dna polymerase i klenow fragment (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Name:

DNA Polymerase I Klenow Fragment

Description:

DNA Polymerase I Klenow Fragment 1 000 units

Catalog Number:

m0210l

Price:

248

Size:

1 000 units

Category:

DNA Polymerases

Buy from Supplier

Structured Review

New England Biolabs dna polymerase i klenow fragment

DNA Polymerase I Klenow Fragment 1 000 units
https://www.bioz.com/result/dna polymerase i klenow fragment/product/New England Biolabs
Average 95 stars, based on 9 article reviews
Price from $9.99 to $1999.99

dna polymerase i klenow fragment - by Bioz Stars, 2020-02

95/100 stars

Related Products / Commonly Used Together

t4 dna polymerase
dna polymerase
t4 polynucleotide
t4 polynucleotide kinase
t4 dna
dttp
deoxynucleotide
dntps
dntp mix
datp
nacl (5
biotin-14-dctp
dctp
t4 dna ligase
t4

Images

1) Product Images from "Characterization of a novel DNA polymerase activity assay enabling sensitive, quantitative and universal detection of viable microbes"

Article Title: Characterization of a novel DNA polymerase activity assay enabling sensitive, quantitative and universal detection of viable microbes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gks316

Sensitive detection of purified DNA polymerase using DPE-PCR. ( A ) A commercial source of DNA polymerase I was assayed in duplicate at 10-fold increments starting at 2 × 10 −5 U down to 2 × 10 −11 U per reaction. A representative DPE-PCR curve is shown for each polymerase input level and NIC. ( B ) A plot was constructed from n = 4 data points per polymerase input level, taken from two independent experiments and linear regression analysis was performed. ( C ) Triplicate reactions containing 2 × 10 −7 U of DNA polymerase I, Klenow, Klenow (exo−) and E. coli DNA Ligase were assayed in comparison to an NIC. A representative DPE-PCR curve is presented for each of the assayed enzymes and NIC. ( D ) Triplicate DPE-PCR curves are shown from corresponding DPE reactions containing a 50 -µM (dATP, dGTP, dTTP) mixture supplemented with 50 µM of either dCTP or ddCTP. A schematic representing some of the first available sites for dCTP or ddCTP incorporation within the DNA substrate is presented adjacent to the DPE-PCR curves.

Figure Legend Snippet: Sensitive detection of purified DNA polymerase using DPE-PCR. ( A ) A commercial source of DNA polymerase I was assayed in duplicate at 10-fold increments starting at 2 × 10 −5 U down to 2 × 10 −11 U per reaction. A representative DPE-PCR curve is shown for each polymerase input level and NIC. ( B ) A plot was constructed from n = 4 data points per polymerase input level, taken from two independent experiments and linear regression analysis was performed. ( C ) Triplicate reactions containing 2 × 10 −7 U of DNA polymerase I, Klenow, Klenow (exo−) and E. coli DNA Ligase were assayed in comparison to an NIC. A representative DPE-PCR curve is presented for each of the assayed enzymes and NIC. ( D ) Triplicate DPE-PCR curves are shown from corresponding DPE reactions containing a 50 -µM (dATP, dGTP, dTTP) mixture supplemented with 50 µM of either dCTP or ddCTP. A schematic representing some of the first available sites for dCTP or ddCTP incorporation within the DNA substrate is presented adjacent to the DPE-PCR curves.

Techniques Used: Purification, Polymerase Chain Reaction, Construct

2) Product Images from "Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer"

Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer

Journal: Journal of Bacteriology

doi: 10.1128/JB.00787-16

In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

Figure Legend Snippet: In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

Techniques Used: In Vitro, Activity Assay, Incubation, Labeling

3) Product Images from "Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction"

Article Title: Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction

Journal: DNA repair

doi: 10.1016/j.dnarep.2016.05.017

Comparison effects of Mg 2+ concentration on the activity of polα-prim and the Klenow fragment on the template with random sequence Sequence of the 3’ portion of the template 73b (excludes the 5’ primer-binding region) that can potentially form two hairpins (marked by * and **) is shown. The extension of hetero-DNA primers annealed with the template contains a heterogeneous sequence (73b) by polα-prim (enzyme to primer/template ratio = 1:15) and the Klenow fragment (enzyme to primer/template ratio = 1: 5) in the absence or presence of 0.2–16.0 mM Mg 2+ . Reactions were carried out at 35 °C for three minutes (polα-prim) and one minute (Klenow fragment).

Figure Legend Snippet: Comparison effects of Mg 2+ concentration on the activity of polα-prim and the Klenow fragment on the template with random sequence Sequence of the 3’ portion of the template 73b (excludes the 5’ primer-binding region) that can potentially form two hairpins (marked by * and **) is shown. The extension of hetero-DNA primers annealed with the template contains a heterogeneous sequence (73b) by polα-prim (enzyme to primer/template ratio = 1:15) and the Klenow fragment (enzyme to primer/template ratio = 1: 5) in the absence or presence of 0.2–16.0 mM Mg 2+ . Reactions were carried out at 35 °C for three minutes (polα-prim) and one minute (Klenow fragment).

Techniques Used: Concentration Assay, Activity Assay, Sequencing, Binding Assay

Comparison of the effects of Zn 2+ alone and in combination with Mg 2+ on DNA synthesis by polα-prim and the Klenow fragment (A) Extension of hetero-DNA primers annealed with heterogeneous 73b template by polα-prim (enzyme to primer/template ratio = 1:10) and (B) the Klenow fragment. (enzyme to primer/template ratio = 1:5). Lanes 2–9, polα-prim for one minute; Lanes 10–17, polα-prim for eight minutes; Lanes 18–25, the Klenow fragment for one minute; all with 100 µM dNTP at 35 °C. Reactions contained no enzyme (lane 1), no additional Me 2+ (lanes 2, 10, 18), 8 mM Mg 2+ (lanes 3, 11, 19), 10 to 50 µM Zn 2+ (lanes 4–6, 12–14, 20–22), and 8 mM Mg 2+ with 10 to 50 µM Zn 2+ (lanes 7–9, 15–17, 23–25).

Figure Legend Snippet: Comparison of the effects of Zn 2+ alone and in combination with Mg 2+ on DNA synthesis by polα-prim and the Klenow fragment (A) Extension of hetero-DNA primers annealed with heterogeneous 73b template by polα-prim (enzyme to primer/template ratio = 1:10) and (B) the Klenow fragment. (enzyme to primer/template ratio = 1:5). Lanes 2–9, polα-prim for one minute; Lanes 10–17, polα-prim for eight minutes; Lanes 18–25, the Klenow fragment for one minute; all with 100 µM dNTP at 35 °C. Reactions contained no enzyme (lane 1), no additional Me 2+ (lanes 2, 10, 18), 8 mM Mg 2+ (lanes 3, 11, 19), 10 to 50 µM Zn 2+ (lanes 4–6, 12–14, 20–22), and 8 mM Mg 2+ with 10 to 50 µM Zn 2+ (lanes 7–9, 15–17, 23–25).

Techniques Used: DNA Synthesis

Transduction:

Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
Article Snippet: Paragraph title: HDAC3 viral transduction. ... The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

Amplification:

Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
Article Snippet: Briefly, 167 bp long fragment of α-Man promoter upstream of ATG of gene was PCR amplified by using primers listed in Supplementary Table . .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
Article Snippet: Briefly, a 200bp β-Hex promoter fragment upstream of ATG was PCR amplified using primers listed in Supplementary Table S1 . .. HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column.

Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

Synthesized:

Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
Article Snippet: A 464-bp probe for hybridization was synthesized from genomic DNA by PCR using primers flanking exons 2 and 3 of NOP56 . .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
Article Snippet: .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots. .. Western blots were performed from total L. infantum lysates equivalent to 2 × 106 parasites in 2× Laemmli buffer.

Construct:

Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
Article Snippet: Plasmid MinR-1 vector containing HDAC3 construct (MinR1-HDAC3) was generated from a pCMV-Sport6 expression vector containing murine HDAC3 (pCMV-Sport6-Mbd2, MMM 1013-9200215, OpenBiosystems). .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified.

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

Incubation:

Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
Article Snippet: Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

Article Title: Genomic nucleosome organization reconstituted with pure proteins
Article Snippet: .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

Expressing:

Western Blot:

Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
Article Snippet: Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots. .. Western blots were performed from total L. infantum lysates equivalent to 2 × 106 parasites in 2× Laemmli buffer.

Competitive Binding Assay:

Hybridization:

Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
Article Snippet: Hybridization intensity signals from plasmid and genomic DNA were measured by a PhosphorImager. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
Article Snippet: DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

Transfection:

Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
Article Snippet: A ratio of the signal obtained from the plasmid DNA versus the genomic DNA was used to determine the plasmid copy number in each transfectant cell line. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

Southern Blot:

Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
Article Snippet: Paragraph title: Southern blot. ... The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

Ligation:

Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
Article Snippet: Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Illumina adapter ligation was performed in a 20-μL reaction by incubation at 20°C for 15 min, followed by 65°C for 10 min (10 μL of DNA from previous step, 1× T4 DNA ligase buffer, 1 μL of T4 DNA ligase (NEB # M0202S), 1 μL of 40-μM pre-annealed adapter mix).

Footprinting:

Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
Article Snippet: Paragraph title: In vivo footprinting ... Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

Northern Blot:

Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
Article Snippet: Southern and Northern blot hybridizations were performed following standard procedures. .. DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs).

Generated:

other:

Article Title: Strand-specific libraries for high throughput RNA sequencing (RNA-Seq) prepared without poly(A) selection
Article Snippet: DNA Polymerase I, Large (Klenow) Fragment (5 U/μl, NEB, Catalog Number M0210L).

Article Title: Crystallographic Analysis of Small Ribozymes and Riboswitches
Article Snippet: Klenow fragment, 5,000 U/mL, with 10× reaction buffer, cat. #M0210S (New England Biolabs, Ipswich, MA).

Sequencing:

Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
Article Snippet: .. The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Retroviruses were generated by cotransfection of MinR1-HDAC3 or parental MinR1 vector with pCLeco (Invitrogen) helper plasmid into the 293T Phoenix ecotropic packaging cell line (ATCC) using Lipofectamine 2000 (11668-019, Invitrogen).

Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

Article Title: Genomic nucleosome organization reconstituted with pure proteins
Article Snippet: Paragraph title: Preparation of sequencing libraries ... Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

Binding Assay:

Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
Article Snippet: Electrophoretic Mobility Shift Assay EMSA was performed for in vitro binding of RIN (AF448522.1) protein with α-Man promoter as methods described previously ( ) with minor modifications. .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

Hi-C:

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: Paragraph title: Construction of Hi-C library ... The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

ChIP-sequencing:

Article Title: Genomic nucleosome organization reconstituted with pure proteins
Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

In Vivo:

RNA Sequencing Assay:

Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
Article Snippet: Paragraph title: 5′ End Enriched RNA-seq Library Construction ... Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

Sensitive Assay:

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

Magnetic Beads:

Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Supernatants were collected and used to infect purified Tregs isolated with magnetic beads.

Article Title: Genomic nucleosome organization reconstituted with pure proteins
Article Snippet: 20 μl Magna ChIP™ Protein A Magnetic Beads (Millipore, cat. # 16-661) were added and incubated for 1.5 h at 4 °C rotating. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

Isolation:

Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
Article Snippet: Genomic DNA was isolated from 10–20 mL of YPD-grown cells using Qiagen Genomic-tip 100/G columns as described by the manufacturer. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

Article Title: The Pumilio-domain protein PUF6 contributes to SIDER2 retroposon-mediated mRNA decay in Leishmania
Article Snippet: Total RNA from parasites was isolated by TRIzol (Life Technologies) according to manufacturer's instructions and resolved on 1% agarose formaldehyde gels. .. Radioactive DNA probes corresponding to the LUC ORF or to the LinJ.36.4000 3′UTR were synthesized using Klenow fragment DNA polymerase I (New England Biolabs) in the presence of [α−32 P] dCTP (PerkinElmer) and random oligonucleotides (NEB) and used in Northern or Southern blots.

Electrophoretic Mobility Shift Assay:

Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
Article Snippet: Paragraph title: Electrophoretic Mobility Shift Assay ... Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column.

Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
Article Snippet: HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

Purification:

Article Title: Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene
Article Snippet: .. Hind III/Xba I digested α-Man promoter fragment was end filled with [α-P32 ]dCTP (3000 Ci/mmol, 50 μCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using sephadex G-50 column. .. EMSA was performed with [α-P32 ]dCTP labeled α-Man promoter fragment incubated with RIN protein purified by in gel shift assay binding buffer (20 mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 10 mM MgCl2 , 2.5 mM EDTA, 2.5 mM DTT and 25 mM NaCl) at 25°C for 30 min. For competition assay, unlabeled promoter fragment was used as specific competitive inhibitor and an unrelated DNA [200 bp region downstream of ATG of tomato actin (FJ532351.1)] was used as non-specific competitor.

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: The sheared DNA was purified with AMPure XP beads (Beckman Coulter, A63881). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening
Article Snippet: .. HindIII/XbaI-digested β-Hex promoter fragment was end filled with [α-P32 ]CTP (3000 Ci mmol–1 , 50 µCi), using DNA polymerase I (Klenow) fragment (New England Biolabs) and purified using a Sephadex G-50 column. .. EMSA was performed with [α-P32 ]CTP labelled β-Hex promoter fragments incubated with purified GST-SlASR1 protein in gel-shift assay binding buffer (20mM HEPES, pH 7.5, 20% glycerol, 0.05 μg poly(dIdC):poly(dIdC), 0.8mM ZnCl2 , 2.5mM EDTA, 2.5mM DTT, and 25mM NaCl) at 25 °C for 30min.

Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
Article Snippet: 5′ End Enriched RNA-seq Library Construction First strand of cDNA was prepared with 3 μg of purified RNA, random hexamers and Invitrogen SuperScript® III First-Strand Synthesis System (Pub. .. Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

Polymerase Chain Reaction:

Article Title: Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings
Article Snippet: .. Reagent list: name (catalog no., vendor) Ethanol 200 proof (E7023; Sigma Aldrich) 5 M NaCl solution (AM9759; Thermo Fisher) HEPES 1 M (15630106; Thermo Fisher) KOH 8 N (P4494; Millipore Sigma) 0.5 M EDTA solution (15575020; Thermo Fisher) Dithiothreitol (R0861; Thermo Fisher) Triton X-100 (85112; Thermo Fisher) Glycerol (17904; Thermo Fisher) 1 M Tris pH 7.0 (AM9850G; Thermo Fisher) 1 M MgCl2 solution (AM9530G; Thermo Fisher) NN-dimethylformamide (D4551; Millipore Sigma) KAPA HiFi PCR kit with dNTPs (NC0142652; Thermo Fisher) 10% SDS (15553027; Thermo Fisher) i5/i7 index primers (any oligo provider) DNA LoBind tubes (13-698-791; Thermo Fisher) Protein LoBind tubes (0030108116; Eppendorf) SPRIselect (B23317; Beckman Coulter) Tn5 transposase with Nextera adapters (custom; QB3 Macrolab) Elution buffer (19086; Qiagen) DNase endonuclease (DB0715K; Lucigen) DNase exonuclease (E3101K; Lucigen) MinElute Virus Spin kit (57704; Qiagen) dNTP solution mix (N0447S; NEB) Klenow (M0210L; NEB) Millex-GP filter unit 0.22 μm (SLGP033RS; EMD) Random primer mix (S1330S; NEB) dNTP solution mix (N0447S; NEB) Ultrapure (10977015; Thermo Fisher) Qubit dsDNA High Sensitivity Kit (Q33230; Thermo Fisher). .. Equipment list Magnetic tube rack for microcentrifuge tubes Heat block Microcentrifuge Vortexer Benchtop centrifuge PCR thermocycler Qubit fluorometer with provided tubes Computer with 2GB+ of RAM, with Docker and Python 3.

Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
Article Snippet: .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP. ..

Labeling:

Article Title: RNA secondary structure and nucleotide composition of the conserved hallmark sequence of Leishmania SIDER2 retroposons are essential for endonucleolytic cleavage and mRNA degradation
Article Snippet: .. DNA probes were radioactively labeled with dCTP [alpha-32P] using random oligonucleotides and Klenow fragment DNA polymerase I (New England Biolabs). .. Copy number values for the LUC-3810 3ʹUTR wild type and mutated plasmids as well as for the LUC-3810ΔSI+II vector were estimated following Southern blot hybridization of total DNA extracted from all the different transfectants and digested with NdeI using a probe complementary to the first 1000 nucleotides of the LmJF.36.3810 3ʹUTR, recognizing both the plasmid and the genomic copies.

Cotransfection:

Article Title: FOXP3+ regulatory T cell development and function require histone/protein deacetylase 3
Article Snippet: The HDAC3 cDNA — cut from pCMV-Sport6 using NotI (R0189S, New England Biolabs) and SalI (R0138S, New England Biolabs) and with a blunt end added using DNA polymerase I Klenow (M0210S, New England Biolabs) in the presence of dNTPs — was ligated into the MinR-1 vector using T4 ligase (203003, Stratagene), and plasmid sequence verified. .. Retroviruses were generated by cotransfection of MinR1-HDAC3 or parental MinR1 vector with pCLeco (Invitrogen) helper plasmid into the 293T Phoenix ecotropic packaging cell line (ATCC) using Lipofectamine 2000 (11668-019, Invitrogen).

Chloramphenicol Acetyltransferase Assay:

Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

Chromatin Immunoprecipitation:

Plasmid Preparation:

In Vitro:

Selection:

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

Agarose Gel Electrophoresis:

Article Title: Prevalence of spinocerebellar ataxia 36 in a US population
Article Snippet: Digested DNA was resolved on a 0.8% agarose gel, depurinated with 0.25 M HCl, denatured with 1.5 M NaCl, 0.5 M NaOH neutralized with 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.0), and transferred with 20× saline-sodium citrate buffer onto a Hybond-N+ nylon membrane (GE Health care, Piscataway, NJ). .. The PCR-amplified probe DNA was used as template to make a 32P-labeled probe using random hexamer primers (#58875; Invitrogen, Carlsbad, CA), Klenow polymerase (#M0210S, NEB) and dNTP's containing [32P]-dCTP.

Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

In Situ:

Hydrophobic Interaction Chromatography:

Random Hexamer Labeling:

Concentration Assay:

Article Title: Genomic nucleosome organization reconstituted with pure proteins
Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. NEBNext Adaptor (0.05 μM final concentration, E7335L and E750L, NEB) was ligated to A-tailed DNA with T4-Ligase (12 U, M0202L, NEB) in 30 μl 1x T4 Ligase reaction Buffer (B0202S, NEB) shaking at 16 °C overnight, then cleaved by addition of USER™ Enzyme (3 U, M5505L, NEB) for 15 min at 37 °C.

High Throughput Screening Assay:

Gel Extraction:

Hood:

Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
Article Snippet: Wear protective clothing and gloves and handle under a fume hood. .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500)