dna ladder 100 bp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    Name:
    100 bp DNA Ladder
    Description:
    100 bp DNA Ladder 500 gel lanes
    Catalog Number:
    N3231L
    Price:
    230
    Size:
    500 gel lanes
    Category:
    DNA Ladders
    Score:
    85
    Buy from Supplier
    Name:
    TriDye 100 bp DNA Ladder - 125 gel lanes
    Description:

    Catalog Number:
    N3271S
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs dna ladder 100 bp
    100 bp DNA Ladder

    https://www.bioz.com/result/dna ladder 100 bp/product/New England Biolabs
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna ladder 100 bp - by Bioz Stars, 2020-01
    79/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Recovery:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs 100 bp dna ladder
    Instability of octarepeats during <t>DNA</t> replication in mismatch repair-deficient XL-1 Red cells. (A) Mutant clones from replication of pOct5 in XL-1 Red E.coli cells. Plasmid DNA samples were prepared from XL-1 Red colonies after transformation with pOct5 and re-transformed into DH5α cells. Plasmid DNAs from the resulting DH5α colonies were digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 4 DH5α colonies that produced two octarepeat bands of equal molar ratio. (B) Mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Same as in (A) except that pOct11b was used. Shown are plasmid DNAs from 4 colonies that produced two octarepeat bands of equal molar ratio. (C–D) Unusual mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Shown are plasmid DNAs from two pOct11b-transformed XL-1 Red colonies that produced 2–3 octarepeat bands upon digestion with Sac II and Spe I, of which the template-sized band is much stronger than the mutant bands (C). The unequal molar ratio of the octarepeat bands suggests the presence of mixed plasmid DNA species in these colonies. Further transformation of these plasmid DNAs into DH5α cells resulted in separation of the mixed plasmid DNA species and produced colonies that each contained only one of the plasmid DNA species as confirmed by restriction analysis and sequencing (D). For all panels, the octarepeat sequence is indicated above each lane, the arrowhead points to the band whose sequence is shown above the lane, and the black box marks the template-sized Oct5 or Oct11 band from a non-mutant clone. Rep. No., number of repeats; <t>M,100-bp</t> DNA Ladder.
    100 Bp Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/100 bp dna ladder/product/New England Biolabs
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    100 bp dna ladder - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier


    Image Search Results


    Instability of octarepeats during DNA replication in mismatch repair-deficient XL-1 Red cells. (A) Mutant clones from replication of pOct5 in XL-1 Red E.coli cells. Plasmid DNA samples were prepared from XL-1 Red colonies after transformation with pOct5 and re-transformed into DH5α cells. Plasmid DNAs from the resulting DH5α colonies were digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 4 DH5α colonies that produced two octarepeat bands of equal molar ratio. (B) Mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Same as in (A) except that pOct11b was used. Shown are plasmid DNAs from 4 colonies that produced two octarepeat bands of equal molar ratio. (C–D) Unusual mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Shown are plasmid DNAs from two pOct11b-transformed XL-1 Red colonies that produced 2–3 octarepeat bands upon digestion with Sac II and Spe I, of which the template-sized band is much stronger than the mutant bands (C). The unequal molar ratio of the octarepeat bands suggests the presence of mixed plasmid DNA species in these colonies. Further transformation of these plasmid DNAs into DH5α cells resulted in separation of the mixed plasmid DNA species and produced colonies that each contained only one of the plasmid DNA species as confirmed by restriction analysis and sequencing (D). For all panels, the octarepeat sequence is indicated above each lane, the arrowhead points to the band whose sequence is shown above the lane, and the black box marks the template-sized Oct5 or Oct11 band from a non-mutant clone. Rep. No., number of repeats; M,100-bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Instability of octarepeats during DNA replication in mismatch repair-deficient XL-1 Red cells. (A) Mutant clones from replication of pOct5 in XL-1 Red E.coli cells. Plasmid DNA samples were prepared from XL-1 Red colonies after transformation with pOct5 and re-transformed into DH5α cells. Plasmid DNAs from the resulting DH5α colonies were digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 4 DH5α colonies that produced two octarepeat bands of equal molar ratio. (B) Mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Same as in (A) except that pOct11b was used. Shown are plasmid DNAs from 4 colonies that produced two octarepeat bands of equal molar ratio. (C–D) Unusual mutant clones from replication of pOct11b in XL-1 Red E.coli cells. Shown are plasmid DNAs from two pOct11b-transformed XL-1 Red colonies that produced 2–3 octarepeat bands upon digestion with Sac II and Spe I, of which the template-sized band is much stronger than the mutant bands (C). The unequal molar ratio of the octarepeat bands suggests the presence of mixed plasmid DNA species in these colonies. Further transformation of these plasmid DNAs into DH5α cells resulted in separation of the mixed plasmid DNA species and produced colonies that each contained only one of the plasmid DNA species as confirmed by restriction analysis and sequencing (D). For all panels, the octarepeat sequence is indicated above each lane, the arrowhead points to the band whose sequence is shown above the lane, and the black box marks the template-sized Oct5 or Oct11 band from a non-mutant clone. Rep. No., number of repeats; M,100-bp DNA Ladder.

    Article Snippet: The 100-bp DNA ladder and 1-Kb DNA ladder (New England Biolabs, MA, USA) were used as markers for agarose gel electrophoresis.

    Techniques: Mutagenesis, Clone Assay, Plasmid Preparation, Transformation Assay, Agarose Gel Electrophoresis, Produced, Sequencing

    Mutant plasmids from octarepeat replication in DH5α are all head-to-head dimers. (A) Restriction analysis of replication-mutant plasmids with Spe I, Sac II and Sca I. pOct5 or pOct11b were transformed into DH5α. Plasmid DNAs were prepared from two mutant colonies and two control (non-mutant) colonies each for pOct5 and pOct11b, digested with Spe I, Sac II or Sca I, and separated by agarose gel electrophoresis. All mutant colonies appear to contain a minute amount of monomer plasmids. M1, 100-bp DNA ladder; M2, 1-kb DNA ladder. (B) Diagram of the head-to-head plasmid dimers. The top panel depicts the parental plasmid monomer; the bottom panel depicts the dimer where the newly generated monomer unit is highlighted in thicker lines. The boxes denote the octarepeat inserts.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Mutant plasmids from octarepeat replication in DH5α are all head-to-head dimers. (A) Restriction analysis of replication-mutant plasmids with Spe I, Sac II and Sca I. pOct5 or pOct11b were transformed into DH5α. Plasmid DNAs were prepared from two mutant colonies and two control (non-mutant) colonies each for pOct5 and pOct11b, digested with Spe I, Sac II or Sca I, and separated by agarose gel electrophoresis. All mutant colonies appear to contain a minute amount of monomer plasmids. M1, 100-bp DNA ladder; M2, 1-kb DNA ladder. (B) Diagram of the head-to-head plasmid dimers. The top panel depicts the parental plasmid monomer; the bottom panel depicts the dimer where the newly generated monomer unit is highlighted in thicker lines. The boxes denote the octarepeat inserts.

    Article Snippet: The 100-bp DNA ladder and 1-Kb DNA ladder (New England Biolabs, MA, USA) were used as markers for agarose gel electrophoresis.

    Techniques: Mutagenesis, Transformation Assay, Plasmid Preparation, Agarose Gel Electrophoresis, Generated

    Instability of octarepeats during PCR amplification by Pwo polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Pwo polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. Bl, blank control. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a non-mutant clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template DNA. Eighteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant plasmid clone produced two octarepeat inserts; one was the wild type Oct5 while the other was a 2-repeat deletion mutant (R1-R2). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 3 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Instability of octarepeats during PCR amplification by Pwo polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Pwo polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. Bl, blank control. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a non-mutant clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template DNA. Eighteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant plasmid clone produced two octarepeat inserts; one was the wild type Oct5 while the other was a 2-repeat deletion mutant (R1-R2). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 3 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Article Snippet: The 100-bp DNA ladder and 1-Kb DNA ladder (New England Biolabs, MA, USA) were used as markers for agarose gel electrophoresis.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Plasmid Preparation, Produced, Sequencing

    Instability of octarepeats during DNA replication in DH5α cells. (A) Mutant clones from replication of pOct5 in DH5α cells. pOct5 was transformed into DH5α. Plasmid DNAs were prepared from the resulting colonies, digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 3 colonies that produced two octarepeat bands of equal molar ratio. (B) Mutant clones from replication of pOct11b in DH5α cells. pOct11b was transformed into DH5α. Plasmid DNAs were prepared from the resulting colonies, digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 4 colonies that produced two octarepeat bands of equal molar ratio. (C–D) Unusual mutant clones from replication of pOct11b in DH5α cells. Shown are plasmid DNAs from two pOct11b-transformed DH5α colonies that produced 2–3 octarepeat bands upon digestion with Sac II and Spe I, of which the template-sized band is much stronger than the mutant bands (C). The unequal molar ratio of the octarepeat bands suggests the presence in these colonies of mixed plasmid DNA species where each species produced one of the octarepeat bands. Re-transformation of these plasmid DNAs into DH5α cells resulted in separation of the mixed plasmid DNA species and produced colonies that each contained only one plasmid DNA species as confirmed by restriction analysis and sequencing (D). For all panels, the octarepeat sequence is indicated above each lane, the arrowhead points to the band whose sequence is shown above the lane, and the black box marks the template-sized Oct5 or Oct11 band from a non-mutant clone. Rep. No., number of repeats; M,100-bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Instability of octarepeats during DNA replication in DH5α cells. (A) Mutant clones from replication of pOct5 in DH5α cells. pOct5 was transformed into DH5α. Plasmid DNAs were prepared from the resulting colonies, digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 3 colonies that produced two octarepeat bands of equal molar ratio. (B) Mutant clones from replication of pOct11b in DH5α cells. pOct11b was transformed into DH5α. Plasmid DNAs were prepared from the resulting colonies, digested with Sac II and Spe I and separated on a 2% agarose gel. Shown are plasmid DNAs from 4 colonies that produced two octarepeat bands of equal molar ratio. (C–D) Unusual mutant clones from replication of pOct11b in DH5α cells. Shown are plasmid DNAs from two pOct11b-transformed DH5α colonies that produced 2–3 octarepeat bands upon digestion with Sac II and Spe I, of which the template-sized band is much stronger than the mutant bands (C). The unequal molar ratio of the octarepeat bands suggests the presence in these colonies of mixed plasmid DNA species where each species produced one of the octarepeat bands. Re-transformation of these plasmid DNAs into DH5α cells resulted in separation of the mixed plasmid DNA species and produced colonies that each contained only one plasmid DNA species as confirmed by restriction analysis and sequencing (D). For all panels, the octarepeat sequence is indicated above each lane, the arrowhead points to the band whose sequence is shown above the lane, and the black box marks the template-sized Oct5 or Oct11 band from a non-mutant clone. Rep. No., number of repeats; M,100-bp DNA Ladder.

    Article Snippet: The 100-bp DNA ladder and 1-Kb DNA ladder (New England Biolabs, MA, USA) were used as markers for agarose gel electrophoresis.

    Techniques: Mutagenesis, Clone Assay, Transformation Assay, Plasmid Preparation, Agarose Gel Electrophoresis, Produced, Sequencing

    Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Article Snippet: The 100-bp DNA ladder and 1-Kb DNA ladder (New England Biolabs, MA, USA) were used as markers for agarose gel electrophoresis.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

    Quantitative and enzymatic analysis of patient DNA. ( A ) Quantitative competitive PCR revealed a significant increase in the amount IP'd/input from heart compared to cerebellum DNA of the same DM1 patient (unpaired two-tailed t-test, p = 0.03, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations). No significant difference was found between matched tissues of a non-DM1 individual. Details of quantitative competitive PCR and examples of the raw data are presented in Fig. S4 . ( B ) Sensitivity of DM1 patient DNAs to structure-specific enzymes. For enzyme location specificity, see Fig. S4D TP-PCR analysis of samples +/−digestions assessed by GeneScan or ( C ) agarose electrophoresis, show decreased signal of the expanded allele after T7endoI or MBN digestion, with control DNA showing no difference. ( D ) Quantification of MBN and T7endoI digestion. Untreated heart DNA compared to MBN-treated, paired t-test, p = 0.0015, and compared to T7endoI-treated, paired t-test, p = 0.0015, n = at least 5 experimental replicates per treatment, on at least two genomic isolations. For analysis of additional tissues see Fig. S4 . All errors bars indicate SEM, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations.

    Journal: PLoS Genetics

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues

    doi: 10.1371/journal.pgen.1003866

    Figure Lengend Snippet: Quantitative and enzymatic analysis of patient DNA. ( A ) Quantitative competitive PCR revealed a significant increase in the amount IP'd/input from heart compared to cerebellum DNA of the same DM1 patient (unpaired two-tailed t-test, p = 0.03, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations). No significant difference was found between matched tissues of a non-DM1 individual. Details of quantitative competitive PCR and examples of the raw data are presented in Fig. S4 . ( B ) Sensitivity of DM1 patient DNAs to structure-specific enzymes. For enzyme location specificity, see Fig. S4D TP-PCR analysis of samples +/−digestions assessed by GeneScan or ( C ) agarose electrophoresis, show decreased signal of the expanded allele after T7endoI or MBN digestion, with control DNA showing no difference. ( D ) Quantification of MBN and T7endoI digestion. Untreated heart DNA compared to MBN-treated, paired t-test, p = 0.0015, and compared to T7endoI-treated, paired t-test, p = 0.0015, n = at least 5 experimental replicates per treatment, on at least two genomic isolations. For analysis of additional tissues see Fig. S4 . All errors bars indicate SEM, n = at least 5 experimental replicates per treatment per tissue, on at least two genomic isolations.

    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Techniques: Polymerase Chain Reaction, Two Tailed Test, Electrophoresis

    Analysis of slipped-DNA in native chromatin, and EM of IP'd DNA. ( A ) Tissues were treated in their native chromatin state with MBN and T7EndoI or Alu I enzymes, DNAs extracted and analyzed by TP-PCR. Agarose electrophoretic analysis of native-chromatin context digested DNA, run out after TP-PCR, showing a decrease in the expanded allele signal from patient muscle, but not cerebellum. See Figure S5A for representative GeneScan analyses of patient DNA treated in its native chromatin context with MBN and T7EndoI or Alu I enzyme (see Text S1 for Nuclease accessibility protocol). Also, see Figure S5C for a comparison of areas under each peak of the GeneScans before and after treatment. ( B ) The graph shows the significant difference in the reduction of the expanded allele after MBN and T7 treatment, compared to both untreated and Alu I treatment (p = 0.0038), n = 3 experiments. There is no significant difference between untreated and MBN+T7 treated ADM9 cerebellum digested in the native chromatin context. All error bars indicate SEM. ( C ) Electron microscopic imaging shows structured DNA. Electron microscopic (EM) images of immunoprecipitated DM1 DNAs and a control fully-duplexed DNA. IP'd DM1 tissue DNA shows multiple sized and clustered structures by EM. For EM analysis of additional tissue DNA as well as wider field views, see Supplementary Fig. S7 . ( D ) Analysis of slip-out sizes and the distance between slip-outs on immunoprecipitated slipped DNAs. The size of the slip-outs presented a bimodal distribution ranging from 1–100 repeats with peaks at ∼30 and

    Journal: PLoS Genetics

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues

    doi: 10.1371/journal.pgen.1003866

    Figure Lengend Snippet: Analysis of slipped-DNA in native chromatin, and EM of IP'd DNA. ( A ) Tissues were treated in their native chromatin state with MBN and T7EndoI or Alu I enzymes, DNAs extracted and analyzed by TP-PCR. Agarose electrophoretic analysis of native-chromatin context digested DNA, run out after TP-PCR, showing a decrease in the expanded allele signal from patient muscle, but not cerebellum. See Figure S5A for representative GeneScan analyses of patient DNA treated in its native chromatin context with MBN and T7EndoI or Alu I enzyme (see Text S1 for Nuclease accessibility protocol). Also, see Figure S5C for a comparison of areas under each peak of the GeneScans before and after treatment. ( B ) The graph shows the significant difference in the reduction of the expanded allele after MBN and T7 treatment, compared to both untreated and Alu I treatment (p = 0.0038), n = 3 experiments. There is no significant difference between untreated and MBN+T7 treated ADM9 cerebellum digested in the native chromatin context. All error bars indicate SEM. ( C ) Electron microscopic imaging shows structured DNA. Electron microscopic (EM) images of immunoprecipitated DM1 DNAs and a control fully-duplexed DNA. IP'd DM1 tissue DNA shows multiple sized and clustered structures by EM. For EM analysis of additional tissue DNA as well as wider field views, see Supplementary Fig. S7 . ( D ) Analysis of slip-out sizes and the distance between slip-outs on immunoprecipitated slipped DNAs. The size of the slip-outs presented a bimodal distribution ranging from 1–100 repeats with peaks at ∼30 and

    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Techniques: Electron Microscopy, Polymerase Chain Reaction, Imaging, Immunoprecipitation

    Immunoprecipitated DNA is enriched for the expanded DM1 allele. ( A ) Multiplex PCR protocol to determine the DM1 allele specificity of IP'd DNA, where “n” and “N” are the non-expanded and expanded alleles. Two primer pairs, indicated by arrow-heads are used in the same PCR reaction in order to differentiate between the expanded and non-expanded allele in genomic and IP'd DNA. Expected products are shown in the schematic gels for each case, sizes are based upon a non-expanded allele of (CTG) 4 . ( B ) Multiplex PCR analysis of ADM5 patient tissue DNAs shows only the lower two products in IP'd DNAs, indicating a strong enrichment of the expanded but not the non-expanded allele. DM1 individual, ADM5, has varying expanded repeat sizes between tissues – too large to be amplified across ( Fig. 2B ) and (CTG) 4 in the non-expanded allele. Sizes of PCR products are indicated. The products in the IP lanes appear brighter because more DNA was loaded in these lanes in order to show that apparent loss of the larger PCR products that are unique to the non-expanded allele was not due to decreased sample loading. ( C ) Triplet-primed PCR protocol for IP'd DNAs (see text and Methods for full explanation of protocol). Briefly, an enrichment of the smeared PCR product (expanded allele) is expected over the smaller discrete product (non-expanded allele) after IP. ( D ) TP-PCR reveals predominantly the expanded allele in IP'd DNA (black arrowhead), and an absence of the non-expanded allele (blue arrowhead), confirming the specific immunoprecipitation of the expanded allele. The supernatant (SN) is depleted of the expanded but not the non-expanded allele. NB, this image is best viewed directly on the original electronic image. Neither Figure 3B nor Figure 3D are quantitative in nature; they are loaded in such a way that the differences between genomic and IP'd DNA are visually apparent.

    Journal: PLoS Genetics

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues

    doi: 10.1371/journal.pgen.1003866

    Figure Lengend Snippet: Immunoprecipitated DNA is enriched for the expanded DM1 allele. ( A ) Multiplex PCR protocol to determine the DM1 allele specificity of IP'd DNA, where “n” and “N” are the non-expanded and expanded alleles. Two primer pairs, indicated by arrow-heads are used in the same PCR reaction in order to differentiate between the expanded and non-expanded allele in genomic and IP'd DNA. Expected products are shown in the schematic gels for each case, sizes are based upon a non-expanded allele of (CTG) 4 . ( B ) Multiplex PCR analysis of ADM5 patient tissue DNAs shows only the lower two products in IP'd DNAs, indicating a strong enrichment of the expanded but not the non-expanded allele. DM1 individual, ADM5, has varying expanded repeat sizes between tissues – too large to be amplified across ( Fig. 2B ) and (CTG) 4 in the non-expanded allele. Sizes of PCR products are indicated. The products in the IP lanes appear brighter because more DNA was loaded in these lanes in order to show that apparent loss of the larger PCR products that are unique to the non-expanded allele was not due to decreased sample loading. ( C ) Triplet-primed PCR protocol for IP'd DNAs (see text and Methods for full explanation of protocol). Briefly, an enrichment of the smeared PCR product (expanded allele) is expected over the smaller discrete product (non-expanded allele) after IP. ( D ) TP-PCR reveals predominantly the expanded allele in IP'd DNA (black arrowhead), and an absence of the non-expanded allele (blue arrowhead), confirming the specific immunoprecipitation of the expanded allele. The supernatant (SN) is depleted of the expanded but not the non-expanded allele. NB, this image is best viewed directly on the original electronic image. Neither Figure 3B nor Figure 3D are quantitative in nature; they are loaded in such a way that the differences between genomic and IP'd DNA are visually apparent.

    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Techniques: Immunoprecipitation, Multiplex Assay, Polymerase Chain Reaction, CTG Assay, Amplification

    Slipped-DNAs are bound by anti-DNA junction antibody. ( A ) The anti-DNA junction antibody 2D3 bound slip-outs of 1-, 3- and 20-excess repeats as well as homoduplex slipped-DNAs with multiple clustered slip-outs/molecule by electrophoretic mobility shift assay. DNA substrates were 59 bp+(CT/AG)n+54 bp radiolabeled, gel-purified and used in binding experiments. Arrowheads indicate non-specific, specific and competition-resistant specific complexes. Line for lanes of S-DNA indicates a non-specific DNA. Triangles indicate increased antibody; + indicates addition of non-specific (plasmid) competitor DNA. All samples of the band-shift experiment were resolved on a single gel with panels separated for clarity. See Fig. S2 for control IgG 1 Ab binding. ( B ) DM1 post-mortem patient and control, tissue, and DM1 CTG tract sizes (for the non-expanded and expanded allele for the patients, and both non-expanded alleles for the control). See Text S1 for post-mortem details. ( C ) Protocol to isolate slipped-DNAs from genomic DNA. Tissue DNA is isolated using a non-denaturing protocol (see Text S1 ). DNA is then digested to release the repeat-containing fragment at the DM1 locus from the rest of the genome (slipped-DNAs are not super-coil dependent), incubated with the anti-DNA junction antibody 2D3, pulled down using protein G beads, released from the beads, and then characterized. The Bbs I-(CTG)n- Bam HI restriction fragment size will vary depending upon the repeat size. NB, this image is best viewed directly on the original electronic image.

    Journal: PLoS Genetics

    Article Title: Detection of Slipped-DNAs at the Trinucleotide Repeats of the Myotonic Dystrophy Type I Disease Locus in Patient Tissues

    doi: 10.1371/journal.pgen.1003866

    Figure Lengend Snippet: Slipped-DNAs are bound by anti-DNA junction antibody. ( A ) The anti-DNA junction antibody 2D3 bound slip-outs of 1-, 3- and 20-excess repeats as well as homoduplex slipped-DNAs with multiple clustered slip-outs/molecule by electrophoretic mobility shift assay. DNA substrates were 59 bp+(CT/AG)n+54 bp radiolabeled, gel-purified and used in binding experiments. Arrowheads indicate non-specific, specific and competition-resistant specific complexes. Line for lanes of S-DNA indicates a non-specific DNA. Triangles indicate increased antibody; + indicates addition of non-specific (plasmid) competitor DNA. All samples of the band-shift experiment were resolved on a single gel with panels separated for clarity. See Fig. S2 for control IgG 1 Ab binding. ( B ) DM1 post-mortem patient and control, tissue, and DM1 CTG tract sizes (for the non-expanded and expanded allele for the patients, and both non-expanded alleles for the control). See Text S1 for post-mortem details. ( C ) Protocol to isolate slipped-DNAs from genomic DNA. Tissue DNA is isolated using a non-denaturing protocol (see Text S1 ). DNA is then digested to release the repeat-containing fragment at the DM1 locus from the rest of the genome (slipped-DNAs are not super-coil dependent), incubated with the anti-DNA junction antibody 2D3, pulled down using protein G beads, released from the beads, and then characterized. The Bbs I-(CTG)n- Bam HI restriction fragment size will vary depending upon the repeat size. NB, this image is best viewed directly on the original electronic image.

    Article Snippet: 10 Units of MBN or T7endoI were incubated with 200 ng DM1 patient genomic, un-IP'd DNA in NEB Buffer 2 (New England Biolabs) at 30°C for 30 minutes and 37°C for 30 minutes, respectively.

    Techniques: Electrophoretic Mobility Shift Assay, Purification, Binding Assay, Plasmid Preparation, CTG Assay, Isolation, Incubation

    Gels showing the results of a multiplex polymerase chain reaction (PCR) assay for enteropathogenic Escherichia coli (EPEC), Shiga toxin–producing E. coli , and enterohemorrhagic E. coli (EHEC). Individual isolates from 34 specimens were subjected to a multiplex PCR as described in the text. Each specimen, separated by yellow vertical lines, consists of 3 individual isolates. The yellow values indicate the cycle threshold obtained for each specimen in the real-time PCR used in the initial screening for eae . The amplicons produced by the positive controls, EPEC E2348/69 ( eae and bfpA ) and EHEC EH48 ( stx1 , stx2 , and ehxA ) are also shown. 100 bp DNA ladder was used as a molecular size marker. Abbreviation: NTC, no template control.

    Journal: Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America

    Article Title: Diagnostic Microbiologic Methods in the GEMS-1 Case/Control Study

    doi: 10.1093/cid/cis754

    Figure Lengend Snippet: Gels showing the results of a multiplex polymerase chain reaction (PCR) assay for enteropathogenic Escherichia coli (EPEC), Shiga toxin–producing E. coli , and enterohemorrhagic E. coli (EHEC). Individual isolates from 34 specimens were subjected to a multiplex PCR as described in the text. Each specimen, separated by yellow vertical lines, consists of 3 individual isolates. The yellow values indicate the cycle threshold obtained for each specimen in the real-time PCR used in the initial screening for eae . The amplicons produced by the positive controls, EPEC E2348/69 ( eae and bfpA ) and EHEC EH48 ( stx1 , stx2 , and ehxA ) are also shown. 100 bp DNA ladder was used as a molecular size marker. Abbreviation: NTC, no template control.

    Article Snippet: The 1-kb plusA 100-bp DNA ladder (New England Biolabs) was used as a molecular size marker in gel.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Produced, Marker

    Appearance of diarrheagenic Escherichia coli amplicons separated by agarose gel electrophoresis. Lane 1, enteropathogenic E. coli ; lane 2, enteroaggregative E. coli ; 3, enterotoxigenic E. coli ; lanes 4 and 5, negative control strains; lane 6, 100 bp DNA ladder (New England Biolabs).

    Journal: Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America

    Article Title: Diagnostic Microbiologic Methods in the GEMS-1 Case/Control Study

    doi: 10.1093/cid/cis754

    Figure Lengend Snippet: Appearance of diarrheagenic Escherichia coli amplicons separated by agarose gel electrophoresis. Lane 1, enteropathogenic E. coli ; lane 2, enteroaggregative E. coli ; 3, enterotoxigenic E. coli ; lanes 4 and 5, negative control strains; lane 6, 100 bp DNA ladder (New England Biolabs).

    Article Snippet: The 1-kb plusA 100-bp DNA ladder (New England Biolabs) was used as a molecular size marker in gel.

    Techniques: Agarose Gel Electrophoresis, Electrophoresis, Negative Control

    Appearance of enteric viral amplicons separated by agarose gel electrophoresis. Lane M, 100 bp DNA ladder (New England Biolabs); lane 1, Norovirus GI (330 bp); lane 2, Norovirus GII positive (387 bp); lane 3, sapovirus (434 bp); lane 4, astrovirus (719 bp).

    Journal: Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America

    Article Title: Diagnostic Microbiologic Methods in the GEMS-1 Case/Control Study

    doi: 10.1093/cid/cis754

    Figure Lengend Snippet: Appearance of enteric viral amplicons separated by agarose gel electrophoresis. Lane M, 100 bp DNA ladder (New England Biolabs); lane 1, Norovirus GI (330 bp); lane 2, Norovirus GII positive (387 bp); lane 3, sapovirus (434 bp); lane 4, astrovirus (719 bp).

    Article Snippet: The 1-kb plusA 100-bp DNA ladder (New England Biolabs) was used as a molecular size marker in gel.

    Techniques: Agarose Gel Electrophoresis, Electrophoresis