity Assay, Recombinant, Incubation

    Decrease of DNA methylation in HEK-293 cells overexpressing DNMT1 and PKCζ . ( A ) Western blot analysis showing expression of PKCζ and DNMT1 in HEK-293 transfected cells used in the analysis of methylated DNA Ip-on-Chip described in Materials and methods. ( B ) Histograms representing the methylation status of 15 genes selected from active regions as measured by qPCR using DNA immunoprecipated with an antibody against 5-methylcytosine. Untr12 was used as a control for a negative region. TRPA1 was used as a positive control. Copy number values were normalized for primer efficiency by dividing by the values obtained using input DNA and the same primer pairs. Error bars represent standard deviations calculated from the triplicate determinations. *, P

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: Decrease of DNA methylation in HEK-293 cells overexpressing DNMT1 and PKCζ . ( A ) Western blot analysis showing expression of PKCζ and DNMT1 in HEK-293 transfected cells used in the analysis of methylated DNA Ip-on-Chip described in Materials and methods. ( B ) Histograms representing the methylation status of 15 genes selected from active regions as measured by qPCR using DNA immunoprecipated with an antibody against 5-methylcytosine. Untr12 was used as a control for a negative region. TRPA1 was used as a positive control. Copy number values were normalized for primer efficiency by dividing by the values obtained using input DNA and the same primer pairs. Error bars represent standard deviations calculated from the triplicate determinations. *, P

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: DNA Methylation Assay, Western Blot, Expressing, Transfection, Methylation, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Positive Control

    PKC isoforms preferentially phosphorylate DNMT1 N-terminal domain . ( A ) Diagram of DNMT1 showing the corresponding regions of the GST fusion DNMT1 fragments used for phosphorylation assays. Methylation DNA-dependent allosteric activation (MDDAAD), bromo domain (BD), and nuclear localization sequences (NLS) of DNMT1 are indicated. ( B ) Coomassie-stained gel representing GST fusion DNMT1 proteins used for phosphorylation assays. Positions of the fusion fragments are marked with an asterisk. ( C ) Phosphorylation of GST fusion DNMT1 fragments following incubation with 20 nM of activated recombinant PKCα, βI, βII, γ, δ or η using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments. ( D ) Phosphorylation of the GST fusion DNMT1 fragment 1 to 446 following incubation with 20 nM of activated recombinant PKCα, βI, βII, γ, δ, ε, η, μ or ζ using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data represent the average of three independent experiments that gave similar results. Bars, S.D.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: PKC isoforms preferentially phosphorylate DNMT1 N-terminal domain . ( A ) Diagram of DNMT1 showing the corresponding regions of the GST fusion DNMT1 fragments used for phosphorylation assays. Methylation DNA-dependent allosteric activation (MDDAAD), bromo domain (BD), and nuclear localization sequences (NLS) of DNMT1 are indicated. ( B ) Coomassie-stained gel representing GST fusion DNMT1 proteins used for phosphorylation assays. Positions of the fusion fragments are marked with an asterisk. ( C ) Phosphorylation of GST fusion DNMT1 fragments following incubation with 20 nM of activated recombinant PKCα, βI, βII, γ, δ or η using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments. ( D ) Phosphorylation of the GST fusion DNMT1 fragment 1 to 446 following incubation with 20 nM of activated recombinant PKCα, βI, βII, γ, δ, ε, η, μ or ζ using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data represent the average of three independent experiments that gave similar results. Bars, S.D.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Methylation, Activation Assay, Staining, Incubation, Recombinant, Negative Control

    PKCε does not phosphorylate individual domains of DNMT1 . Incorporation of (γ- 32 P)ATP by GST fusion DNMT1 fragments following incubation with 20 nM of activated recombinant PKCζ, PKCμ or PKCε. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: PKCε does not phosphorylate individual domains of DNMT1 . Incorporation of (γ- 32 P)ATP by GST fusion DNMT1 fragments following incubation with 20 nM of activated recombinant PKCζ, PKCμ or PKCε. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Incubation, Recombinant, Negative Control

    PKCζ interacts with and phosphorylates DNMT1 fragments . ( A ) Binding of PKCζ to GST fusion DNMT1 fragments using the pull-down procedure described in Materials and methods. Input, 10 ng of recombinant PKCζ. ( B ) Ponceau-stained transferred proteins from pull-down experiments. Positions of the fusion proteins are marked with an asterisk. ( C ) Phosphorylation of GST fusion DNMT1 fragments bound and ( D ) unbound to beads following incubation with 20 nM of activated recombinant PKCζ using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments. Bars, S.D.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: PKCζ interacts with and phosphorylates DNMT1 fragments . ( A ) Binding of PKCζ to GST fusion DNMT1 fragments using the pull-down procedure described in Materials and methods. Input, 10 ng of recombinant PKCζ. ( B ) Ponceau-stained transferred proteins from pull-down experiments. Positions of the fusion proteins are marked with an asterisk. ( C ) Phosphorylation of GST fusion DNMT1 fragments bound and ( D ) unbound to beads following incubation with 20 nM of activated recombinant PKCζ using (γ- 32 P)ATP. Counts were obtained following subtraction of the negative control (GST alone). Data are representative of three independent experiments. Bars, S.D.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Binding Assay, Recombinant, Staining, Incubation, Negative Control

    In vivo association between DNMT1 and PKCζ . (A) Co-immunoprecipitation of DNMT1 and PKCζ in nuclear extracts of HEK-293 cells. The cells were transfected with DNMT1 and PKCζ-c-myc or c-myc for 48 hours and c-myc proteins were purified with immobilized anti-c-myc beads. Protein complexes were resolved by SDS/PAGE and the presence of PKCζ was demonstrated using an anti-c-myc antibody; DNMT1 and actin were revealed, respectively, using an anti-DNMT1 and an anti-actin antibody. (B) Detection of endogenous PKCζ activity in DNMT1 immunoprecipitates. Nuclear proteins from HEK-293 cells were incubated with beads prebound to an isotopic IgG antibody or antibodies against DNMT1 or PKCζ for 4 hours. After several washes, protein-bead complexes were tested for kinase activity using (γ- 32 P)ATP and PKCζ specific substrate. Data are representative of three independent experiments. rec. PKCζ, recombinant PKCζ.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: In vivo association between DNMT1 and PKCζ . (A) Co-immunoprecipitation of DNMT1 and PKCζ in nuclear extracts of HEK-293 cells. The cells were transfected with DNMT1 and PKCζ-c-myc or c-myc for 48 hours and c-myc proteins were purified with immobilized anti-c-myc beads. Protein complexes were resolved by SDS/PAGE and the presence of PKCζ was demonstrated using an anti-c-myc antibody; DNMT1 and actin were revealed, respectively, using an anti-DNMT1 and an anti-actin antibody. (B) Detection of endogenous PKCζ activity in DNMT1 immunoprecipitates. Nuclear proteins from HEK-293 cells were incubated with beads prebound to an isotopic IgG antibody or antibodies against DNMT1 or PKCζ for 4 hours. After several washes, protein-bead complexes were tested for kinase activity using (γ- 32 P)ATP and PKCζ specific substrate. Data are representative of three independent experiments. rec. PKCζ, recombinant PKCζ.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: In Vivo, Immunoprecipitation, Transfection, Purification, SDS Page, Activity Assay, Incubation, Recombinant

    PKC isoforms phosphorylate human recombinant DNMT1 . ( A ) Quantitative measurements of phosphorylation of 5 nM of DNMT1 in the presence of (γ- 32 P)ATP for 30 minutes at 30°C with the indicated amounts of activated recombinant human PKCα, δ, ε, μ or ζ. DNMT1 phosphorylation was quantified as the ratio of PKC activity to negative control. Data represent the average of two representative independent experiments. Bars, S.D. ( B ) PKC activity of recombinant PKC isoforms against CREB, showing that all isoforms were active. 20 nM of each PKC and 1.5 μM of CREB peptides were used for the assay and were incubated in the presence of (γ- 32 P)ATP for 30 minutes at 30°C. Bars, S.D. ( C ) Autoradiography of a SDS-PAGE showing incorporation (γ- 32 P)ATP in recombinant human DNMT1 following incubation with different amounts of human PKCζ.

    Journal: BMC Biology

    Article Title: PKC isoforms interact with and phosphorylate DNMT1

    doi: 10.1186/1741-7007-9-31

    Figure Lengend Snippet: PKC isoforms phosphorylate human recombinant DNMT1 . ( A ) Quantitative measurements of phosphorylation of 5 nM of DNMT1 in the presence of (γ- 32 P)ATP for 30 minutes at 30°C with the indicated amounts of activated recombinant human PKCα, δ, ε, μ or ζ. DNMT1 phosphorylation was quantified as the ratio of PKC activity to negative control. Data represent the average of two representative independent experiments. Bars, S.D. ( B ) PKC activity of recombinant PKC isoforms against CREB, showing that all isoforms were active. 20 nM of each PKC and 1.5 μM of CREB peptides were used for the assay and were incubated in the presence of (γ- 32 P)ATP for 30 minutes at 30°C. Bars, S.D. ( C ) Autoradiography of a SDS-PAGE showing incorporation (γ- 32 P)ATP in recombinant human DNMT1 following incubation with different amounts of human PKCζ.

    Article Snippet: Briefly, 20 nM of DNMT1 (New England Biolabs) and 100 ng of PKCζ were incubated with or without 50 μM of ATP in the presence of 5 μCi of S -adenosyl-l-(methyl -3 H)methionine (AdoMet) and 50 ng of poly(dI-dC)·poly(dI-dC) in methyltransferase buffer (50 mM Tris-HCL, pH 7.8, 1 mM Na2 EDTA, pH 8.0, 1 mM DTT, 7 μg/ml phenylmethylsulfonyl fluoride, 5% glycerol) supplemented with 5 μg of phosphatidylserine and 5 mM MgCl2 to allow PKCζ activity.

    Techniques: Recombinant, Activity Assay, Negative Control, Incubation, Autoradiography, SDS Page