Structured Review

TaKaRa dna polymerase i
Dna Polymerase I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase i/product/TaKaRa
Average 90 stars, based on 15 article reviews
Price from $9.99 to $1999.99
dna polymerase i - by Bioz Stars, 2020-01
90/100 stars

Images

Related Articles

Clone Assay:

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt). .. Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt).

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To generate promoter constructs for the HB-EGF gene promoter, which were located at −4138 to +205 base pair (bp), −125 to +205 bp, −178 to +205 bp, and −253 to +205 bp from its transcriptional start site (TSS), the sequences were amplified and cloned into pGL4.12 (Promega, Madison, WI). .. To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio).

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: To yield LGR5 upstream plasmids, 2000 bp of LGR5 promoter region was amplified from TIG-112 genome using the primers: 5′- CAAACTCGAGGGGTAGGAGAAGGGTGTGGG -3′ and 5′- TCATGGATCCGGTGCCCGAAGTAGGGGGCC -3′, treated with Bam HI and Xho I, and cloned into Bgl II-Xho I site of pGL4.12. .. The obtained plasmid was digested with Xho I and Sph I, subsequently treated with Klenow fragment (Takara) to create blunt end, and self-ligated.

Centrifugation:

Article Title: Unraveling the Light-Specific Metabolic and Regulatory Signatures of Rice through Combined in Silico Modeling and Multiomics Analysis
Article Snippet: For the synthesis of Cy3-labeled target DNA fragments, 1 μg of double-strand was mixed with 30 mL (1 optical density) of Cy3-9mer primers (Sigma-Aldrich) and denatured by heating at 98°C for 10 min. .. The reaction was further carried out by adding 10 µL of 50× dNTP mix (10 m m ), 8 µL of deionized water, and 2 µL of Klenow fragment (50 units mL−1 ; Takara) and incubating at 37°C for 2 h. Finally, DNA was precipitated by centrifugation at 12,000 g after adding 11.5 µL of 5 m NaCl and 110 µL of isopropanol. .. Ten milligrams of DNA was used for microarray hybridization.

Amplification:

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. The adaptor was ligated to cDNA fragments and purified to select cDNA fragments of approximately 200 bp.

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan). .. The short double-stranded DNA (dsDNA) fragments were purified using a QiaQuick PCR Extraction Kit (Qiagen, Hilden, Germany) and resolved with EB buffer for the end repair and single nucleotide A (adenine) addition.

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Spacer sequences were amplified by polymerase chain reaction (PCR) from LacZ gene using primer sets (5′-CCCGGGATCCGATCCCGTCGTTTTACAAC-3′/5′-AGATCTACCGGTCAGGCTGCGCAAC-3′ and 5′-GGATCCGCTAGCGATACACCGCATC-3′/5′-ACTAGTAGATCTCAATGGCAGATCCCAG-3′), digested and ligated between the BamHI–AgeI sites and the NheI–BglII sites of pKt-EGFP to create plasmids pKt-Sp-EGFP and pSp-Kt-EGFP, respectively. .. Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt).

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To generate promoter constructs for the HB-EGF gene promoter, which were located at −4138 to +205 base pair (bp), −125 to +205 bp, −178 to +205 bp, and −253 to +205 bp from its transcriptional start site (TSS), the sequences were amplified and cloned into pGL4.12 (Promega, Madison, WI). .. To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. The short fragments were connected with sequencing adaptors, and the desired fragments (200 ± 25 bp) were separated by agarose gel electrophoresis and purified with a Gel Extraction Kit (Axygen Biosciences, Central Avenue Union City, CA, USA).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China). .. Sequencing adapters were ligated onto the dsDNAs.

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: To yield LGR5 upstream plasmids, 2000 bp of LGR5 promoter region was amplified from TIG-112 genome using the primers: 5′- CAAACTCGAGGGGTAGGAGAAGGGTGTGGG -3′ and 5′- TCATGGATCCGGTGCCCGAAGTAGGGGGCC -3′, treated with Bam HI and Xho I, and cloned into Bgl II-Xho I site of pGL4.12. .. The obtained plasmid was digested with Xho I and Sph I, subsequently treated with Klenow fragment (Takara) to create blunt end, and self-ligated.

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa). .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.). .. These cDNA fragments then have the addition of a single “A” base and subsequent ligation of the adapter.

Reporter Assay:

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: Paragraph title: Luciferase reporter assay ... The obtained plasmid was digested with Xho I and Sph I, subsequently treated with Klenow fragment (Takara) to create blunt end, and self-ligated.

Synthesized:

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Briefly, the mRNAs were enriched using oligo (dT) magnetic beads and broken into short fragments. .. The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. The adaptor was ligated to cDNA fragments and purified to select cDNA fragments of approximately 200 bp.

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: Then, the first cDNA strand was synthesized using the mRNA fragments as templates, which was achieved by random hexamer priming. .. The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan). .. The short double-stranded DNA (dsDNA) fragments were purified using a QiaQuick PCR Extraction Kit (Qiagen, Hilden, Germany) and resolved with EB buffer for the end repair and single nucleotide A (adenine) addition.

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: An RNA Fragmentation Kit (Ambion, Austin, TX, USA) was used to cleave the mRNA into short fragments, which were then used as templates to reverse-transcribe first strand using random hexamer primers and reverse transcriptase ( http://www.takara-bio.com ) (Takara). .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. A paired-end library was synthesized using the Genomic Sample Preparation Kit (Illumina) according to the manufacturer’s instructions.

Article Title: Unraveling the Light-Specific Metabolic and Regulatory Signatures of Rice through Combined in Silico Modeling and Multiomics Analysis
Article Snippet: First-strand DNA was synthesized by adding 4 µL of 5× First-Strand Buffer, 1 µL of RiboLock RNase Inhibitor, 2 µL of 10 m m deoxynucleotide triphosphate mix, and 1 µL of RevertAid H Minus M-MuLV Reverse Tranase Enzyme and incubating at 42°C for 1 h. The reaction was stopped by heating at 70°C for 10 min. To synthesize the second strand, 66.7 µL of nuclease-free water, 5 µL of 10× reaction buffer for DNA Polymerase I (Fermentas), 5 µL of 10× T4 DNA Ligase Buffer (Takara), 3 µL of 10 units µL−1 DNA Polymersase I (Fermentas), 0.2 µL of 5 units µL−1 RNase H (Fermentas), and 0.1 µL of 350 units µL−1 T4 DNA Ligase (Takara) were added to the first-strand reaction mixture, and the reaction was proceeded at 15°C for 2 h. The double-stranded mixture was purified using the MinElute Reaction Cleanup Kit (QIAGEN). .. The reaction was further carried out by adding 10 µL of 50× dNTP mix (10 m m ), 8 µL of deionized water, and 2 µL of Klenow fragment (50 units mL−1 ; Takara) and incubating at 37°C for 2 h. Finally, DNA was precipitated by centrifugation at 12,000 g after adding 11.5 µL of 5 m NaCl and 110 µL of isopropanol.

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Fragmentation buffer was added to break the mRNA into the short fragments required as template for the synthesis of the first cDNA strand, which was achieved by random hexamer priming. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China). .. The resulting dsDNA fragments were purified using a QiaQuick PCR purification kit (Qiagen, Valencia, CA, USA) and resuspended in EB buffer for end repair and the addition of an adenine.

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Fragmentation buffer was used to obtain short mRNA fragments for use as templates to synthesize first-strand cDNAs by using random hexamer primers. .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa). .. Short fragments were purified using QiaQuick PCR extraction kit (Qiagen) and dissolved using EB buffer supplied in the kit, for end preparation and poly(A) addition.

Construct:

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: To construct a cDNA library of ToMV variants tagged with a random 10 nucleotides, the CP coding region of pTLW3 was substituted for the YFP-coding sequence containing a Bst EII restriction site directly downstream of the termination codon. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan).

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To generate promoter constructs for the HB-EGF gene promoter, which were located at −4138 to +205 base pair (bp), −125 to +205 bp, −178 to +205 bp, and −253 to +205 bp from its transcriptional start site (TSS), the sequences were amplified and cloned into pGL4.12 (Promega, Madison, WI). .. To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio).

Article Title: Relationship Between Homodimeric Glucocorticoid Receptor and Transcriptional Regulation Assessed via an In Vitro Fluorescence Correlation Spectroscopy-Microwell System
Article Snippet: The template containing GRE sequences was extended using an Alexa647-labeled common primer and a Klenow fragment (TaKaRa) at 37 °C for 30 min. After extension, exonuclease treatment was used to digest the unreacted single-strand DNA. .. Alexa647-labeled DNA was purified using an Illustra AutoSeq G-50 column (GE Healthcare).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: The mRNA-seq library was constructed using an mRNA-seq Sample Preparation Kit (Illumina Inc., Sandiego, CA, USA) following the manufacturer’s instruction. .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Real-time Polymerase Chain Reaction:

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan). .. Sequencing adapters were ligated onto dsDNAs and suitable fragments were selected for the PCR amplification.

Random Hexamer Labeling:

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Briefly, the mRNAs were enriched using oligo (dT) magnetic beads and broken into short fragments. .. The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. The adaptor was ligated to cDNA fragments and purified to select cDNA fragments of approximately 200 bp.

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: Then, the first cDNA strand was synthesized using the mRNA fragments as templates, which was achieved by random hexamer priming. .. The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: An RNA Fragmentation Kit (Ambion, Austin, TX, USA) was used to cleave the mRNA into short fragments, which were then used as templates to reverse-transcribe first strand using random hexamer primers and reverse transcriptase ( http://www.takara-bio.com ) (Takara). .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Fragmentation buffer was added to break the mRNA into the short fragments required as template for the synthesis of the first cDNA strand, which was achieved by random hexamer priming. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Fragmentation buffer was used to obtain short mRNA fragments for use as templates to synthesize first-strand cDNAs by using random hexamer primers. .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Luciferase:

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: Paragraph title: Luciferase reporter assay ... The obtained plasmid was digested with Xho I and Sph I, subsequently treated with Klenow fragment (Takara) to create blunt end, and self-ligated.

Expressing:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications. .. The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications.

Article Title: Protection of Human Colon Cells from Shiga Toxin by Plant-based Recombinant Secretory IgA
Article Snippet: Paragraph title: Construction of a secretory hybrid-IgG/IgA expression vector ... The pGEM5zf/TCAB2 was digested with Hin dIII and then blunt ends were generated with the Klenow fragment (Takara Bio, Shiga, Japan).

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. PCR products were purified and sequenced with Illumina Hiseq 2000 in Shanghai Majorbio Biopharm Technology Co. Ltd. (Shanghai, China).

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio). .. To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio).

Derivative Assay:

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: To construct pTLPYFP and pTLPCFP, the coat protein (CP) coding region of pTLW3 [ ], an infectious cDNA plasmid for ToMV, was substituted with the YFP and CFP coding sequences connected to nuclear localization signal (NLS) sequences that were derived from pJS2.NLSYFPp19 and pJS2.NLSCFPp19 [ ] (DDBJ AB499725 and AB499726, respectively). pTLPYFP-CP and pTLPCFP-CP were constructed by inserting the YFP and CFP genes, respectively, between the MP and CP genes of pTLW3. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan).

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Reporter plasmids that express enhanced green fluorescent protein (EGFP) or enhanced cyan fluorescent protein (ECFP) following engineered 5′-UTRs were derived from pKt-EGFP and pdKt-EGFP, previously described as p1-box C/D-EGFP and p1-box C/D mut-EGFP , respectively. .. Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt).

Ligation:

Article Title: Protection of Human Colon Cells from Shiga Toxin by Plant-based Recombinant Secretory IgA
Article Snippet: The resulting DNA fragments, Jc-TCAB2 and SC-TCAB1 , were ligated with Hin dIII-digested pUC19 (Invitrogen) by means of three-piece ligation, resulting in the production of pUC19/TCAB2 -Jc-SC-TCAB1 . pUC19/TCAB2 -Jc-SC-TCAB1 was digested with Sac II and then ligated with Sac II-digested PCAB , resulting in the production of the pUC19/Jc-SC expression cassette. .. The pGEM5zf/TCAB2 was digested with Hin dIII and then blunt ends were generated with the Klenow fragment (Takara Bio, Shiga, Japan).

Biomarker Assay:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications. .. All the high-throughput sequencing assay was performed using the HiSeq.

Generated:

Article Title: Protection of Human Colon Cells from Shiga Toxin by Plant-based Recombinant Secretory IgA
Article Snippet: First step was the insertion of TCAB2 into pBCH1. .. The pGEM5zf/TCAB2 was digested with Hin dIII and then blunt ends were generated with the Klenow fragment (Takara Bio, Shiga, Japan). .. The blunt-ended DNA was digested with Sac I and ligated into Sma I/Sac I-digested pBCH1, resulting in the production of pBCH1/TCAB2 .

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Sequencing libraries were generated following the specifications of the TruSeq® RNA Sample Preparation Guide V2 (Illumina). .. The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa).

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: The resultant plasmid was cleaved at the Bst EII and downstream Bss HII sites and was filled with a library of fragments containing random 10-nucleotide sequence tags. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan). .. In total, 2.5 × 105 independent colonies were obtained after transforming Escherichia coli JM109 cells using electroporation, and the cDNA library was extracted from these colonies without further amplification.

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Spacer sequences were amplified by polymerase chain reaction (PCR) from LacZ gene using primer sets (5′-CCCGGGATCCGATCCCGTCGTTTTACAAC-3′/5′-AGATCTACCGGTCAGGCTGCGCAAC-3′ and 5′-GGATCCGCTAGCGATACACCGCATC-3′/5′-ACTAGTAGATCTCAATGGCAGATCCCAG-3′), digested and ligated between the BamHI–AgeI sites and the NheI–BglII sites of pKt-EGFP to create plasmids pKt-Sp-EGFP and pSp-Kt-EGFP, respectively. .. Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt). .. The longest spacer sequence (320 nt) was generated by concatenation of the two spacer fragments described earlier in the text and inserted between the NheI–BglII sites of pKt-ECFP and pdKt-ECFP.

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio). .. Site-detected mutants of the reporter vector were constructed by inverse PCR with primers described in Table S1.

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.). .. The PCR yield was quantified by Qubit and the samples were pooled together to make a single strand DNA circle (ssDNA circle), which gave the final library.

other:

Article Title: Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome
Article Snippet: A fragment containing MxA gene was prepared from pET14b-MxA by digestion with NdeI followed by treatment with Klenow fragment and digestion with BamHI.

DNA Sequencing:

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio). .. Site-detected mutants of the reporter vector were constructed by inverse PCR with primers described in Table S1.

Sequencing:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: Paragraph title: RNA extraction and high-throughput sequencing ... The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications.

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Paragraph title: RNA isolation, sequencing and analysis ... The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa).

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: Paragraph title: 4.4. RNA Extraction, cDNA Library Construction and Sequencing ... The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: The resultant plasmid was cleaved at the Bst EII and downstream Bss HII sites and was filled with a library of fragments containing random 10-nucleotide sequence tags. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan).

Article Title: Relationship Between Homodimeric Glucocorticoid Receptor and Transcriptional Regulation Assessed via an In Vitro Fluorescence Correlation Spectroscopy-Microwell System
Article Snippet: The template containing GRE sequences was extended using an Alexa647-labeled common primer and a Klenow fragment (TaKaRa) at 37 °C for 30 min. After extension, exonuclease treatment was used to digest the unreacted single-strand DNA. .. Alexa647-labeled DNA was purified using an Illustra AutoSeq G-50 column (GE Healthcare).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Paragraph title: Total RNA isolation, cDNA library construction and sequencing ... Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Paragraph title: RNA extraction, cDNA library construction and Illumina sequencing ... The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa). .. Short fragments were purified using QiaQuick PCR extraction kit (Qiagen) and dissolved using EB buffer supplied in the kit, for end preparation and poly(A) addition.

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.). .. The PCR yield was quantified by Qubit and the samples were pooled together to make a single strand DNA circle (ssDNA circle), which gave the final library.

Recombinant:

Article Title: Translesional DNA Synthesis through a C8-Guanyl Adduct of 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) in Vitro
Article Snippet: Human recombinant DNA polymerases, pol δ, pol η, pol κ, and REV1, and PCNA were expressed and purified as described previously ( – ). .. E. coli DNA polymerases I (Takara Biotech) and Klenow Fragment (Takara Biotech), and thermophilic bacterial DNA polymerases, r Taq (Toyobo Biochem) and Tth (Toyobo Biochem) were used.

Nucleic Acid Electrophoresis:

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: The quality and quantity of total RNA were analyzed using a Thermo Scientific Multiskan GO (Thermo Scientific Multiskan GO, www.thermoscientific.com ), gel electrophoresis, and Agilent G2939A (Agilent RNA 6000 Nano Kit). .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

RNA Sequencing Assay:

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Paragraph title: RNA extraction, library preparation, and RNA-seq ... Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Magnetic Beads:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: Next, RNase-free DNase I (Takara, Dalian, China) was used to remove the contaminating DNA, and oligo (dT) coated magnetic beads was mixed to separate the poly (A) fraction. .. The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications.

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Briefly, the mRNAs were enriched using oligo (dT) magnetic beads and broken into short fragments. .. The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: The poly-(A) mRNA was isolated from the total RNA samples with poly-T oligo-attached magnetic beads. .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: A 30 μg pool of RNA formed by combining 10 μg from each biological replicate was subjected to RNase-free DNase I (Takara, Dalian, China) treatment to remove contaminating DNA, and mixed with oligo (dT) coated magnetic beads to separate the poly A fraction. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: The first step in the workflow involves purifying the poly-A containing mRNA molecules using poly-T oligo-attached magnetic beads. .. This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.).

Isolation:

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Paragraph title: RNA isolation, sequencing and analysis ... The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Paragraph title: Total RNA isolation, cDNA library construction and sequencing ... Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Unraveling the Light-Specific Metabolic and Regulatory Signatures of Rice through Combined in Silico Modeling and Multiomics Analysis
Article Snippet: Paragraph title: RNA Isolation and Labeling of Probes ... The reaction was further carried out by adding 10 µL of 50× dNTP mix (10 m m ), 8 µL of deionized water, and 2 µL of Klenow fragment (50 units mL−1 ; Takara) and incubating at 37°C for 2 h. Finally, DNA was precipitated by centrifugation at 12,000 g after adding 11.5 µL of 5 m NaCl and 110 µL of isopropanol.

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: RNA was extracted using a Total RNA Isolation System (Takara, Kyoto, Japan) following the manufacturer’s protocol. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Polymerase Chain Reaction:

Article Title: Protection of Human Colon Cells from Shiga Toxin by Plant-based Recombinant Secretory IgA
Article Snippet: To subclone mouse SC cDNA, PCR was performed using pcDNA3.1/mouse SC as a template, and SC-specific SCF-Xho and SCR-Xba as primers. .. The pGEM5zf/TCAB2 was digested with Hin dIII and then blunt ends were generated with the Klenow fragment (Takara Bio, Shiga, Japan).

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. The adaptor was ligated to cDNA fragments and purified to select cDNA fragments of approximately 200 bp.

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan). .. The short double-stranded DNA (dsDNA) fragments were purified using a QiaQuick PCR Extraction Kit (Qiagen, Hilden, Germany) and resolved with EB buffer for the end repair and single nucleotide A (adenine) addition.

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Spacer sequences were amplified by polymerase chain reaction (PCR) from LacZ gene using primer sets (5′-CCCGGGATCCGATCCCGTCGTTTTACAAC-3′/5′-AGATCTACCGGTCAGGCTGCGCAAC-3′ and 5′-GGATCCGCTAGCGATACACCGCATC-3′/5′-ACTAGTAGATCTCAATGGCAGATCCCAG-3′), digested and ligated between the BamHI–AgeI sites and the NheI–BglII sites of pKt-EGFP to create plasmids pKt-Sp-EGFP and pSp-Kt-EGFP, respectively. .. Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt).

Article Title: Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma
Article Snippet: The primers used for these PCR assays are listed in Table S1. .. To create pGL/HB−2585/+205 and pGL/HB−454/+205 , pGL/HB−4138/+205 was digested with Nde I and Kpn I or Ase I and Kpn I, and self-ligation was performed after blunt-ended treatment with Klenow fragment (Takara Bio).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China). .. Sequencing adapters were ligated onto the dsDNAs.

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa). .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.). .. These cDNA fragments then have the addition of a single “A” base and subsequent ligation of the adapter.

Labeling:

Article Title: Unraveling the Light-Specific Metabolic and Regulatory Signatures of Rice through Combined in Silico Modeling and Multiomics Analysis
Article Snippet: Paragraph title: RNA Isolation and Labeling of Probes ... The reaction was further carried out by adding 10 µL of 50× dNTP mix (10 m m ), 8 µL of deionized water, and 2 µL of Klenow fragment (50 units mL−1 ; Takara) and incubating at 37°C for 2 h. Finally, DNA was precipitated by centrifugation at 12,000 g after adding 11.5 µL of 5 m NaCl and 110 µL of isopropanol.

Purification:

Article Title: Translesional DNA Synthesis through a C8-Guanyl Adduct of 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) in Vitro
Article Snippet: Human recombinant DNA polymerases, pol δ, pol η, pol κ, and REV1, and PCNA were expressed and purified as described previously ( – ). .. E. coli DNA polymerases I (Takara Biotech) and Klenow Fragment (Takara Biotech), and thermophilic bacterial DNA polymerases, r Taq (Toyobo Biochem) and Tth (Toyobo Biochem) were used.

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa). .. PCR amplification was performed with size-selected and adaptor-ligated cDNA with Pfu High-Fidelity DNA Polymerase.

Article Title: Construction of a cDNA library and preliminary analysis of the expressed sequence tags of the earthworm Eisenia fetida (Savigny, 1826)
Article Snippet: The purified mRNA was used as a template, Oligod(T)18 with XhoI cleavage site was used as the primer, and first strand cDNA was transcribed at 42°C using SuperScript™ II RnaseH-Reverse (Thermo Fisher Scientific, Inc.). .. The first cDNA chain was used as a template for double-stranded cDNA synthesis, using DNA Polymerase I (Takara Biotechnology Co., Ltd., Beijing, China).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Unraveling the Light-Specific Metabolic and Regulatory Signatures of Rice through Combined in Silico Modeling and Multiomics Analysis
Article Snippet: First-strand DNA was synthesized by adding 4 µL of 5× First-Strand Buffer, 1 µL of RiboLock RNase Inhibitor, 2 µL of 10 m m deoxynucleotide triphosphate mix, and 1 µL of RevertAid H Minus M-MuLV Reverse Tranase Enzyme and incubating at 42°C for 1 h. The reaction was stopped by heating at 70°C for 10 min. To synthesize the second strand, 66.7 µL of nuclease-free water, 5 µL of 10× reaction buffer for DNA Polymerase I (Fermentas), 5 µL of 10× T4 DNA Ligase Buffer (Takara), 3 µL of 10 units µL−1 DNA Polymersase I (Fermentas), 0.2 µL of 5 units µL−1 RNase H (Fermentas), and 0.1 µL of 350 units µL−1 T4 DNA Ligase (Takara) were added to the first-strand reaction mixture, and the reaction was proceeded at 15°C for 2 h. The double-stranded mixture was purified using the MinElute Reaction Cleanup Kit (QIAGEN). .. The reaction was further carried out by adding 10 µL of 50× dNTP mix (10 m m ), 8 µL of deionized water, and 2 µL of Klenow fragment (50 units mL−1 ; Takara) and incubating at 37°C for 2 h. Finally, DNA was precipitated by centrifugation at 12,000 g after adding 11.5 µL of 5 m NaCl and 110 µL of isopropanol.

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: Following purification, the mRNA is fragmented into small pieces using divalent cations under elevated temperature. .. This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: Next, RNase-free DNase I (Takara, Dalian, China) was used to remove the contaminating DNA, and oligo (dT) coated magnetic beads was mixed to separate the poly (A) fraction. .. The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications. .. The reaction mixture was subjected to polyacrylamide gel electrophoresis (PAGE) and the suitable fragments were isolated and purified.

cDNA Library Assay:

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: Paragraph title: 4.4. RNA Extraction, cDNA Library Construction and Sequencing ... The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Construction of a cDNA library and preliminary analysis of the expressed sequence tags of the earthworm Eisenia fetida (Savigny, 1826)
Article Snippet: Paragraph title: cDNA library construction ... The first cDNA chain was used as a template for double-stranded cDNA synthesis, using DNA Polymerase I (Takara Biotechnology Co., Ltd., Beijing, China).

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: To construct a cDNA library of ToMV variants tagged with a random 10 nucleotides, the CP coding region of pTLW3 was substituted for the YFP-coding sequence containing a Bst EII restriction site directly downstream of the termination codon. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Paragraph title: Total RNA isolation, cDNA library construction and sequencing ... Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Paragraph title: RNA extraction, cDNA library construction and Illumina sequencing ... The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Sample Prep:

Article Title: Dynamic transcriptome and phytohormone profiling along the time of light exposure in the mesocotyl of rice seedling
Article Snippet: Sequencing libraries were generated following the specifications of the TruSeq® RNA Sample Preparation Guide V2 (Illumina). .. The cDNA was synthesized using random hexamer primer, M-MuLV Reverse Transcriptase and DNA polymerase I (TaKaRa).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: The mRNA-seq library was constructed using an mRNA-seq Sample Preparation Kit (Illumina Inc., Sandiego, CA, USA) following the manufacturer’s instruction. .. Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara).

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Library preparation was performed according to TruSeq RNA Sample Preparation v2 guide (Illumina). .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Chromatin Immunoprecipitation:

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Its quality and quantity were assessed with either a 2100 Bioanalyzer RNA Nano chip device (Agilent, Santa Clara, CA, USA) or a Nanodrop ND-430 1000 spectrophotometer (Agilent, Santa Clara, CA, USA), and only samples delivering a λ260/280 ratio of 1.8–2.1, a λ260/230 ratio of 2.0–2.5 and an RNA integrity number > 8.0 were retained. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Plasmid Preparation:

Article Title: Protection of Human Colon Cells from Shiga Toxin by Plant-based Recombinant Secretory IgA
Article Snippet: Paragraph title: Construction of a secretory hybrid-IgG/IgA expression vector ... The pGEM5zf/TCAB2 was digested with Hin dIII and then blunt ends were generated with the Klenow fragment (Takara Bio, Shiga, Japan).

Article Title: Viruses Roll the Dice: The Stochastic Behavior of Viral Genome Molecules Accelerates Viral Adaptation at the Cell and Tissue LevelsViral Cell-to-Cell Transmission—Why Less Is More
Article Snippet: The resultant plasmid was cleaved at the Bst EII and downstream Bss HII sites and was filled with a library of fragments containing random 10-nucleotide sequence tags. .. The tags were generated by annealing two oligo DNA fragments (To14 and To15) and then synthesizing the complementary strands using the Klenow fragment (TaKaRa Bio, Ohtsu, Japan).

Article Title: Quantitative and simultaneous translational control of distinct mammalian mRNAs
Article Snippet: Paragraph title: Plasmid constructions ... Similarly, pdKt-Sp-EGFP and pSp-dKt-EGFP were generated from pdKt-EGFP. pKt-ECFP and pdKt-ECFP were digested with NheI and BamHI, blunted by Klenow fragment (Takara Bio, Otsu, Japan) and self-ligated to create the shortest 5′-UTR (18 nt).

Article Title: Tandem repeats of the 5′ flanking region of human MUC5AC have a role as a novel enhancer in MUC5AC gene expression
Article Snippet: To yield LGR5 upstream plasmids, 2000 bp of LGR5 promoter region was amplified from TIG-112 genome using the primers: 5′- CAAACTCGAGGGGTAGGAGAAGGGTGTGGG -3′ and 5′- TCATGGATCCGGTGCCCGAAGTAGGGGGCC -3′, treated with Bam HI and Xho I, and cloned into Bgl II-Xho I site of pGL4.12. .. The obtained plasmid was digested with Xho I and Sph I, subsequently treated with Klenow fragment (Takara) to create blunt end, and self-ligated. .. The resulting plasmid, which contains LGR5 upstream 1155 bp was named pGL4.12-Lgr5up1155bp.

RNA Extraction:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: Paragraph title: RNA extraction and high-throughput sequencing ... The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications.

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: Paragraph title: 4.4. RNA Extraction, cDNA Library Construction and Sequencing ... The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Paragraph title: RNA extraction, cDNA library construction and Illumina sequencing ... The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Paragraph title: RNA extraction, library preparation, and RNA-seq ... Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

Binding Assay:

Article Title: Relationship Between Homodimeric Glucocorticoid Receptor and Transcriptional Regulation Assessed via an In Vitro Fluorescence Correlation Spectroscopy-Microwell System
Article Snippet: Paragraph title: Synthesis of Alexa647-labeled GRE for calculation of the in vitro dissociation constant of DNA binding by using FCCS measure ment ... The template containing GRE sequences was extended using an Alexa647-labeled common primer and a Klenow fragment (TaKaRa) at 37 °C for 30 min. After extension, exonuclease treatment was used to digest the unreacted single-strand DNA.

Agarose Gel Electrophoresis:

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. Short fragments were purified with the MinElute PCR Purification Kit (QIAGEN, Dusseldorf, Germany) and eluted in 10 µL of EB buffer (QIAGEN).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China). .. Sequencing adapters were ligated onto the dsDNAs.

Article Title: Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.
Article Snippet: Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa). .. Second-strand cDNAs were synthesized using DNA polymerase I (TaKaRa).

In Vitro:

Article Title: Relationship Between Homodimeric Glucocorticoid Receptor and Transcriptional Regulation Assessed via an In Vitro Fluorescence Correlation Spectroscopy-Microwell System
Article Snippet: Paragraph title: Synthesis of Alexa647-labeled GRE for calculation of the in vitro dissociation constant of DNA binding by using FCCS measure ment ... The template containing GRE sequences was extended using an Alexa647-labeled common primer and a Klenow fragment (TaKaRa) at 37 °C for 30 min. After extension, exonuclease treatment was used to digest the unreacted single-strand DNA.

Incubation:

Article Title: Human CTF18-RFC clamp-loader complexed with non-synthesising DNA polymerase ε efficiently loads the PCNA sliding clamp
Article Snippet: Photo-crosslinking oligonucleotide substrate labelled at a fixed position on the template strand was prepared by extension of RF64 on BTN3; 300 pmol of RF64 primer was annealed with 150 pmol of biotinylated BTN3 90-mer and bound to 5 μl of streptavidin agarose ultra-performance beads. .. The DNA beads were incubated in a 25 μl of Klenow reaction mixture with 4 μM [α-32 P] TTP, 24 μM α-S-dCTP and 2 units of Klenow fragment at 10°C for 30 min. After three washes with BW buffer and one wash with TE, the attached RF64 was completely elongated with 250 μM dNTP and 2 units of Klenow fragment at 10°C for 30 min in a 20 μl Klenow reaction mixture. .. Free nucleotides and proteins were removed by two washes with BW buffer; then the elongated RF64 strand was eluted twice with 50 μl of 0.1 M NaOH.

Spectrophotometry:

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: The quality and concentration of each RNA sample were verified using an ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE, USA), and only RNA samples delivering the OD260/280 ratio of 1.8–2.1 and the OD260/230 ratio > 1.8 were retained. .. The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum
Article Snippet: Its quality and quantity were assessed with either a 2100 Bioanalyzer RNA Nano chip device (Agilent, Santa Clara, CA, USA) or a Nanodrop ND-430 1000 spectrophotometer (Agilent, Santa Clara, CA, USA), and only samples delivering a λ260/280 ratio of 1.8–2.1, a λ260/230 ratio of 2.0–2.5 and an RNA integrity number > 8.0 were retained. .. The second cDNA strand was synthesized by a reaction driven by DNA polymerase I (Takara, Dalian, China).

Concentration Assay:

Article Title: Comparative Transcriptome Analysis of Waterlogging-Sensitive and Waterlogging-Tolerant Chrysanthemum morifolium Cultivars under Waterlogging Stress and Reoxygenation Conditions
Article Snippet: The quality and concentration of each RNA sample were verified using an ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE, USA), and only RNA samples delivering the OD260/280 ratio of 1.8–2.1 and the OD260/230 ratio > 1.8 were retained. .. The second cDNA strand was synthesized by a reaction that was driven by DNA polymerase I (TaKaRa Bio, Tokyo, Japan).

Article Title: Tolerance of Transplastomic Tobacco Plants Overexpressing a Theta Class Glutathione Transferase to Abiotic and Oxidative Stresses
Article Snippet: Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) was used for the total RNA sample QC: RNA concentration, RIN value, 28S/18S and the fragment length distribution. .. This is followed by second strand cDNA synthesis using DNA Polymerase I and RNase H (Takara Bio Inc.).

High Throughput Screening Assay:

Article Title: Transcriptome analysis of differentially expressed unigenes involved in flavonoid biosynthesis during flower development of Chrysanthemum morifolium ‘Chuju’
Article Snippet: Paragraph title: RNA extraction and high-throughput sequencing ... The obtained mRNA molecules were sequentially broken into short fragments and converted to cDNA by DNA polymerase I (Takara, Dalian, China) through the reverse transcription polymerase chain reaction (RT-PCR) amplifications.

Gel Extraction:

Article Title: Construction of a cDNA library and preliminary analysis of the expressed sequence tags of the earthworm Eisenia fetida (Savigny, 1826)
Article Snippet: The first cDNA chain was used as a template for double-stranded cDNA synthesis, using DNA Polymerase I (Takara Biotechnology Co., Ltd., Beijing, China). .. The first cDNA chain was used as a template for double-stranded cDNA synthesis, using DNA Polymerase I (Takara Biotechnology Co., Ltd., Beijing, China).

Article Title: Deep sequencing reveals transcriptome re-programming of Polygonum multiflorum thunb. roots to the elicitation with methyl jasmonate
Article Snippet: Second-strand cDNA was synthesized in a reaction containing buffer, dNTPs, RNase H and DNA polymerase I (Takara). .. Short fragments were purified with the MinElute PCR Purification Kit (QIAGEN, Dusseldorf, Germany) and eluted in 10 µL of EB buffer (QIAGEN).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa klenow fragment
    The effect of transiently expressed nuclear <t>MxA</t> proteins. ( A ) The effect of nuclear MxA proteins in Swiss3T3 cells. The cells were transfected with pHMP1-vNS-Luc (0.2 µg), pSEAP2-control (0.1 µg), plasmids encoding three RNA polymerase subunits and NP (0.05 µg of each plasmid) and either parental vector, pVP16-MxA or pHMG-TMxA (0.3 µg each). Luciferase activity was determined and shown as described in Materials and Methods. Error bars represent standard deviation (n = 3). ( B ) Dose-dependent effect of wild-type MxA and VP16-MxA. The same procedure for (A) was carried out in the presence of increasing amounts of wild-type MxA or VP16-MxA. Error bars represent standard deviation (n = 3). ( C ) The effect of C-terminal (MxAΔC) and internal (MxAΔM) deletion VP16-MxA mutant proteins on reporter gene expression. The same procedure for (A) was carried out with mutant MxA proteins. To generate a VP16-MxA deletion mutant (MxAΔC) for expression of MxA lacking its C-terminal region (362–662), we amplified a fragment by PCR with specific primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATCGCA-3′ and 5′-CGCGGATCCTTAACCATACTTTTGTAGCTCCTCTGT-3′ and pVP16-MxA as template. To generate a VP16-MxA deletion mutant (MxAΔM) lacking its internal region (362–573), a fragment was amplified by PCR with primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATC GCA-3′ and 5′-CGCGGATCCTTAACCGGGGAACTGGGCAAGCCGGCG-3′ and pCHA-MxAΔM plasmid as a template. pCHA-MxAΔM was derived from previously constructed plasmid, pCHA-MxA by removal of an internal part of MxA by digestion with SalI (TOYOBO) and NcoI (TOYOBO) restriction enzymes. The main part of the plasmid was blunted with <t>Klenow</t> fragment and self-ligated. MxA fragments thus prepared were digested with NdeI, blunted with Klenow fragment and then digested with BamHI. These fragments were cloned into pVP16 plasmid digested with EcoRI followed by Klenow treatment and subsequent digestion with BamHI. Error bars represent standard deviation (n = 3).
    Klenow Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klenow fragment/product/TaKaRa
    Average 90 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    klenow fragment - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    75
    TaKaRa escherichia coli
    Cytokine release induced by naked plasmid DNA (pDNA) or other DNAs from macrophage (Mφ) cell lines. RAW264.7 cells (a) or J774A1 cells (b) were incubated with lipopolysaccharide (LPS) (white bar), <t>Escherichia</t> coli ( E. coli ) DNA (black bar), pDNA
    Escherichia Coli, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/TaKaRa
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-01
    75/100 stars
      Buy from Supplier

    Image Search Results


    The effect of transiently expressed nuclear MxA proteins. ( A ) The effect of nuclear MxA proteins in Swiss3T3 cells. The cells were transfected with pHMP1-vNS-Luc (0.2 µg), pSEAP2-control (0.1 µg), plasmids encoding three RNA polymerase subunits and NP (0.05 µg of each plasmid) and either parental vector, pVP16-MxA or pHMG-TMxA (0.3 µg each). Luciferase activity was determined and shown as described in Materials and Methods. Error bars represent standard deviation (n = 3). ( B ) Dose-dependent effect of wild-type MxA and VP16-MxA. The same procedure for (A) was carried out in the presence of increasing amounts of wild-type MxA or VP16-MxA. Error bars represent standard deviation (n = 3). ( C ) The effect of C-terminal (MxAΔC) and internal (MxAΔM) deletion VP16-MxA mutant proteins on reporter gene expression. The same procedure for (A) was carried out with mutant MxA proteins. To generate a VP16-MxA deletion mutant (MxAΔC) for expression of MxA lacking its C-terminal region (362–662), we amplified a fragment by PCR with specific primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATCGCA-3′ and 5′-CGCGGATCCTTAACCATACTTTTGTAGCTCCTCTGT-3′ and pVP16-MxA as template. To generate a VP16-MxA deletion mutant (MxAΔM) lacking its internal region (362–573), a fragment was amplified by PCR with primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATC GCA-3′ and 5′-CGCGGATCCTTAACCGGGGAACTGGGCAAGCCGGCG-3′ and pCHA-MxAΔM plasmid as a template. pCHA-MxAΔM was derived from previously constructed plasmid, pCHA-MxA by removal of an internal part of MxA by digestion with SalI (TOYOBO) and NcoI (TOYOBO) restriction enzymes. The main part of the plasmid was blunted with Klenow fragment and self-ligated. MxA fragments thus prepared were digested with NdeI, blunted with Klenow fragment and then digested with BamHI. These fragments were cloned into pVP16 plasmid digested with EcoRI followed by Klenow treatment and subsequent digestion with BamHI. Error bars represent standard deviation (n = 3).

    Journal:

    Article Title: Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome

    doi: 10.1093/nar/gkh192

    Figure Lengend Snippet: The effect of transiently expressed nuclear MxA proteins. ( A ) The effect of nuclear MxA proteins in Swiss3T3 cells. The cells were transfected with pHMP1-vNS-Luc (0.2 µg), pSEAP2-control (0.1 µg), plasmids encoding three RNA polymerase subunits and NP (0.05 µg of each plasmid) and either parental vector, pVP16-MxA or pHMG-TMxA (0.3 µg each). Luciferase activity was determined and shown as described in Materials and Methods. Error bars represent standard deviation (n = 3). ( B ) Dose-dependent effect of wild-type MxA and VP16-MxA. The same procedure for (A) was carried out in the presence of increasing amounts of wild-type MxA or VP16-MxA. Error bars represent standard deviation (n = 3). ( C ) The effect of C-terminal (MxAΔC) and internal (MxAΔM) deletion VP16-MxA mutant proteins on reporter gene expression. The same procedure for (A) was carried out with mutant MxA proteins. To generate a VP16-MxA deletion mutant (MxAΔC) for expression of MxA lacking its C-terminal region (362–662), we amplified a fragment by PCR with specific primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATCGCA-3′ and 5′-CGCGGATCCTTAACCATACTTTTGTAGCTCCTCTGT-3′ and pVP16-MxA as template. To generate a VP16-MxA deletion mutant (MxAΔM) lacking its internal region (362–573), a fragment was amplified by PCR with primers, 5′-GGCATCCATATGGTTGTTTCCGAAGTGGACATC GCA-3′ and 5′-CGCGGATCCTTAACCGGGGAACTGGGCAAGCCGGCG-3′ and pCHA-MxAΔM plasmid as a template. pCHA-MxAΔM was derived from previously constructed plasmid, pCHA-MxA by removal of an internal part of MxA by digestion with SalI (TOYOBO) and NcoI (TOYOBO) restriction enzymes. The main part of the plasmid was blunted with Klenow fragment and self-ligated. MxA fragments thus prepared were digested with NdeI, blunted with Klenow fragment and then digested with BamHI. These fragments were cloned into pVP16 plasmid digested with EcoRI followed by Klenow treatment and subsequent digestion with BamHI. Error bars represent standard deviation (n = 3).

    Article Snippet: A fragment containing MxA gene was prepared from pET14b-MxA by digestion with NdeI followed by treatment with Klenow fragment and digestion with BamHI.

    Techniques: Transfection, Plasmid Preparation, Luciferase, Activity Assay, Standard Deviation, Mutagenesis, Expressing, Amplification, Polymerase Chain Reaction, Derivative Assay, Construct, Clone Assay

    Cytokine release induced by naked plasmid DNA (pDNA) or other DNAs from macrophage (Mφ) cell lines. RAW264.7 cells (a) or J774A1 cells (b) were incubated with lipopolysaccharide (LPS) (white bar), Escherichia coli ( E. coli ) DNA (black bar), pDNA

    Journal:

    Article Title: Restricted cytokine production from mouse peritoneal macrophages in culture in spite of extensive uptake of plasmid DNA

    doi: 10.1111/j.1365-2567.2004.01814.x

    Figure Lengend Snippet: Cytokine release induced by naked plasmid DNA (pDNA) or other DNAs from macrophage (Mφ) cell lines. RAW264.7 cells (a) or J774A1 cells (b) were incubated with lipopolysaccharide (LPS) (white bar), Escherichia coli ( E. coli ) DNA (black bar), pDNA

    Article Snippet: The reaction was initiated by adding 4 U of Escherichia coli ( E. coli ) DNA Polymerase I (Takara, Kyoto, Japan) and 0·0004 U of DNAse I (Takara) in the presence of 40 n m unlabelled triphosphate (dATP, dGTP, dTTP) and [α-32 P]dCTP (3·7 MBq, 100 µCi).

    Techniques: Plasmid Preparation, Incubation

    Cytokine release induced by naked plasmid DNA (pDNA) or other DNAs from primary cultured macrophages (Mφs). Resident Mφs (a) or elicited Mφs (b) were incubated with lipopolysaccharide (LPS), Escherichia coli ( E. coli ) DNA, pDNA,

    Journal:

    Article Title: Restricted cytokine production from mouse peritoneal macrophages in culture in spite of extensive uptake of plasmid DNA

    doi: 10.1111/j.1365-2567.2004.01814.x

    Figure Lengend Snippet: Cytokine release induced by naked plasmid DNA (pDNA) or other DNAs from primary cultured macrophages (Mφs). Resident Mφs (a) or elicited Mφs (b) were incubated with lipopolysaccharide (LPS), Escherichia coli ( E. coli ) DNA, pDNA,

    Article Snippet: The reaction was initiated by adding 4 U of Escherichia coli ( E. coli ) DNA Polymerase I (Takara, Kyoto, Japan) and 0·0004 U of DNAse I (Takara) in the presence of 40 n m unlabelled triphosphate (dATP, dGTP, dTTP) and [α-32 P]dCTP (3·7 MBq, 100 µCi).

    Techniques: Plasmid Preparation, Cell Culture, Incubation