Structured Review

Illumina Inc dna input
Coverage of the microbial genomes, Olsenella profusa (62% GC) (left) and Bacillus megaterium (38% GC) (right) with (A) <t>MGIEasy</t> PCR-Free <t>DNA</t> Library Pre Set and (B) MGIEasy FS PCR-Free DNA Library Pre Set. Read coverage across the range of the GC content, calculated in 100 bp windows (pink bars) and normalized coverage (colored dots). 3 replicates (red, blue and green dots) were included in the normalized coverage VS GC content analysis.
Dna Input, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna input/product/Illumina Inc
Average 91 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dna input - by Bioz Stars, 2020-07
91/100 stars

Images

1) Product Images from "Advanced Whole Genome Sequencing Using a Complete PCR-free Massively Parallel Sequencing (MPS) Workflow"

Article Title: Advanced Whole Genome Sequencing Using a Complete PCR-free Massively Parallel Sequencing (MPS) Workflow

Journal: bioRxiv

doi: 10.1101/2019.12.20.885517

Coverage of the microbial genomes, Olsenella profusa (62% GC) (left) and Bacillus megaterium (38% GC) (right) with (A) MGIEasy PCR-Free DNA Library Pre Set and (B) MGIEasy FS PCR-Free DNA Library Pre Set. Read coverage across the range of the GC content, calculated in 100 bp windows (pink bars) and normalized coverage (colored dots). 3 replicates (red, blue and green dots) were included in the normalized coverage VS GC content analysis.
Figure Legend Snippet: Coverage of the microbial genomes, Olsenella profusa (62% GC) (left) and Bacillus megaterium (38% GC) (right) with (A) MGIEasy PCR-Free DNA Library Pre Set and (B) MGIEasy FS PCR-Free DNA Library Pre Set. Read coverage across the range of the GC content, calculated in 100 bp windows (pink bars) and normalized coverage (colored dots). 3 replicates (red, blue and green dots) were included in the normalized coverage VS GC content analysis.

Techniques Used: Polymerase Chain Reaction

DNBSEQTM WGS PCR vs PCR-free workflows and general performance of PCR-free libraries. (a) MPS library construction workflows of WGS PCR and PCR-free libraries. RCA ( r olling c ircle a mplification) is used to increase signal intensity during array formation, which is followed by sequencing DNBs with DNBSEQ TM technology. Individual copies from the same DNB are replicated independently using the same ssCir template. Therefore, amplification errors cannot accumulate. Black, genomic DNA; Gray rectangle, adapter; green, barcode; red, amplification errors. (b) Two sets of 9 replicates from 1 μg NA12878 DNA were processed with MGIEasy PCR-Free DNA Library Prep Set (blue) or MGIEasy FS PCR-Free DNA Library Prep Set (orange). The GC content, Duplication rate, Median Insert size, and regions with > 10x Coverage were calculated and plotted. The error bars represent the standard deviations across the replicates.
Figure Legend Snippet: DNBSEQTM WGS PCR vs PCR-free workflows and general performance of PCR-free libraries. (a) MPS library construction workflows of WGS PCR and PCR-free libraries. RCA ( r olling c ircle a mplification) is used to increase signal intensity during array formation, which is followed by sequencing DNBs with DNBSEQ TM technology. Individual copies from the same DNB are replicated independently using the same ssCir template. Therefore, amplification errors cannot accumulate. Black, genomic DNA; Gray rectangle, adapter; green, barcode; red, amplification errors. (b) Two sets of 9 replicates from 1 μg NA12878 DNA were processed with MGIEasy PCR-Free DNA Library Prep Set (blue) or MGIEasy FS PCR-Free DNA Library Prep Set (orange). The GC content, Duplication rate, Median Insert size, and regions with > 10x Coverage were calculated and plotted. The error bars represent the standard deviations across the replicates.

Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification

Related Articles

Amplification:

Article Title: Capture‐based next‐generation sequencing reveals multiple actionable mutations in cancer patients failed in traditional testing
Article Snippet: .. For low DNA input samples, PCR‐free library was further amplified with Illumina p5 (AATGATACGGCGACCACCGA) and p7 (CAAGCAGAAGA‐CGGCATACGA) primers in NEB Next High‐Fidelity 2XPCR Master Mix (NEB, Ipswich, MA, USA). .. Hybrid capture and sequencing Different libraries with unique indexes were pooled together with desirable ratio to up to 2 μ g of total library input.

Article Title: Genetic heterogeneity in hepatocellular carcinoma and paired bone metastasis revealed by next-generation sequencing
Article Snippet: .. For low DNA input samples, PCR-free library was further amplified with Illumina p5 (AATGATACGGCGACCACCGA) and p7 (CAAGCAGAAGACGGCATACGA) primers in NEB Next High-Fidelity 2XPCR Master Mix (NEB, Ipswich, MA, USA). ..

Sample Prep:

Article Title: Phylogenetic Diversity and Single-Cell Genome Analysis of “Melainabacteria”, a Non-Photosynthetic Cyanobacterial Group, in the Termite Gut
Article Snippet: .. A sequencing library for this sample was prepared using the TruSeq DNA Sample Preparation Kit according to its protocol for low DNA input (Illumina, San Diego, CA, USA). .. Sequencing was performed on the Illumina MiSeq platform with its Reagent Kit V3.

HTS Assay:

Article Title: An Enrichment Strategy Yields Seven Novel Single Nucleotide Polymorphisms Associated with Mortality and Altered Th17 Responses following Blunt Trauma
Article Snippet: .. Single nucleotide polymorphism genotyping was performed with 200 ng of genomic DNA input using the Human Core Exome-24 v1.1 BeadChip (Illumina, San Diego, CA) following the manufacturer’s Infinium® HTS Assay protocol. .. Briefly, DNA was denatured in 0.1N NaOH and neutralized prior to isothermal amplification.

Sequencing:

Article Title: Phylogenetic Diversity and Single-Cell Genome Analysis of “Melainabacteria”, a Non-Photosynthetic Cyanobacterial Group, in the Termite Gut
Article Snippet: .. A sequencing library for this sample was prepared using the TruSeq DNA Sample Preparation Kit according to its protocol for low DNA input (Illumina, San Diego, CA, USA). .. Sequencing was performed on the Illumina MiSeq platform with its Reagent Kit V3.

Article Title: Targeted or whole genome sequencing of formalin fixed tissue samples: potential applications in cancer genomics
Article Snippet: .. Future studies should extend our initial observations to include the effect of duration of formalin fixation and the amount of genomic DNA input on FFPE artifacts in Illumina sequencing applications. ..

Generated:

Article Title: Identification of biomarkers for amyotrophic lateral sclerosis by comprehensive analysis of exosomal mRNAs in human cerebrospinal fluid
Article Snippet: .. Alternatively, increase of DNA input to 1 ng successfully generated the Illumina library. ..

Formalin-fixed Paraffin-Embedded:

Article Title: Targeted or whole genome sequencing of formalin fixed tissue samples: potential applications in cancer genomics
Article Snippet: .. Future studies should extend our initial observations to include the effect of duration of formalin fixation and the amount of genomic DNA input on FFPE artifacts in Illumina sequencing applications. ..

Polymerase Chain Reaction:

Article Title: Capture‐based next‐generation sequencing reveals multiple actionable mutations in cancer patients failed in traditional testing
Article Snippet: .. For low DNA input samples, PCR‐free library was further amplified with Illumina p5 (AATGATACGGCGACCACCGA) and p7 (CAAGCAGAAGA‐CGGCATACGA) primers in NEB Next High‐Fidelity 2XPCR Master Mix (NEB, Ipswich, MA, USA). .. Hybrid capture and sequencing Different libraries with unique indexes were pooled together with desirable ratio to up to 2 μ g of total library input.

Article Title: Genetic heterogeneity in hepatocellular carcinoma and paired bone metastasis revealed by next-generation sequencing
Article Snippet: .. For low DNA input samples, PCR-free library was further amplified with Illumina p5 (AATGATACGGCGACCACCGA) and p7 (CAAGCAGAAGACGGCATACGA) primers in NEB Next High-Fidelity 2XPCR Master Mix (NEB, Ipswich, MA, USA). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Illumina Inc chip input dna
    Genome-wide characterization of <t>Runx2</t> occupied regions (R2ORs). C4-2B/Rx2 dox cells were subjected to Runx2 ChIP-seq analysis after dox treatment and immunoprecipitation of Runx2-bound <t>DNA</t> fragments with anti-FLAG antibodies. ( A ) ChIP-seq results showing R2ORs upstream of the KLK and CSF2 TSS s . Raw ChIP-seq data are presented as frequency of reads per location for 30 kb of DNA sequences at the KLK2 (top) and CSF2 (bottom) loci. For each locus, the upper track shows results for chromatin aliquoted prior to immunoprecipitation (input). Regions investigated in Figure 1 by conventional ChIP assays are marked by black bars. ( B ) Sixteen Runx2 ChIP-seq peaks were validated by conventional ChIP-qPCR and the ChIP-seq scores are plotted against the qPCR enrichment factors. ( C ) Distance from the 1603 top R2ORs to the nearest TSS were mapped (red) and are shown along with control distribution patterns of 1000 sets of 1603 matched random sequences (gray). Y -axis values are numbers of R2ORs per 15 kb window. ( D ) Genomic distribution of the 1603 top R2ORs (red bars) versus that of 1000 sets of matched random sequences (gray bars; mean ± SD). TSS refers to −1000 to +100 bp from 5′-end of annotated RNA. Transcription Termination Site ( TTS ) is defined as −100 to +1000 bp from the 3′-end of the transcript. Inset shows blow up of TTS and TTS data.
    Chip Input Dna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chip input dna/product/Illumina Inc
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    chip input dna - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    89
    Illumina Inc hela input dna
    Pol III co-occupies methylated SINEs with MBPs. ( a ) Semiquantitative ChIP assay in A31 fibroblasts showing specific binding of TFIIIB, TFIIIC and pol III to B1 and B2 loci, as well as 7SL , but not the Apo-E gene. Histone H3 and TAF I 48 provide positive and negative controls, respectively. ( b ) Semiquantitative ChIP assay in <t>HeLa</t> cells showing occupancy of pol III, TFIIIB and TFIIIC at Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E genes. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock sample. ( c ) Mean±s.e.m. of the percentage input bound in three independent ChIP–quantitative PCR (qPCR) assays in HeLa cells, of the indicated proteins at individual Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E loci and Alu PV subfamily consensus. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock samples. P values are calculated by t -test. ( d ) Mean±s.e.m. of four independent sequential ChIP–qPCR assays in which <t>DNA</t> immunoprecipitated from HeLa cells using pol III antibody was reprecipitated using antibodies against pol III, TFIIIB, TAF I 48 (negative control), MBD1, MBD2 and MeCP2, as indicated. No TAF I 48 signal was detected on Alu(c6).
    Hela Input Dna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hela input dna/product/Illumina Inc
    Average 89 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    hela input dna - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    94
    Illumina Inc input dna
    Establishment of a high‐resolution MNase‐ChIP‐seq protocol for Trypanosoma brucei Outline of MNase‐ChIP‐seq. T. brucei cells were formaldehyde‐cross‐linked and permeabilized, and chromatin was digested into mononucleosomes using MNase. Nucleosomes containing histone H3 were isolated via affinity purification using rabbit H3 antiserum. After reversing cross‐links, the nucleosomal <t>DNA</t> was purified and paired‐end‐sequenced using <t>Illumina</t> HiSeq 2500. The sequencing reads were joined to fragments and assembled according to their midpoints. 2% agarose gel with 100 ng of mononucleosomal DNA after an MNase digest. Fragment size distribution after sequencing and joining of paired sequencing reads. Dashed lines indicate the fragment sizes 100, 137, 147, and 157 bp. Relative frequencies of AA/AT/TA/TT and CC/CG/GC/GG dinucleotides throughout 147 bp of nucleosomal DNA for each bp relative to the nucleosome dyad. Dashed lines indicate distance of 10 bp from position −74 bp.
    Input Dna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 224 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/input dna/product/Illumina Inc
    Average 94 stars, based on 224 article reviews
    Price from $9.99 to $1999.99
    input dna - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Genome-wide characterization of Runx2 occupied regions (R2ORs). C4-2B/Rx2 dox cells were subjected to Runx2 ChIP-seq analysis after dox treatment and immunoprecipitation of Runx2-bound DNA fragments with anti-FLAG antibodies. ( A ) ChIP-seq results showing R2ORs upstream of the KLK and CSF2 TSS s . Raw ChIP-seq data are presented as frequency of reads per location for 30 kb of DNA sequences at the KLK2 (top) and CSF2 (bottom) loci. For each locus, the upper track shows results for chromatin aliquoted prior to immunoprecipitation (input). Regions investigated in Figure 1 by conventional ChIP assays are marked by black bars. ( B ) Sixteen Runx2 ChIP-seq peaks were validated by conventional ChIP-qPCR and the ChIP-seq scores are plotted against the qPCR enrichment factors. ( C ) Distance from the 1603 top R2ORs to the nearest TSS were mapped (red) and are shown along with control distribution patterns of 1000 sets of 1603 matched random sequences (gray). Y -axis values are numbers of R2ORs per 15 kb window. ( D ) Genomic distribution of the 1603 top R2ORs (red bars) versus that of 1000 sets of matched random sequences (gray bars; mean ± SD). TSS refers to −1000 to +100 bp from 5′-end of annotated RNA. Transcription Termination Site ( TTS ) is defined as −100 to +1000 bp from the 3′-end of the transcript. Inset shows blow up of TTS and TTS data.

    Journal: Nucleic Acids Research

    Article Title: Genome-wide Runx2 occupancy in prostate cancer cells suggests a role in regulating secretion

    doi: 10.1093/nar/gkr1219

    Figure Lengend Snippet: Genome-wide characterization of Runx2 occupied regions (R2ORs). C4-2B/Rx2 dox cells were subjected to Runx2 ChIP-seq analysis after dox treatment and immunoprecipitation of Runx2-bound DNA fragments with anti-FLAG antibodies. ( A ) ChIP-seq results showing R2ORs upstream of the KLK and CSF2 TSS s . Raw ChIP-seq data are presented as frequency of reads per location for 30 kb of DNA sequences at the KLK2 (top) and CSF2 (bottom) loci. For each locus, the upper track shows results for chromatin aliquoted prior to immunoprecipitation (input). Regions investigated in Figure 1 by conventional ChIP assays are marked by black bars. ( B ) Sixteen Runx2 ChIP-seq peaks were validated by conventional ChIP-qPCR and the ChIP-seq scores are plotted against the qPCR enrichment factors. ( C ) Distance from the 1603 top R2ORs to the nearest TSS were mapped (red) and are shown along with control distribution patterns of 1000 sets of 1603 matched random sequences (gray). Y -axis values are numbers of R2ORs per 15 kb window. ( D ) Genomic distribution of the 1603 top R2ORs (red bars) versus that of 1000 sets of matched random sequences (gray bars; mean ± SD). TSS refers to −1000 to +100 bp from 5′-end of annotated RNA. Transcription Termination Site ( TTS ) is defined as −100 to +1000 bp from the 3′-end of the transcript. Inset shows blow up of TTS and TTS data.

    Article Snippet: ChIP-sequencing and peak calling Runx2 ChIP DNA along with ChIP input DNA were prepared as above from C4-2B/Rx2dox cells treated with dox for 14 h, and high throughput sequencing of the 500–1000 bp fragments was performed using Illumina Hi-Seq 2000.

    Techniques: Genome Wide, Chromatin Immunoprecipitation, Immunoprecipitation, Real-time Polymerase Chain Reaction

    DNA sequence motifs enriched in R2ORs. Motifs enriched in R2ORs compared to 1603 matched random sequences were identified using HOMER 3.1. ( A ) Logo for the top motif ( Runx2 ) is shown above the Runx1 logo identified by Pencovich et al. ( 35 ). ( B ) Motifs identified after R2ORs were re-analyzed as in A following masking of the Runx2 motifs. ( C ) Motif statistics. P- values are for motif enrichment. The percentages of R2ORs containing at least one copy of each motif are indicated against the percentage of motif-containing random sequences. Motifs/R2OR indicates for each motif the average number of copies per R2OR in R2ORs containing at least one copy.

    Journal: Nucleic Acids Research

    Article Title: Genome-wide Runx2 occupancy in prostate cancer cells suggests a role in regulating secretion

    doi: 10.1093/nar/gkr1219

    Figure Lengend Snippet: DNA sequence motifs enriched in R2ORs. Motifs enriched in R2ORs compared to 1603 matched random sequences were identified using HOMER 3.1. ( A ) Logo for the top motif ( Runx2 ) is shown above the Runx1 logo identified by Pencovich et al. ( 35 ). ( B ) Motifs identified after R2ORs were re-analyzed as in A following masking of the Runx2 motifs. ( C ) Motif statistics. P- values are for motif enrichment. The percentages of R2ORs containing at least one copy of each motif are indicated against the percentage of motif-containing random sequences. Motifs/R2OR indicates for each motif the average number of copies per R2OR in R2ORs containing at least one copy.

    Article Snippet: ChIP-sequencing and peak calling Runx2 ChIP DNA along with ChIP input DNA were prepared as above from C4-2B/Rx2dox cells treated with dox for 14 h, and high throughput sequencing of the 500–1000 bp fragments was performed using Illumina Hi-Seq 2000.

    Techniques: Sequencing

    Pol III co-occupies methylated SINEs with MBPs. ( a ) Semiquantitative ChIP assay in A31 fibroblasts showing specific binding of TFIIIB, TFIIIC and pol III to B1 and B2 loci, as well as 7SL , but not the Apo-E gene. Histone H3 and TAF I 48 provide positive and negative controls, respectively. ( b ) Semiquantitative ChIP assay in HeLa cells showing occupancy of pol III, TFIIIB and TFIIIC at Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E genes. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock sample. ( c ) Mean±s.e.m. of the percentage input bound in three independent ChIP–quantitative PCR (qPCR) assays in HeLa cells, of the indicated proteins at individual Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E loci and Alu PV subfamily consensus. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock samples. P values are calculated by t -test. ( d ) Mean±s.e.m. of four independent sequential ChIP–qPCR assays in which DNA immunoprecipitated from HeLa cells using pol III antibody was reprecipitated using antibodies against pol III, TFIIIB, TAF I 48 (negative control), MBD1, MBD2 and MeCP2, as indicated. No TAF I 48 signal was detected on Alu(c6).

    Journal: Nature Communications

    Article Title: SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    doi: 10.1038/ncomms7569

    Figure Lengend Snippet: Pol III co-occupies methylated SINEs with MBPs. ( a ) Semiquantitative ChIP assay in A31 fibroblasts showing specific binding of TFIIIB, TFIIIC and pol III to B1 and B2 loci, as well as 7SL , but not the Apo-E gene. Histone H3 and TAF I 48 provide positive and negative controls, respectively. ( b ) Semiquantitative ChIP assay in HeLa cells showing occupancy of pol III, TFIIIB and TFIIIC at Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E genes. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock sample. ( c ) Mean±s.e.m. of the percentage input bound in three independent ChIP–quantitative PCR (qPCR) assays in HeLa cells, of the indicated proteins at individual Alu loci from chromosomes 6, 10, 19 and 22, as well as 7SL and Apo-E loci and Alu PV subfamily consensus. ChIPs for histone H3 and TAF I 48 provide positive and negative controls, respectively. No antibody was used for the mock samples. P values are calculated by t -test. ( d ) Mean±s.e.m. of four independent sequential ChIP–qPCR assays in which DNA immunoprecipitated from HeLa cells using pol III antibody was reprecipitated using antibodies against pol III, TFIIIB, TAF I 48 (negative control), MBD1, MBD2 and MeCP2, as indicated. No TAF I 48 signal was detected on Alu(c6).

    Article Snippet: ChIP-BS-Seq library preparation and sequencing For HeLa input DNA, two libraries were prepared from the same input DNA: one with starting quantity of 10 ng, following the Illumina ChIP-Seq library protocol, with the addition of bisulfite conversion after addition of adaptors but before amplification; and one following the Illumina Bisulfite Sequencing protocol, including the recommended starting amount.

    Techniques: Methylation, Chromatin Immunoprecipitation, Binding Assay, Real-time Polymerase Chain Reaction, Immunoprecipitation, Negative Control

    SINE expression is not stimulated by loss of DNA methylation. ( a ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in matched Dnmt1 +/+ and Dnmt1 −/− fibroblasts. Duplicate samples are shown for both cell types. Apo-E and p53BP2 mRNAs provide controls that have been documented as being suppressed by DNA methylation. GAPDH mRNA provides a loading control. ( b ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in mouse ES cells treated for 16 h with (+) or without (−) 5-azacytidine. Apo-E mRNA provides a control that has been documented as being inhibited by DNA methylation. ARPP P0 mRNA provides a loading control. ( c ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in HeLa cells treated for 72 h with 5-azacytidine. Apo-E mRNA provides a control that has been documented as being inhibited by DNA methylation. ARPP P0 mRNA provides a loading control. ( d ) Analysis by primer extension of Alu transcripts in the RNA from Fig. 5c . Bracket indicates ~240 bp products that initiate at the principle pol III start site of Alu. Reverse transcriptase was omitted from the reactions in lanes 1 and 2. To confirm that the assay was not saturated, raising the amount of template RNA from 5 (lanes 5 and 6) to 10 μg (lanes 3 and 4) is shown to give a stronger signal. Alu, B1 and B2 RT–PCRs were performed with Alu, B1 and B2 consensus primers, respectively ( Supplementary Table 1 ).

    Journal: Nature Communications

    Article Title: SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    doi: 10.1038/ncomms7569

    Figure Lengend Snippet: SINE expression is not stimulated by loss of DNA methylation. ( a ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in matched Dnmt1 +/+ and Dnmt1 −/− fibroblasts. Duplicate samples are shown for both cell types. Apo-E and p53BP2 mRNAs provide controls that have been documented as being suppressed by DNA methylation. GAPDH mRNA provides a loading control. ( b ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in mouse ES cells treated for 16 h with (+) or without (−) 5-azacytidine. Apo-E mRNA provides a control that has been documented as being inhibited by DNA methylation. ARPP P0 mRNA provides a loading control. ( c ) Analysis by semiquantitative RT–PCR of expression levels of the indicated transcripts in HeLa cells treated for 72 h with 5-azacytidine. Apo-E mRNA provides a control that has been documented as being inhibited by DNA methylation. ARPP P0 mRNA provides a loading control. ( d ) Analysis by primer extension of Alu transcripts in the RNA from Fig. 5c . Bracket indicates ~240 bp products that initiate at the principle pol III start site of Alu. Reverse transcriptase was omitted from the reactions in lanes 1 and 2. To confirm that the assay was not saturated, raising the amount of template RNA from 5 (lanes 5 and 6) to 10 μg (lanes 3 and 4) is shown to give a stronger signal. Alu, B1 and B2 RT–PCRs were performed with Alu, B1 and B2 consensus primers, respectively ( Supplementary Table 1 ).

    Article Snippet: ChIP-BS-Seq library preparation and sequencing For HeLa input DNA, two libraries were prepared from the same input DNA: one with starting quantity of 10 ng, following the Illumina ChIP-Seq library protocol, with the addition of bisulfite conversion after addition of adaptors but before amplification; and one following the Illumina Bisulfite Sequencing protocol, including the recommended starting amount.

    Techniques: Expressing, DNA Methylation Assay, Reverse Transcription Polymerase Chain Reaction

    DNA methylation does not prevent pol III occupancy of SINEs. ( a ) Percentage input bound in three independent ChIP–quantitative PCR (qPCR) assays with mouse ES cells treated for 16 h with (+) or without (−) 5-azacytidine, showing occupancy of MBD2, MeCP2 and pol III at 7SL, B1 and B2 loci, as well as an Alu inserted onto chromosomes 14 and 17. ChIPs for TAF I 48 and without antibody (mock) provide negative controls. ( b ) Percentage input bound in three independent ChIP–qPCR assays with HeLa cells treated for 72 h with (+) or without (−) 5-azacytidine, showing the binding of MBD2, TFIIIB, TFIIIC and pol III to DNA centred over the body of Alu(c22) or 200 bp downstream. The resolution of this assay is limited by the size of the genomic DNA fragments (~500 bp). ( c ) Percentage input bound in two independent ChIP–qPCR assays with matched Dnmt1 +/+ and Dnmt1 −/− fibroblasts showing occupancy of MBD2, TFIIIB, TFIIIC and pol III at B1 and B2 loci, as well as 7SL and Apo-E genes. ChIPs for TAF I 48 and without antibody (mock) provide negative controls. Error bars indicate s.e.m. and all P values are calculated by t -test.

    Journal: Nature Communications

    Article Title: SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    doi: 10.1038/ncomms7569

    Figure Lengend Snippet: DNA methylation does not prevent pol III occupancy of SINEs. ( a ) Percentage input bound in three independent ChIP–quantitative PCR (qPCR) assays with mouse ES cells treated for 16 h with (+) or without (−) 5-azacytidine, showing occupancy of MBD2, MeCP2 and pol III at 7SL, B1 and B2 loci, as well as an Alu inserted onto chromosomes 14 and 17. ChIPs for TAF I 48 and without antibody (mock) provide negative controls. ( b ) Percentage input bound in three independent ChIP–qPCR assays with HeLa cells treated for 72 h with (+) or without (−) 5-azacytidine, showing the binding of MBD2, TFIIIB, TFIIIC and pol III to DNA centred over the body of Alu(c22) or 200 bp downstream. The resolution of this assay is limited by the size of the genomic DNA fragments (~500 bp). ( c ) Percentage input bound in two independent ChIP–qPCR assays with matched Dnmt1 +/+ and Dnmt1 −/− fibroblasts showing occupancy of MBD2, TFIIIB, TFIIIC and pol III at B1 and B2 loci, as well as 7SL and Apo-E genes. ChIPs for TAF I 48 and without antibody (mock) provide negative controls. Error bars indicate s.e.m. and all P values are calculated by t -test.

    Article Snippet: ChIP-BS-Seq library preparation and sequencing For HeLa input DNA, two libraries were prepared from the same input DNA: one with starting quantity of 10 ng, following the Illumina ChIP-Seq library protocol, with the addition of bisulfite conversion after addition of adaptors but before amplification; and one following the Illumina Bisulfite Sequencing protocol, including the recommended starting amount.

    Techniques: DNA Methylation Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay

    Establishment of a high‐resolution MNase‐ChIP‐seq protocol for Trypanosoma brucei Outline of MNase‐ChIP‐seq. T. brucei cells were formaldehyde‐cross‐linked and permeabilized, and chromatin was digested into mononucleosomes using MNase. Nucleosomes containing histone H3 were isolated via affinity purification using rabbit H3 antiserum. After reversing cross‐links, the nucleosomal DNA was purified and paired‐end‐sequenced using Illumina HiSeq 2500. The sequencing reads were joined to fragments and assembled according to their midpoints. 2% agarose gel with 100 ng of mononucleosomal DNA after an MNase digest. Fragment size distribution after sequencing and joining of paired sequencing reads. Dashed lines indicate the fragment sizes 100, 137, 147, and 157 bp. Relative frequencies of AA/AT/TA/TT and CC/CG/GC/GG dinucleotides throughout 147 bp of nucleosomal DNA for each bp relative to the nucleosome dyad. Dashed lines indicate distance of 10 bp from position −74 bp.

    Journal: The EMBO Journal

    Article Title: GT‐rich promoters can drive RNA pol II transcription and deposition of H2A.Z in African trypanosomes

    doi: 10.15252/embj.201695323

    Figure Lengend Snippet: Establishment of a high‐resolution MNase‐ChIP‐seq protocol for Trypanosoma brucei Outline of MNase‐ChIP‐seq. T. brucei cells were formaldehyde‐cross‐linked and permeabilized, and chromatin was digested into mononucleosomes using MNase. Nucleosomes containing histone H3 were isolated via affinity purification using rabbit H3 antiserum. After reversing cross‐links, the nucleosomal DNA was purified and paired‐end‐sequenced using Illumina HiSeq 2500. The sequencing reads were joined to fragments and assembled according to their midpoints. 2% agarose gel with 100 ng of mononucleosomal DNA after an MNase digest. Fragment size distribution after sequencing and joining of paired sequencing reads. Dashed lines indicate the fragment sizes 100, 137, 147, and 157 bp. Relative frequencies of AA/AT/TA/TT and CC/CG/GC/GG dinucleotides throughout 147 bp of nucleosomal DNA for each bp relative to the nucleosome dyad. Dashed lines indicate distance of 10 bp from position −74 bp.

    Article Snippet: ChIP‐seq libraries were constructed using 35 ng of immunoprecipitated DNA or 35 ng of input DNA and sequenced on an Illumina® HiSeq 2500 or NextSeq 500.

    Techniques: Chromatin Immunoprecipitation, Isolation, Affinity Purification, Purification, Sequencing, Agarose Gel Electrophoresis

    Preliminary characterization of Psa transposon mutants. (A) Colony size variation between wild-type Psa (left) and transposon mutants (right). A region of each plate, boxed in black, is enlarged (2×) for comparison; (B) Evaluation of the ability of transposon mutants to express GUS on KB-Km agar medium containing X-Gluc; (C) Arbitrary PCR to amplify transposon insertion sites from the genomic DNA of 32 independent transposon mutants (1–32). PCR amplicons from samples labelled in red were sequenced to characterize the specific location(s) of genome insertion by the transposon. M = DNA ladder, bp = base pairs,– = H 2 O negative control, WT = wild-type Psa genomic DNA.

    Journal: PLoS ONE

    Article Title: Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    doi: 10.1371/journal.pone.0172790

    Figure Lengend Snippet: Preliminary characterization of Psa transposon mutants. (A) Colony size variation between wild-type Psa (left) and transposon mutants (right). A region of each plate, boxed in black, is enlarged (2×) for comparison; (B) Evaluation of the ability of transposon mutants to express GUS on KB-Km agar medium containing X-Gluc; (C) Arbitrary PCR to amplify transposon insertion sites from the genomic DNA of 32 independent transposon mutants (1–32). PCR amplicons from samples labelled in red were sequenced to characterize the specific location(s) of genome insertion by the transposon. M = DNA ladder, bp = base pairs,– = H 2 O negative control, WT = wild-type Psa genomic DNA.

    Article Snippet: An Illumina TruSeq Nano library was then created with ~1 μg input DNA using a Tru-Seq DNA Low-Throughput (LT) PCR-Free Library Kit (Illumina).

    Techniques: Polymerase Chain Reaction, Negative Control

    Validation of the Psa mutant of interest (MOI) library. (A) PCR screen to identify disruptions in the IYO_023025 gene. Pooled genomic DNA samples from the columns (lanes 1–12) and rows (lanes A–H) of MOI library plate 3 (P3) were used as templates for PCR. Two sets of amplicons that share a specific IYO_023025 disruption across a single pooled column and row sample are boxed in green and red, respectively; (B) Location of the P3-G10 and P3-D4 wells, which contain a mutant with an IYO_023025 disruption specific to the PCR amplicons boxed in green and red in (A), respectively; (C) Schematic of the IYO_023025 gene showing the location of transposon insertion sites identified in (A). Transposon insertion sites are denoted by arrows, and are color-coded to match the PCR amplicons boxed green and red in (A); (D) PCR screen to identify the IYO_023025 disruption mutant from well P3-G10. Pooled genomic DNA samples from the columns and rows of a 96-well plate (P2) containing independent colony-forming units of well P3-G10 were used as templates for PCR; (E) Location of intersecting wells in P2 (dark green) that possibly contain the IYO_023025 P3-G10 disruption mutant, as determined by the PCR amplicon profile in (D); (F) PCR screen to determine which of the intersecting wells in (E) contain the IYO_023025 P3-G10 disruption mutant. Amplicons shown in the left and right panels (separated by a black line) are derived from different regions of the same gel. Wells that contain the mutant are shown in bold in (E); (G) Colony morphology of wild-type (WT) Psa and the IYO_023025 P3-G10 disruption mutant. Bar = 2 μM, M = DNA ladder, bp = base pairs,– = H 2 O negative control, WT = WT Psa DNA.

    Journal: PLoS ONE

    Article Title: Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    doi: 10.1371/journal.pone.0172790

    Figure Lengend Snippet: Validation of the Psa mutant of interest (MOI) library. (A) PCR screen to identify disruptions in the IYO_023025 gene. Pooled genomic DNA samples from the columns (lanes 1–12) and rows (lanes A–H) of MOI library plate 3 (P3) were used as templates for PCR. Two sets of amplicons that share a specific IYO_023025 disruption across a single pooled column and row sample are boxed in green and red, respectively; (B) Location of the P3-G10 and P3-D4 wells, which contain a mutant with an IYO_023025 disruption specific to the PCR amplicons boxed in green and red in (A), respectively; (C) Schematic of the IYO_023025 gene showing the location of transposon insertion sites identified in (A). Transposon insertion sites are denoted by arrows, and are color-coded to match the PCR amplicons boxed green and red in (A); (D) PCR screen to identify the IYO_023025 disruption mutant from well P3-G10. Pooled genomic DNA samples from the columns and rows of a 96-well plate (P2) containing independent colony-forming units of well P3-G10 were used as templates for PCR; (E) Location of intersecting wells in P2 (dark green) that possibly contain the IYO_023025 P3-G10 disruption mutant, as determined by the PCR amplicon profile in (D); (F) PCR screen to determine which of the intersecting wells in (E) contain the IYO_023025 P3-G10 disruption mutant. Amplicons shown in the left and right panels (separated by a black line) are derived from different regions of the same gel. Wells that contain the mutant are shown in bold in (E); (G) Colony morphology of wild-type (WT) Psa and the IYO_023025 P3-G10 disruption mutant. Bar = 2 μM, M = DNA ladder, bp = base pairs,– = H 2 O negative control, WT = WT Psa DNA.

    Article Snippet: An Illumina TruSeq Nano library was then created with ~1 μg input DNA using a Tru-Seq DNA Low-Throughput (LT) PCR-Free Library Kit (Illumina).

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Derivative Assay, Negative Control