Structured Review

GE Healthcare dna polymerase
Comparison of <t>DNA</t> polymerase activity in the presence of <t>dUTP.</t> The efficiency of dUTP utilization was compared among five DNA polymerases. Results are presented as percentages of incorporated radioactivity in the presence of [ 3 H]dUTP compared to [ 3 H]TTP. The relative efficiencies of dUTP utilization were 74.9% for Neq DNA polymerase, 71.3% for Taq DNA polymerase, 9.4% for Pfu DNA polymerase, 15.1% for Vent DNA polymerase, and 12.3% for KOD DNA polymerase. Columns are mean values obtained from three independent assays; bars indicate standard deviations.
Dna Polymerase, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/GE Healthcare
Average 93 stars, based on 7 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-04
93/100 stars

Images

1) Product Images from "Unique Substrate Spectrum and PCR Application of Nanoarchaeum equitans Family B DNA Polymerase ▿"

Article Title: Unique Substrate Spectrum and PCR Application of Nanoarchaeum equitans Family B DNA Polymerase ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.00624-08

Comparison of DNA polymerase activity in the presence of dUTP. The efficiency of dUTP utilization was compared among five DNA polymerases. Results are presented as percentages of incorporated radioactivity in the presence of [ 3 H]dUTP compared to [ 3 H]TTP. The relative efficiencies of dUTP utilization were 74.9% for Neq DNA polymerase, 71.3% for Taq DNA polymerase, 9.4% for Pfu DNA polymerase, 15.1% for Vent DNA polymerase, and 12.3% for KOD DNA polymerase. Columns are mean values obtained from three independent assays; bars indicate standard deviations.
Figure Legend Snippet: Comparison of DNA polymerase activity in the presence of dUTP. The efficiency of dUTP utilization was compared among five DNA polymerases. Results are presented as percentages of incorporated radioactivity in the presence of [ 3 H]dUTP compared to [ 3 H]TTP. The relative efficiencies of dUTP utilization were 74.9% for Neq DNA polymerase, 71.3% for Taq DNA polymerase, 9.4% for Pfu DNA polymerase, 15.1% for Vent DNA polymerase, and 12.3% for KOD DNA polymerase. Columns are mean values obtained from three independent assays; bars indicate standard deviations.

Techniques Used: Activity Assay, Radioactivity

Comparison of PCR amplifications in the presence of deaminated bases. (a) PCR in the presence of dUTP or dITP. PCR was conducted using 250 μM dNTPs (lanes 1 to 5); 250 μM each of dATP, dCTP, dGTP, and dUTP (lanes 6 to 10); or 250 μM each of dATP, dCTP, dTTP, and dITP/dGTP (1:9 ratio) (lanes 11 to 15). Lane M, DNA molecular size markers; lanes 1, 6, and 11, Neq DNA polymerase; lanes 2, 7, and 12, Taq DNA polymerase; lanes 3, 8, and 13, Pfu DNA polymerase; lanes 4, 9, and 14, Vent DNA polymerase; lanes 5, 10, and 15, KOD DNA polymerase. (b) PCRs in the presence of different concentrations of dITP. PCR was conducted using dITP/dGTP mixtures in different ratios, in which the final concentration of the mixtures was maintained at 250 μM. The values on the gel indicate the percentages of dITP included in dITP/dGTP mixture. Lanes 1 to 5, Neq DNA polymerase; lanes 6 to 10, Taq DNA polymerase.
Figure Legend Snippet: Comparison of PCR amplifications in the presence of deaminated bases. (a) PCR in the presence of dUTP or dITP. PCR was conducted using 250 μM dNTPs (lanes 1 to 5); 250 μM each of dATP, dCTP, dGTP, and dUTP (lanes 6 to 10); or 250 μM each of dATP, dCTP, dTTP, and dITP/dGTP (1:9 ratio) (lanes 11 to 15). Lane M, DNA molecular size markers; lanes 1, 6, and 11, Neq DNA polymerase; lanes 2, 7, and 12, Taq DNA polymerase; lanes 3, 8, and 13, Pfu DNA polymerase; lanes 4, 9, and 14, Vent DNA polymerase; lanes 5, 10, and 15, KOD DNA polymerase. (b) PCRs in the presence of different concentrations of dITP. PCR was conducted using dITP/dGTP mixtures in different ratios, in which the final concentration of the mixtures was maintained at 250 μM. The values on the gel indicate the percentages of dITP included in dITP/dGTP mixture. Lanes 1 to 5, Neq DNA polymerase; lanes 6 to 10, Taq DNA polymerase.

Techniques Used: Polymerase Chain Reaction, Concentration Assay

Comparison of Neq plus and Taq DNA polymerases, in combination with UDG, in preventing carryover contamination in PCR. To mimic carryover contamination, the 2-kb uracil-DNAs (75 pg) were added to new PCR mixtures that contained 150 pg of the 4-kb target DNAs. The mixtures were preincubated at 25°C for 10 min in the presence (lanes 2 to 7) or absence (lane 1) of 1 U of BMTU 3346 UDG. After heating at 95°C for 5 min, the mixtures were used for normal PCR cycling in the presence of dUTP. PCRs were carried out using Taq DNA polymerase (lanes 2 to 4) and Neq plus DNA polymerase (lanes 1 and 5 to 7). Lane M, DNA molecular size markers; lanes 2 and 5, 20 cycles; lanes 3 and 6, 25 cycles; lanes 1, 4, and 7, 30 cycles.
Figure Legend Snippet: Comparison of Neq plus and Taq DNA polymerases, in combination with UDG, in preventing carryover contamination in PCR. To mimic carryover contamination, the 2-kb uracil-DNAs (75 pg) were added to new PCR mixtures that contained 150 pg of the 4-kb target DNAs. The mixtures were preincubated at 25°C for 10 min in the presence (lanes 2 to 7) or absence (lane 1) of 1 U of BMTU 3346 UDG. After heating at 95°C for 5 min, the mixtures were used for normal PCR cycling in the presence of dUTP. PCRs were carried out using Taq DNA polymerase (lanes 2 to 4) and Neq plus DNA polymerase (lanes 1 and 5 to 7). Lane M, DNA molecular size markers; lanes 2 and 5, 20 cycles; lanes 3 and 6, 25 cycles; lanes 1, 4, and 7, 30 cycles.

Techniques Used: Polymerase Chain Reaction

2) Product Images from "TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease"

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease

Journal: Molecular and Cellular Biology

doi:

Preferential binding of TBP to damaged DNA. CDDP-, TDDP-, Dach-, or Dien-treated (100 lesions/plasmid); EtAz-treated (30 lesions/plasmid); or AAF-treated (15 to 20 lesions/plasmid) DNA or untreated (NT) DNA was labelled with [α- 32 P]dATP. NT or damaged DNA was then incubated with increasing amounts of TBP and tested for retention on nitrocellulose filters. Graphs represent the percentages of DNA retained on the filters as a function of the amount of TBP. One hundred percent represents the total counts obtained when 1 μl of each DNA probe (input) was spotted onto Whatman paper and simultaneously exposed with the nitrocellulose filter.
Figure Legend Snippet: Preferential binding of TBP to damaged DNA. CDDP-, TDDP-, Dach-, or Dien-treated (100 lesions/plasmid); EtAz-treated (30 lesions/plasmid); or AAF-treated (15 to 20 lesions/plasmid) DNA or untreated (NT) DNA was labelled with [α- 32 P]dATP. NT or damaged DNA was then incubated with increasing amounts of TBP and tested for retention on nitrocellulose filters. Graphs represent the percentages of DNA retained on the filters as a function of the amount of TBP. One hundred percent represents the total counts obtained when 1 μl of each DNA probe (input) was spotted onto Whatman paper and simultaneously exposed with the nitrocellulose filter.

Techniques Used: Binding Assay, Plasmid Preparation, Incubation

Related Articles

Clone Assay:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: Paragraph title: DNA cloning. ... A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R).

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: Interesting clones will be identified and PCR primers could be used for further experiments (e.g. sequencing the whole bacterial genome). .. For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used.

Article Title: Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain
Article Snippet: Paragraph title: Phage cloning and sequencing. ... Sequencing was performed manually by the dideoxy-mediated chain termination method ( ) using T7 Sequenase, version 2.0, DNA polymerase (Amersham Life Sciences, Inc.) and α-35 S-dATP.

Amplification:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: .. A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R). ..

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The AdMLP TATA box DNA probe was obtained by PCR amplification with a unique end-labelled primer and purification by G-50 gel filtration. .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham).

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: .. For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used. .. It means that RST microarrays give the possibility both for studying biodiversity and isolation of new microorganisms.

Article Title: Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain
Article Snippet: Nonamplified eluates were plated on Luria-Bertani (LB) top agar containing 50 μg of IPTG (isopropyl-β- d -thiogalactopyranoside)/ml and 40 μg of X-Gal (5-bromo-4-chloro-3-indolyl-μ- d -galactopyranoside), and, after 16 h of incubation, single phage plaques were amplified in 1 ml of mid-log-phase E. coli ER2537 in LB medium for 4.5 h at 37°C. .. Sequencing was performed manually by the dideoxy-mediated chain termination method ( ) using T7 Sequenase, version 2.0, DNA polymerase (Amersham Life Sciences, Inc.) and α-35 S-dATP.

Article Title: NotI passporting to identify species composition of complex microbial systems
Article Snippet: Recently, a new DNA polymerase, Phi 29 became commercially available (Amersham Biosciences, Buckinghamshire, UK). .. This DNA polymerase can be used for isothermal amplification of large DNA molecules including whole bacterial genomes ( , ).

Filtration:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The AdMLP TATA box DNA probe was obtained by PCR amplification with a unique end-labelled primer and purification by G-50 gel filtration. .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham).

Paired-end Tag:

Article Title: NotI passporting to identify species composition of complex microbial systems
Article Snippet: On average 96.6% of ditags was species specific and Listeria monocytogenes strain EGD had the lowest fraction of species-specific tags: 83.8%. .. Recently, a new DNA polymerase, Phi 29 became commercially available (Amersham Biosciences, Buckinghamshire, UK).

Autoradiography:

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min. .. The DNA band was visualized by autoradiography, excised, and eluted overnight with 200 μl of Tris-EDTA buffer at 4°C.

Construct:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: Plasmids for disruption of algO were constructed as follows. .. A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R).

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: Contrary to the approach described above, where only carefully selected NotI clones were used to construct microarrays, another way may be even more fruitful. .. For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used.

Electrophoresis:

Article Title: Retinoic acid modulates retinaldehyde dehydrogenase 1 gene expression through the induction of GADD153-C/EBP? interaction
Article Snippet: Total RNA (20 μg) was subjected to electrophoresis in a 1% agarose, 2.2 M formaldehyde gel and then transferred to GeneScreen Plus membranes in 20× SSC (3 M NaCl, 30 mM sodium citrate, pH 7.0) (J.T. .. The RNA was fixed to the membranes by baking at 80 °C for 2 h, prehybridized in SSC/formamide solution, and hybridized at 42 °C with the 32 P-labeled probes. cDNAs were labeled by random priming with DNA polymerase I Klenow fragment using [32 P]dCTP (Amersham Pharmacia Biotech, UK).

Incubation:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham). .. After addition of 40 ng of purified recombinant yeast TBP and, when indicated, 200 ng of human TFIIB, the mixture was incubated for 20 to 30 min at room temperature in the absence or presence of competitor DNA.

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: .. The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min. .. The labeled DNA was electrophoresed on 10% polyacrylamide–0.5× Tris-borate-EDTA (TBE) gels.

Article Title: Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain
Article Snippet: Nonamplified eluates were plated on Luria-Bertani (LB) top agar containing 50 μg of IPTG (isopropyl-β- d -thiogalactopyranoside)/ml and 40 μg of X-Gal (5-bromo-4-chloro-3-indolyl-μ- d -galactopyranoside), and, after 16 h of incubation, single phage plaques were amplified in 1 ml of mid-log-phase E. coli ER2537 in LB medium for 4.5 h at 37°C. .. Sequencing was performed manually by the dideoxy-mediated chain termination method ( ) using T7 Sequenase, version 2.0, DNA polymerase (Amersham Life Sciences, Inc.) and α-35 S-dATP.

Activity Assay:

Article Title: Unique Substrate Spectrum and PCR Application of Nanoarchaeum equitans Family B DNA Polymerase ▿
Article Snippet: Paragraph title: DNA polymerase activity assay. ... To determine whether a DNA polymerase could catalyze the incorporation of dUTP, the assay was also performed using [5-3 H]dUTP (5 to 30 Ci/mmol; GE Healthcare) and dUTP instead of [ methyl -3 H]TTP and dTTP, respectively.

Hybridization:

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: A Cla I- Eco RI 0.95-kb fragment from plasmid pISM1236 (see Fig. ) containing the entire open reading frame of the beta-hemolysin gene was used in these hybridization studies. .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Countercurrent Chromatography:

Article Title: Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain
Article Snippet: After one precipitation with PEG 8000 as described above, DNA from the phages was extracted and sequenced with a −96 gIII sequencing primer (CCC TCA TAG TTA GCG TAA CG) (New England Biolabs). .. Sequencing was performed manually by the dideoxy-mediated chain termination method ( ) using T7 Sequenase, version 2.0, DNA polymerase (Amersham Life Sciences, Inc.) and α-35 S-dATP.

Southern Blot:

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: Paragraph title: Determination of C by Southern blot marker frequency analysis. ... A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham).

Footprinting:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: Paragraph title: DNase I footprinting of TBP. ... The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham).

Northern Blot:

Article Title: Retinoic acid modulates retinaldehyde dehydrogenase 1 gene expression through the induction of GADD153-C/EBP? interaction
Article Snippet: Paragraph title: 2.4. Northern blot analysis ... The RNA was fixed to the membranes by baking at 80 °C for 2 h, prehybridized in SSC/formamide solution, and hybridized at 42 °C with the 32 P-labeled probes. cDNAs were labeled by random priming with DNA polymerase I Klenow fragment using [32 P]dCTP (Amersham Pharmacia Biotech, UK).

DNA Sequencing:

Article Title: Digital Detection of Genetic Mutations Using SPC-Sequencing
Article Snippet: Paragraph title: DNA Sequencing Using a Fluorescent Capillary-Array DNA Sequencer ... A 20-μL reaction mixture contained 100 ng of the DNA template, 5 pmole of the sequencing primer (5′-CGGACCACAGGATTT GTGT-3′, exon 2; 5′-ATATGACGTGTCTGCTCC-AC-3′, exon 20), and 8 μL of an ET Terminator mixture (Amersham Biosciences) containing DNA polymerase, fluorescence energy transfer dye-labeled ddNTPs, dNTPs, and reaction buffer.

DNA Labeling:

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: Paragraph title: DNA labeling and DNA mobility shift assay. ... The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min.

Sequencing:

Article Title: Digital Detection of Genetic Mutations Using SPC-Sequencing
Article Snippet: .. A 20-μL reaction mixture contained 100 ng of the DNA template, 5 pmole of the sequencing primer (5′-CGGACCACAGGATTT GTGT-3′, exon 2; 5′-ATATGACGTGTCTGCTCC-AC-3′, exon 20), and 8 μL of an ET Terminator mixture (Amersham Biosciences) containing DNA polymerase, fluorescence energy transfer dye-labeled ddNTPs, dNTPs, and reaction buffer. .. The sequencing product was purified by isopropanol precipitation, washed with 70% ethanol, and then dried under vacuum.

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: Interesting clones will be identified and PCR primers could be used for further experiments (e.g. sequencing the whole bacterial genome). .. For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used.

Article Title: Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain
Article Snippet: .. Sequencing was performed manually by the dideoxy-mediated chain termination method ( ) using T7 Sequenase, version 2.0, DNA polymerase (Amersham Life Sciences, Inc.) and α-35 S-dATP. ..

Article Title: NotI passporting to identify species composition of complex microbial systems
Article Snippet: Recently, a new DNA polymerase, Phi 29 became commercially available (Amersham Biosciences, Buckinghamshire, UK). .. Sequence information obtained during passporting can be used for the design of PCR primers and for amplification of genomes from unknown bacterial species showing interesting features.

Antiviral Assay:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham). .. The plasmid was then digested with Pvu I (New England Biolabs), and the Ava II- Pvu I fragment as well as the control nondamaged DNA probe (NT) was purified on a 5% polyacrylamide gel.

Recombinant:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham). .. After addition of 40 ng of purified recombinant yeast TBP and, when indicated, 200 ng of human TFIIB, the mixture was incubated for 20 to 30 min at room temperature in the absence or presence of competitor DNA.

Cellular Antioxidant Activity Assay:

Article Title: GreA and GreB proteins revive backtracked RNA polymerase in vivo by promoting transcript trimming
Article Snippet: The Klenow fragment of DNA polymerase I was purchased from Amersham. .. The Klenow fragment of DNA polymerase I was purchased from Amersham.

Radioactivity:

Article Title: Unique Substrate Spectrum and PCR Application of Nanoarchaeum equitans Family B DNA Polymerase ▿
Article Snippet: To determine whether a DNA polymerase could catalyze the incorporation of dUTP, the assay was also performed using [5-3 H]dUTP (5 to 30 Ci/mmol; GE Healthcare) and dUTP instead of [ methyl -3 H]TTP and dTTP, respectively. .. Incorporated radioactivity was determined using a Beckman LS6500 scintillation counter.

Fluorescence:

Article Title: Digital Detection of Genetic Mutations Using SPC-Sequencing
Article Snippet: .. A 20-μL reaction mixture contained 100 ng of the DNA template, 5 pmole of the sequencing primer (5′-CGGACCACAGGATTT GTGT-3′, exon 2; 5′-ATATGACGTGTCTGCTCC-AC-3′, exon 20), and 8 μL of an ET Terminator mixture (Amersham Biosciences) containing DNA polymerase, fluorescence energy transfer dye-labeled ddNTPs, dNTPs, and reaction buffer. .. The sequencing product was purified by isopropanol precipitation, washed with 70% ethanol, and then dried under vacuum.

Isolation:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: The fragment ( algO ) amplified by PCR was isolated and ligated with HincII-digested pUC119 (TaKaRa Bio). .. A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R).

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used. .. It means that RST microarrays give the possibility both for studying biodiversity and isolation of new microorganisms.

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: This fragment was isolated by agarose gel electrophoresis following plasmid digestion and was purified using a Qiagen (Chatsworth, Calif.) column. .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

Article Title: NotI passporting to identify species composition of complex microbial systems
Article Snippet: Recently, a new DNA polymerase, Phi 29 became commercially available (Amersham Biosciences, Buckinghamshire, UK). .. This means that the RSTS approach gives a possibility both for studying biodiversity and for isolation of new microorganisms.

Article Title: Retinoic acid modulates retinaldehyde dehydrogenase 1 gene expression through the induction of GADD153-C/EBP? interaction
Article Snippet: Total RNA from mouse liver was isolated by homogenizing cells in a guanidine/phenol solution (Biotex Laboratories, Houston, TX). .. The RNA was fixed to the membranes by baking at 80 °C for 2 h, prehybridized in SSC/formamide solution, and hybridized at 42 °C with the 32 P-labeled probes. cDNAs were labeled by random priming with DNA polymerase I Klenow fragment using [32 P]dCTP (Amersham Pharmacia Biotech, UK).

Labeling:

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham). ..

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: .. The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min. .. The labeled DNA was electrophoresed on 10% polyacrylamide–0.5× Tris-borate-EDTA (TBE) gels.

Article Title: Retinoic acid modulates retinaldehyde dehydrogenase 1 gene expression through the induction of GADD153-C/EBP? interaction
Article Snippet: .. The RNA was fixed to the membranes by baking at 80 °C for 2 h, prehybridized in SSC/formamide solution, and hybridized at 42 °C with the 32 P-labeled probes. cDNAs were labeled by random priming with DNA polymerase I Klenow fragment using [32 P]dCTP (Amersham Pharmacia Biotech, UK). .. Filters were washed in 0.1× SSC and 0.5% sodium dodecyl sulfate (Invitrogen, Carlsbad, CA), and the membranes were exposed to autoradiographic film overnight at –80 °C with aid of a Phosphor screen to visualize hybridized RNA.

Purification:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The AdMLP TATA box DNA probe was obtained by PCR amplification with a unique end-labelled primer and purification by G-50 gel filtration. .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham).

Article Title: Digital Detection of Genetic Mutations Using SPC-Sequencing
Article Snippet: A 20-μL reaction mixture contained 100 ng of the DNA template, 5 pmole of the sequencing primer (5′-CGGACCACAGGATTT GTGT-3′, exon 2; 5′-ATATGACGTGTCTGCTCC-AC-3′, exon 20), and 8 μL of an ET Terminator mixture (Amersham Biosciences) containing DNA polymerase, fluorescence energy transfer dye-labeled ddNTPs, dNTPs, and reaction buffer. .. The sequencing product was purified by isopropanol precipitation, washed with 70% ethanol, and then dried under vacuum.

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: This fragment was isolated by agarose gel electrophoresis following plasmid digestion and was purified using a Qiagen (Chatsworth, Calif.) column. .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min. .. DNA binding reactions were performed on ice for 30 min by incubating 2 μl of purified labeled fragment (1 ng of DNA), 1 μl of protein extract, and nonspecific competitor DNA (salmon sperm DNA in varying quantities) in binding buffer (50 mM HEPES KOH [pH 7.8] 150 mM KCl, 60% glycerol, 25 mM MgCl2 , 2.5 mM DTT, 0.5 mM EDTA).

Polymerase Chain Reaction:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: .. A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R). ..

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The AdMLP TATA box DNA probe was obtained by PCR amplification with a unique end-labelled primer and purification by G-50 gel filtration. .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham).

Article Title: Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems
Article Snippet: Interesting clones will be identified and PCR primers could be used for further experiments (e.g. sequencing the whole bacterial genome). .. For this purpose, the slalom approach ( ) and a new DNA polymerase, φ29 (Amersham Biosciences), allowing isothermal amplification of large DNA molecules, including whole bacterial genomes ( , ), can be used.

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: NotI passporting to identify species composition of complex microbial systems
Article Snippet: Recently, a new DNA polymerase, Phi 29 became commercially available (Amersham Biosciences, Buckinghamshire, UK). .. Sequence information obtained during passporting can be used for the design of PCR primers and for amplification of genomes from unknown bacterial species showing interesting features.

Polyacrylamide Gel Electrophoresis:

Article Title: Digital Detection of Genetic Mutations Using SPC-Sequencing
Article Snippet: A 20-μL reaction mixture contained 100 ng of the DNA template, 5 pmole of the sequencing primer (5′-CGGACCACAGGATTT GTGT-3′, exon 2; 5′-ATATGACGTGTCTGCTCC-AC-3′, exon 20), and 8 μL of an ET Terminator mixture (Amersham Biosciences) containing DNA polymerase, fluorescence energy transfer dye-labeled ddNTPs, dNTPs, and reaction buffer. .. The plate was loaded into a MegaBACE 1000 DNA sequencer (Amersham Biosciences), in which the DNA fragments were separated on the basis of their size by linear polyacrylamide gel electrophoresis and detected by using laser-induced fluorescence to produce a sequence electropherogram.

Plasmid Preparation:

Article Title: Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1
Article Snippet: The resultant plasmid containing algO was designated pUC119-algO. .. A Km resistance-encoding gene cassette for aminoglycoside 3′-phosphotransferase (Kmr ) was amplified by PCR with KOD as DNA polymerase, pUC4K (Amersham) as the template, and two synthetic oligonucleotides as primers (Km-F and Km-R).

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: .. The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham). .. The plasmid was then digested with Pvu I (New England Biolabs), and the Ava II- Pvu I fragment as well as the control nondamaged DNA probe (NT) was purified on a 5% polyacrylamide gel.

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: This fragment was isolated by agarose gel electrophoresis following plasmid digestion and was purified using a Qiagen (Chatsworth, Calif.) column. .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

DNA Hybridization:

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: Paragraph title: DNA hybridization. ... The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

Binding Assay:

Article Title: TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease
Article Snippet: The plasmid DNA containing a single cisplatin-induced 1,2-d(GpG) intrastrand cross-link was digested with Ava II (New England Biolabs), and the 5′ extremity was labelled with the Klenow fragment of DNA polymerase in the presence of [α-32 P]dCTP (3,000 Ci/mmol) (Amersham). .. The standard binding reaction mixtures contained 1 to 2 ng of end-labelled probe (20,000 cpm), 500 ng of poly(dG-dC), 10 mM Tris-HCl (pH 7.5), 50 mM KCl, 50 mM NaCl, 0.1 mM EDTA, 2 mM dithiothreitol, 5 mM MgCl2 , 2.5 mM CaCl2 , 4 mM spermidine, 0.2% Nonidet P-40, and 15% glycerol.

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min. .. DNA binding reactions were performed on ice for 30 min by incubating 2 μl of purified labeled fragment (1 ng of DNA), 1 μl of protein extract, and nonspecific competitor DNA (salmon sperm DNA in varying quantities) in binding buffer (50 mM HEPES KOH [pH 7.8] 150 mM KCl, 60% glycerol, 25 mM MgCl2 , 2.5 mM DTT, 0.5 mM EDTA).

Agarose Gel Electrophoresis:

Article Title: Cloning of a Beta-Hemolysin Gene of Brachyspira (Serpulina) hyodysenteriae and Its Expression in Escherichia coli
Article Snippet: This fragment was isolated by agarose gel electrophoresis following plasmid digestion and was purified using a Qiagen (Chatsworth, Calif.) column. .. The probe was labeled with 32 P by random-primer labeling using the Klenow fragment of DNA polymerase (Amersham).

Produced:

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. The terC probe was produced by using pBD2348 ( ) as the template and the primers ter1 (GTTGAAGTACTTGAGTCACC) and ter2 (CATTCAGACTTGAATGCGTG).

Mobility Shift:

Article Title: Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
Article Snippet: Paragraph title: DNA labeling and DNA mobility shift assay. ... The fragments were labeled by addition of DNA polymerase I Klenow fragment, dATP, dTTP, dGTP (1 nmol each), and [α-32 P]dCTP (60 μCi, 20 pmol [Amersham]) and incubation at 37°C for 30 min.

Marker:

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: Paragraph title: Determination of C by Southern blot marker frequency analysis. ... A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    GE Healthcare rna dependent dna polymerase activity
    Efficiency of (-)ssDNA synthesis in cell-free assay . The efficiencies of the reactions with WT and mutant RTs were compared in time course experiments. (A) Graphic representation of the cell-free system (HIV-1 PBS <t>RNA/tRNA</t> 3Lys ) used to monitor the synthesis of (-)ssDNA. (B) Synthesis of full-length <t>DNA</t> by WT and mutant enzymes. Reactions were initiated with 10 μM dNTPs and monitored by incorporation of [α- 32 P]-dCTP. Full-length DNA product and pausing sites are shown on the left. (C) Graphic representation of the cell-free system (HIV-1 PBS RNA/tRNA 3Lys ) used to monitor the efficiency of initiation of (-)ssDNA synthesis in the presence of the chain-terminator ddATP. (D) Initiation of (-) ssDNA synthesis by WT and mutant enzymes. Reactions were performed using 1 μM dNTPs, and ddATP was employed in place of dATP to give rise to a six-nucleotide initiation product. ddATP-terminated +6 product and +3 and +5 pausing position are shown on the left side. (E) Graphic representation of the gel-based assays shown in D.
    Rna Dependent Dna Polymerase Activity, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna dependent dna polymerase activity/product/GE Healthcare
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna dependent dna polymerase activity - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    94
    GE Healthcare dna polymerase b subunit gene
    Sites of collection and electron microscopy and phylogenetic analysis of the pandoravirus isolated in this work. (A) Map of Brazil showing where the samples were collected for the isolation of pandoraviruses. (B to D) Representative pictures from the areas of collection: Bom Jesus Creek (B), Mergulhão Creek (C), and the city of Bonito (D). (E) P. tropicalis particles were analyzed using scanning electron microscopy at 24 h.p.i. and an MOI of 0.01. (F, G, and H) Transmission electron microscopy (24 h.p.i./MOI 0.01) for the viral particles corresponding to the isolates of P. pampulha , P. tropicalis , and P. kadiweu , respectively. (I) Alignment of the sequences, showing that P. kadiweu and P. tropicalis represent strains of pandoraviruses with many exclusive polymorphisms (highlighted in yellow), compared to the sequences of other isolated pandoraviruses. (J) Maximum likelihood tree constructed using predicted sequence of 251 amino acids of a <t>DNA</t> <t>polymerase</t> B subunit in different isolates of pandoraviruses. The giant viruses isolated in this work are highlighted in red.
    Dna Polymerase B Subunit Gene, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase b subunit gene/product/GE Healthcare
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna polymerase b subunit gene - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    85
    GE Healthcare dna polymerase activity
    <t>DNA</t> binding affinity of WT and G517V pol <t>γ</t> proteins
    Dna Polymerase Activity, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase activity/product/GE Healthcare
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    dna polymerase activity - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    86
    GE Healthcare phi29 polymerase amplification viral dna
    The human genomic <t>DNA</t> levels were reduced by pre-treatment. Comparing the effects of different pre-treatment methods on the level of human gDNA (measured as ß-actin), in a clinical sample. A HSV1 + skin lesion-sample was pre-treated with centrifugation and filtration only, or with centrifugation, filtration and DNase treatment. The ß-actin content was measured by real-time PCR. (A) Centrifugation+filtration: Ct = 22; centrifugation+filtration+DNase treatment: Ct = 32; ΔCt = 10 which equals a 1000-fold decrease in signal. Negative control was water used as a PCR control. (B) Time-course for <t>Phi29-amplification</t> of pre-treated clinical sample (centrifugation+filtration+DNase) using GenomiPhi (GE Healthcare). Fold increase in signal plotted versus amplification time for HSV1 and ß-actin.
    Phi29 Polymerase Amplification Viral Dna, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phi29 polymerase amplification viral dna/product/GE Healthcare
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phi29 polymerase amplification viral dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Efficiency of (-)ssDNA synthesis in cell-free assay . The efficiencies of the reactions with WT and mutant RTs were compared in time course experiments. (A) Graphic representation of the cell-free system (HIV-1 PBS RNA/tRNA 3Lys ) used to monitor the synthesis of (-)ssDNA. (B) Synthesis of full-length DNA by WT and mutant enzymes. Reactions were initiated with 10 μM dNTPs and monitored by incorporation of [α- 32 P]-dCTP. Full-length DNA product and pausing sites are shown on the left. (C) Graphic representation of the cell-free system (HIV-1 PBS RNA/tRNA 3Lys ) used to monitor the efficiency of initiation of (-)ssDNA synthesis in the presence of the chain-terminator ddATP. (D) Initiation of (-) ssDNA synthesis by WT and mutant enzymes. Reactions were performed using 1 μM dNTPs, and ddATP was employed in place of dATP to give rise to a six-nucleotide initiation product. ddATP-terminated +6 product and +3 and +5 pausing position are shown on the left side. (E) Graphic representation of the gel-based assays shown in D.

    Journal: Retrovirology

    Article Title: Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance

    doi: 10.1186/1742-4690-6-14

    Figure Lengend Snippet: Efficiency of (-)ssDNA synthesis in cell-free assay . The efficiencies of the reactions with WT and mutant RTs were compared in time course experiments. (A) Graphic representation of the cell-free system (HIV-1 PBS RNA/tRNA 3Lys ) used to monitor the synthesis of (-)ssDNA. (B) Synthesis of full-length DNA by WT and mutant enzymes. Reactions were initiated with 10 μM dNTPs and monitored by incorporation of [α- 32 P]-dCTP. Full-length DNA product and pausing sites are shown on the left. (C) Graphic representation of the cell-free system (HIV-1 PBS RNA/tRNA 3Lys ) used to monitor the efficiency of initiation of (-)ssDNA synthesis in the presence of the chain-terminator ddATP. (D) Initiation of (-) ssDNA synthesis by WT and mutant enzymes. Reactions were performed using 1 μM dNTPs, and ddATP was employed in place of dATP to give rise to a six-nucleotide initiation product. ddATP-terminated +6 product and +3 and +5 pausing position are shown on the left side. (E) Graphic representation of the gel-based assays shown in D.

    Article Snippet: Specific activity determination The RNA-dependent DNA polymerase activity of each recombinant RT preparation was assayed in duplicate using poly(rA)/p(dT)12–18 template/primer (GE Healthcare) as described [ , ].

    Techniques: Cell-Free Assay, Mutagenesis

    dNTP concentration dependence of single-cycle processivity of WT and mutant RTs . The DNA primer dPR was 5'-end labeled with [γ- 32 P]ATP and annealed to HIV PBS RNA. Extension was performed using a heparin trap and equivalent amounts of recombinant RTs at three different dNTP concentrations: 200 μM, 5 μM, and 2 μM. The sizes of some fragments of the 32 P-labeled 10 bp DNA ladder (Invitrogen) in nucleotide bases are shown on the left. Positions of 32 P-labeled dPR primer ( 32 P-dPR) and full-length extension product (FL DNA) are indicated on the right.

    Journal: Retrovirology

    Article Title: Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance

    doi: 10.1186/1742-4690-6-14

    Figure Lengend Snippet: dNTP concentration dependence of single-cycle processivity of WT and mutant RTs . The DNA primer dPR was 5'-end labeled with [γ- 32 P]ATP and annealed to HIV PBS RNA. Extension was performed using a heparin trap and equivalent amounts of recombinant RTs at three different dNTP concentrations: 200 μM, 5 μM, and 2 μM. The sizes of some fragments of the 32 P-labeled 10 bp DNA ladder (Invitrogen) in nucleotide bases are shown on the left. Positions of 32 P-labeled dPR primer ( 32 P-dPR) and full-length extension product (FL DNA) are indicated on the right.

    Article Snippet: Specific activity determination The RNA-dependent DNA polymerase activity of each recombinant RT preparation was assayed in duplicate using poly(rA)/p(dT)12–18 template/primer (GE Healthcare) as described [ , ].

    Techniques: Concentration Assay, Mutagenesis, Labeling, Recombinant

    Sites of collection and electron microscopy and phylogenetic analysis of the pandoravirus isolated in this work. (A) Map of Brazil showing where the samples were collected for the isolation of pandoraviruses. (B to D) Representative pictures from the areas of collection: Bom Jesus Creek (B), Mergulhão Creek (C), and the city of Bonito (D). (E) P. tropicalis particles were analyzed using scanning electron microscopy at 24 h.p.i. and an MOI of 0.01. (F, G, and H) Transmission electron microscopy (24 h.p.i./MOI 0.01) for the viral particles corresponding to the isolates of P. pampulha , P. tropicalis , and P. kadiweu , respectively. (I) Alignment of the sequences, showing that P. kadiweu and P. tropicalis represent strains of pandoraviruses with many exclusive polymorphisms (highlighted in yellow), compared to the sequences of other isolated pandoraviruses. (J) Maximum likelihood tree constructed using predicted sequence of 251 amino acids of a DNA polymerase B subunit in different isolates of pandoraviruses. The giant viruses isolated in this work are highlighted in red.

    Journal: Journal of Virology

    Article Title: New Isolates of Pandoraviruses: Contribution to the Study of Replication Cycle Steps

    doi: 10.1128/JVI.01942-18

    Figure Lengend Snippet: Sites of collection and electron microscopy and phylogenetic analysis of the pandoravirus isolated in this work. (A) Map of Brazil showing where the samples were collected for the isolation of pandoraviruses. (B to D) Representative pictures from the areas of collection: Bom Jesus Creek (B), Mergulhão Creek (C), and the city of Bonito (D). (E) P. tropicalis particles were analyzed using scanning electron microscopy at 24 h.p.i. and an MOI of 0.01. (F, G, and H) Transmission electron microscopy (24 h.p.i./MOI 0.01) for the viral particles corresponding to the isolates of P. pampulha , P. tropicalis , and P. kadiweu , respectively. (I) Alignment of the sequences, showing that P. kadiweu and P. tropicalis represent strains of pandoraviruses with many exclusive polymorphisms (highlighted in yellow), compared to the sequences of other isolated pandoraviruses. (J) Maximum likelihood tree constructed using predicted sequence of 251 amino acids of a DNA polymerase B subunit in different isolates of pandoraviruses. The giant viruses isolated in this work are highlighted in red.

    Article Snippet: A fragment of the DNA polymerase B subunit gene (from position 473404 to position 474507—reference Pandoravirus quercus ) was amplified (5′GCCCTCAAGCGGGGCCGCATG3′ and 5′CATCCACTGGGTGATCGGCGCCT3′) and sequenced, in both orientations and in duplicate, using an automated capillary sequencer (MegaBACE sequencer; GE Healthcare, Buckinghamshire, United Kingdom).

    Techniques: Electron Microscopy, Isolation, Transmission Assay, Construct, Sequencing

    DNA binding affinity of WT and G517V pol γ proteins

    Journal: Mitochondrion

    Article Title: Biochemical analysis of the G517V POLG variant reveals wild-type like activity

    doi: 10.1016/j.mito.2011.08.003

    Figure Lengend Snippet: DNA binding affinity of WT and G517V pol γ proteins

    Article Snippet: DNA polymerase activity was determined using the standard pol γ assay with poly(dA)-oligo(dT)12-18 (GE Healthcare) as the primer-template substrate ( ).

    Techniques: Binding Assay

    Amino acid alignment and three-dimensional structure of the human DNA polymerase γ holoenzyme with Gly517 highlighted

    Journal: Mitochondrion

    Article Title: Biochemical analysis of the G517V POLG variant reveals wild-type like activity

    doi: 10.1016/j.mito.2011.08.003

    Figure Lengend Snippet: Amino acid alignment and three-dimensional structure of the human DNA polymerase γ holoenzyme with Gly517 highlighted

    Article Snippet: DNA polymerase activity was determined using the standard pol γ assay with poly(dA)-oligo(dT)12-18 (GE Healthcare) as the primer-template substrate ( ).

    Techniques:

    The human genomic DNA levels were reduced by pre-treatment. Comparing the effects of different pre-treatment methods on the level of human gDNA (measured as ß-actin), in a clinical sample. A HSV1 + skin lesion-sample was pre-treated with centrifugation and filtration only, or with centrifugation, filtration and DNase treatment. The ß-actin content was measured by real-time PCR. (A) Centrifugation+filtration: Ct = 22; centrifugation+filtration+DNase treatment: Ct = 32; ΔCt = 10 which equals a 1000-fold decrease in signal. Negative control was water used as a PCR control. (B) Time-course for Phi29-amplification of pre-treated clinical sample (centrifugation+filtration+DNase) using GenomiPhi (GE Healthcare). Fold increase in signal plotted versus amplification time for HSV1 and ß-actin.

    Journal: PLoS ONE

    Article Title: The Microbial Detection Array Combined with Random Phi29-Amplification Used as a Diagnostic Tool for Virus Detection in Clinical Samples

    doi: 10.1371/journal.pone.0022631

    Figure Lengend Snippet: The human genomic DNA levels were reduced by pre-treatment. Comparing the effects of different pre-treatment methods on the level of human gDNA (measured as ß-actin), in a clinical sample. A HSV1 + skin lesion-sample was pre-treated with centrifugation and filtration only, or with centrifugation, filtration and DNase treatment. The ß-actin content was measured by real-time PCR. (A) Centrifugation+filtration: Ct = 22; centrifugation+filtration+DNase treatment: Ct = 32; ΔCt = 10 which equals a 1000-fold decrease in signal. Negative control was water used as a PCR control. (B) Time-course for Phi29-amplification of pre-treated clinical sample (centrifugation+filtration+DNase) using GenomiPhi (GE Healthcare). Fold increase in signal plotted versus amplification time for HSV1 and ß-actin.

    Article Snippet: Phi29 polymerase amplification Viral DNA was amplified by Phi29 polymerase amplification using GenomiPhi V2 Amplification kit (GE Healthcare) or Repli-g Midi kit (typical yield ∼40 µg from a 50 µl reaction, Qiagen), following manufacturer's protocols.

    Techniques: Centrifugation, Filtration, Real-time Polymerase Chain Reaction, Negative Control, Polymerase Chain Reaction, Amplification