dna fragments  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs dna fragments
    Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo <t>DNA</t> methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by <t>LM-PCR</t> and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.
    Dna Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 502 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna fragments/product/New England Biolabs
    Average 94 stars, based on 502 article reviews
    Price from $9.99 to $1999.99
    dna fragments - by Bioz Stars, 2020-07
    94/100 stars

    Images

    1) Product Images from "A highly sensitive in vivo footprinting technique for condition-dependent identification of cis elements"

    Article Title: A highly sensitive in vivo footprinting technique for condition-dependent identification of cis elements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt883

    Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo DNA methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by LM-PCR and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.
    Figure Legend Snippet: Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo DNA methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by LM-PCR and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.

    Techniques Used: Software, High Throughput Screening Assay, In Vivo, Footprinting, DNA Methylation Assay, DNA Extraction, Polymerase Chain Reaction, Sequencing

    2) Product Images from "Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6"

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6

    Journal: BMC Developmental Biology

    doi: 10.1186/1471-213X-14-17

    Direct transcriptional regulators of lin-39 in the embryo and larva. A) Horizontal lines represent 20 kb of genomic DNA surrounding the lin-39 locus. The lin-39 transcript is shown below the top line, with boxes representing exons. The next horizontal line shows evolutionarily-conserved regions (ECRs; thin vertical lines), the PCR fragments used in the yeast one hybrid assays containing the ECRs (boxes labeled 1–12), and two fragments ( pJW3.9 shown, JW5 unlabeled) identified previously using an enhancerless GFP assay [ 47 ]. Transcription factors that bind the lin-39 gene are shown above the line (previously reported) or below the line (reported in this work). B) Model for positive feedback loop between egl-18 / elt-6 and lin-39 . EGL-18 and ELT-6 act via the GATA site in enhancer pJW3.9 to facilitate initiation of lin-39 expression in the embryo, and then LIN-39 acts to positively regulate egl-18 / elt-6 expression via the Hox/Pbx binding site in the intron of egl-18 [ 55 ].
    Figure Legend Snippet: Direct transcriptional regulators of lin-39 in the embryo and larva. A) Horizontal lines represent 20 kb of genomic DNA surrounding the lin-39 locus. The lin-39 transcript is shown below the top line, with boxes representing exons. The next horizontal line shows evolutionarily-conserved regions (ECRs; thin vertical lines), the PCR fragments used in the yeast one hybrid assays containing the ECRs (boxes labeled 1–12), and two fragments ( pJW3.9 shown, JW5 unlabeled) identified previously using an enhancerless GFP assay [ 47 ]. Transcription factors that bind the lin-39 gene are shown above the line (previously reported) or below the line (reported in this work). B) Model for positive feedback loop between egl-18 / elt-6 and lin-39 . EGL-18 and ELT-6 act via the GATA site in enhancer pJW3.9 to facilitate initiation of lin-39 expression in the embryo, and then LIN-39 acts to positively regulate egl-18 / elt-6 expression via the Hox/Pbx binding site in the intron of egl-18 [ 55 ].

    Techniques Used: Polymerase Chain Reaction, Labeling, Activated Clotting Time Assay, Expressing, Binding Assay

    3) Product Images from "Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response"

    Article Title: Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response

    Journal: Cell Research

    doi: 10.1038/cr.2016.118

    A functional UPR mt pathway in neurons is required for peripheral induction of UPR mt . (A) Targeting sequences of UPR mt pathway genes for CRISPR-Cas9 knockout, together with their PAM sequences. (B) Deletions of UPR mt pathway genes produced by CRISPR/Cas9 are detected by T7E1 assay. Representative DNA gels of T7E1 assay reveals the PCR products amplified from genomic DNA of control worms, or worms with UPR mt pathway gene deletion in the nervous system. (C , D) Neural knockout of atfs-1 or dve-1 suppresses the UPR mt in distal tissues in rab-3p ::Cas9+ u6p :: spg-7 -sg worms. Representative fluorescent images (C) and quantification of hsp-6p ::GFP reporter expression (D) in animals containing rab-3p ::Cas9+ u6p :: spg-7 -sg (control) or rab-3p ::Cas9+ u6p :: spg-7 -sg with neural-specific knockout of UPR mt genes are shown. mec-7p ::RFP is used as co-injection marker. n ≥ 28, error bars indicate mean ±SE. A Student's t -test is used to assess significance: * P
    Figure Legend Snippet: A functional UPR mt pathway in neurons is required for peripheral induction of UPR mt . (A) Targeting sequences of UPR mt pathway genes for CRISPR-Cas9 knockout, together with their PAM sequences. (B) Deletions of UPR mt pathway genes produced by CRISPR/Cas9 are detected by T7E1 assay. Representative DNA gels of T7E1 assay reveals the PCR products amplified from genomic DNA of control worms, or worms with UPR mt pathway gene deletion in the nervous system. (C , D) Neural knockout of atfs-1 or dve-1 suppresses the UPR mt in distal tissues in rab-3p ::Cas9+ u6p :: spg-7 -sg worms. Representative fluorescent images (C) and quantification of hsp-6p ::GFP reporter expression (D) in animals containing rab-3p ::Cas9+ u6p :: spg-7 -sg (control) or rab-3p ::Cas9+ u6p :: spg-7 -sg with neural-specific knockout of UPR mt genes are shown. mec-7p ::RFP is used as co-injection marker. n ≥ 28, error bars indicate mean ±SE. A Student's t -test is used to assess significance: * P

    Techniques Used: Functional Assay, CRISPR, Knock-Out, Produced, Polymerase Chain Reaction, Amplification, Expressing, Injection, Marker

    Neural-specific knockout of mitochondrial genes induces cell non-autonomous UPR mt . (A) Targeting sequences for CRISPR-Cas9 knockout of spg-7 or cco-1 , together with their PAM sequences. (B) Knockout of spg-7 in intestine activates hsp-6p ::GFP reporter cell autonomously. odr-1p ::dsRed is used as the co-injection marker. (C) Deletions of spg-7 or cco-1 by CRISPR/Cas9 are detected by T7E1 assay. Representative DNA gels of T7E1 assay show spg-7 or cco-1 PCR products amplified from genomic DNA of hsp-6 p::GFP worms (control), or unc-119p ::Cas9+ u6p :: spg-7 -sg(left), rab-3p ::Cas9+ u6p :: cco-1 -sg(right) worms. (D) Neural-specific knockout of spg-7 or cco-1 activates hsp-6p ::GFP in distal tissues. (E) Western blotting shows the increasing level of hsp-6p ::GFP in rab-3p ::Cas9+ u6p :: spg-7 -sg strain. The control lysate is from hsp-6p ::GFP strain. Cell lysates are probed with GFP antibody. Tubulin is used as a loading control. (F , G) Neural knockout of spg-7 fails to induce UPR ER or HSR in distal tissues. As positive controls, tunicamycin treatment robustly induces hsp-4p ::GFP reporter, heat shock 1 h at 34 °C robustly induces hsp-16.2p ::GFP reporter.
    Figure Legend Snippet: Neural-specific knockout of mitochondrial genes induces cell non-autonomous UPR mt . (A) Targeting sequences for CRISPR-Cas9 knockout of spg-7 or cco-1 , together with their PAM sequences. (B) Knockout of spg-7 in intestine activates hsp-6p ::GFP reporter cell autonomously. odr-1p ::dsRed is used as the co-injection marker. (C) Deletions of spg-7 or cco-1 by CRISPR/Cas9 are detected by T7E1 assay. Representative DNA gels of T7E1 assay show spg-7 or cco-1 PCR products amplified from genomic DNA of hsp-6 p::GFP worms (control), or unc-119p ::Cas9+ u6p :: spg-7 -sg(left), rab-3p ::Cas9+ u6p :: cco-1 -sg(right) worms. (D) Neural-specific knockout of spg-7 or cco-1 activates hsp-6p ::GFP in distal tissues. (E) Western blotting shows the increasing level of hsp-6p ::GFP in rab-3p ::Cas9+ u6p :: spg-7 -sg strain. The control lysate is from hsp-6p ::GFP strain. Cell lysates are probed with GFP antibody. Tubulin is used as a loading control. (F , G) Neural knockout of spg-7 fails to induce UPR ER or HSR in distal tissues. As positive controls, tunicamycin treatment robustly induces hsp-4p ::GFP reporter, heat shock 1 h at 34 °C robustly induces hsp-16.2p ::GFP reporter.

    Techniques Used: Knock-Out, CRISPR, Injection, Marker, Polymerase Chain Reaction, Amplification, Western Blot

    4) Product Images from "Efficient Genome Editing of a Facultative Thermophile Using Mesophilic spCas9"

    Article Title: Efficient Genome Editing of a Facultative Thermophile Using Mesophilic spCas9

    Journal: ACS Synthetic Biology

    doi: 10.1021/acssynbio.6b00339

    Schematic overview of the basic pWUR_Cas9nt construct. (A) The non-codon-optimized cas9 sp gene was employed for the construction of the pWUR_Cas9nt vector, since S. pyogenes and B. smithii GC content and codon usage are highly similar. In the pNW33n-based basic construct, s pCas9 was placed under the control of P xynA . A Rho-independent terminator from B. subtilis ( 59 ) was introduced after the stop codon of the gene. The spCas9 module is followed by an sgRNA-expressing module that encompasses a spacer which does not target the genome of ET 138. The sgRNA module was placed under the transcriptional control of P pta from B. coagulans (without its RBS), which was followed by a second Rho-independent terminator from B. subtilis . 15 , 49 The spCas9 and sgRNA modules were synthesized as one fragment, which was subsequently cloned into pNW33n through the BspHI and HindIII restriction sites. (B) To prevent double restriction sites and create a modular system, five silent point mutations (C192A, T387C, T1011A, C3126A, G354A) were introduced to the gene (depicted as *). The depicted restriction sites are unique in the construct and introduced to facilitate the exchange of genetic parts. The spacer was easily exchanged to targeting spacers via BsmBI restriction digestion or Gibson assembly. The basic construct did not contain any HR templates, but in cases where these were added, they were always inserted immediately upstream of the spCas9 module and downstream of the origin of replication. (C) Total RNA was isolated from ET 138 wild-type cells transformed with pWUR_Cas9nt or pNW33n and grown at 55, 45, and 37 °C. Six cDNA libraries were produced with rt-PCR and used as templates for PCR with cas9sp-specific primers that amplify a 255 bp region. The PCR results are depicted as follows: lane 1 corresponds to the marker (1kb+ DNA ladder, ThermoFisher), lanes 2–4 correspond to ET 138 wild-type cultures transformed with pWUR_Cas9nt and grown at 55, 42, or 37 °C, respectively, lanes 5–7 correspond to ET 138 wild-type cultures transformed with pNW33n and grown at 55, 42, or 37 °C, respectively, lanes 7, 8, 9, 11, 12 correspond to different negative controls, and lane 10 corresponds to the positive control, for which pWUR_Cas9nt was used as the PCR template.
    Figure Legend Snippet: Schematic overview of the basic pWUR_Cas9nt construct. (A) The non-codon-optimized cas9 sp gene was employed for the construction of the pWUR_Cas9nt vector, since S. pyogenes and B. smithii GC content and codon usage are highly similar. In the pNW33n-based basic construct, s pCas9 was placed under the control of P xynA . A Rho-independent terminator from B. subtilis ( 59 ) was introduced after the stop codon of the gene. The spCas9 module is followed by an sgRNA-expressing module that encompasses a spacer which does not target the genome of ET 138. The sgRNA module was placed under the transcriptional control of P pta from B. coagulans (without its RBS), which was followed by a second Rho-independent terminator from B. subtilis . 15 , 49 The spCas9 and sgRNA modules were synthesized as one fragment, which was subsequently cloned into pNW33n through the BspHI and HindIII restriction sites. (B) To prevent double restriction sites and create a modular system, five silent point mutations (C192A, T387C, T1011A, C3126A, G354A) were introduced to the gene (depicted as *). The depicted restriction sites are unique in the construct and introduced to facilitate the exchange of genetic parts. The spacer was easily exchanged to targeting spacers via BsmBI restriction digestion or Gibson assembly. The basic construct did not contain any HR templates, but in cases where these were added, they were always inserted immediately upstream of the spCas9 module and downstream of the origin of replication. (C) Total RNA was isolated from ET 138 wild-type cells transformed with pWUR_Cas9nt or pNW33n and grown at 55, 45, and 37 °C. Six cDNA libraries were produced with rt-PCR and used as templates for PCR with cas9sp-specific primers that amplify a 255 bp region. The PCR results are depicted as follows: lane 1 corresponds to the marker (1kb+ DNA ladder, ThermoFisher), lanes 2–4 correspond to ET 138 wild-type cultures transformed with pWUR_Cas9nt and grown at 55, 42, or 37 °C, respectively, lanes 5–7 correspond to ET 138 wild-type cultures transformed with pNW33n and grown at 55, 42, or 37 °C, respectively, lanes 7, 8, 9, 11, 12 correspond to different negative controls, and lane 10 corresponds to the positive control, for which pWUR_Cas9nt was used as the PCR template.

    Techniques Used: Construct, Plasmid Preparation, Expressing, Synthesized, Clone Assay, Isolation, Transformation Assay, Produced, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Marker, Positive Control

    5) Product Images from "Conversion of 5-Methylcytosine to 5-Hydroxymethylcytosine in Mammalian DNA by MLL Partner TET1"

    Article Title: Conversion of 5-Methylcytosine to 5-Hydroxymethylcytosine in Mammalian DNA by MLL Partner TET1

    Journal: Science (New York, N.Y.)

    doi: 10.1126/science.1170116

    The modified nucleotide is identified as 5-hydroxymethylcytosine. ( A ) Genomic DNA from T4 phage grown in UDP-glucose–deficient E. coli ER1656 (T4*) and HEK293 cells transfected with wild-type or mutant TET1-CD were digested with Taq α I.
    Figure Legend Snippet: The modified nucleotide is identified as 5-hydroxymethylcytosine. ( A ) Genomic DNA from T4 phage grown in UDP-glucose–deficient E. coli ER1656 (T4*) and HEK293 cells transfected with wild-type or mutant TET1-CD were digested with Taq α I.

    Techniques Used: Modification, Transfection, Mutagenesis

    6) Product Images from "Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo"

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0201880

    Construction of HSV-2 mutant viruses with mutated SIAH binding motifs in ICP0. ( A ) Depiction of homologous recombination. The native ICP0 sequence in HSV-2 strain MS was exchanged by a sequence encoding ICP0-eGFP fusion protein. ( B ) Maps of the various ICP0 constructs. The wild-type gene is located in the HSV-2 TR L region. The various ICP0-GFP DNA sequences were accordingly adjusted to reduce their GC content. The NxN1 and NxN2 mutations in the SIAH-1 binding domains are marked in red. Sequences recognized by Southern blot probes are marked in blue.
    Figure Legend Snippet: Construction of HSV-2 mutant viruses with mutated SIAH binding motifs in ICP0. ( A ) Depiction of homologous recombination. The native ICP0 sequence in HSV-2 strain MS was exchanged by a sequence encoding ICP0-eGFP fusion protein. ( B ) Maps of the various ICP0 constructs. The wild-type gene is located in the HSV-2 TR L region. The various ICP0-GFP DNA sequences were accordingly adjusted to reduce their GC content. The NxN1 and NxN2 mutations in the SIAH-1 binding domains are marked in red. Sequences recognized by Southern blot probes are marked in blue.

    Techniques Used: Mutagenesis, Binding Assay, Homologous Recombination, Sequencing, Mass Spectrometry, Construct, Southern Blot

    NxN1/2 mutation in ICP0 results in delayed and reduced vital DNA and protein synthesis. ( A ) U2OS cells, and ( B ) HepaRG cells were infected with HSV-2-ICP0-GFP (ICP0-GFP) or HSV-2-ICP0 NxN1/2 -GFP (NxN1/2-GFP) at an MOI of 2 or 1 pfu/cell, respectively. Infected cells were harvested at the indicated time points post infection (p.i.) for isolation of genomic and viral DNA. Viral DNA copies were determined by quantitative real-time PCR using oligonucleotide-primers and probes directed against the UL27 gene encoding glycoprotein gB. Copy numbers were normalized to the sequence of the human single-copy beta-globin gene (HBG). ( C ) U2OS cells, and ( D ) HepaRG cells were infected with HSV-2-ICP0-GFP or HSV-2-ICP0 NxN1/2 .
    Figure Legend Snippet: NxN1/2 mutation in ICP0 results in delayed and reduced vital DNA and protein synthesis. ( A ) U2OS cells, and ( B ) HepaRG cells were infected with HSV-2-ICP0-GFP (ICP0-GFP) or HSV-2-ICP0 NxN1/2 -GFP (NxN1/2-GFP) at an MOI of 2 or 1 pfu/cell, respectively. Infected cells were harvested at the indicated time points post infection (p.i.) for isolation of genomic and viral DNA. Viral DNA copies were determined by quantitative real-time PCR using oligonucleotide-primers and probes directed against the UL27 gene encoding glycoprotein gB. Copy numbers were normalized to the sequence of the human single-copy beta-globin gene (HBG). ( C ) U2OS cells, and ( D ) HepaRG cells were infected with HSV-2-ICP0-GFP or HSV-2-ICP0 NxN1/2 .

    Techniques Used: Mutagenesis, Infection, Isolation, Real-time Polymerase Chain Reaction, Sequencing

    7) Product Images from "Sp1-mediated microRNA-182 expression regulates lung cancer progression"

    Article Title: Sp1-mediated microRNA-182 expression regulates lung cancer progression

    Journal: Oncotarget

    doi:

    Sp1 regulates miR-182 expression (A) Scramble (shScr) and different doses of Sp1 shRNAs (shSp1) were transfected into A549 for 48 h. The miR-182 level was determined by stem-loop RT-PCR. U6 served as the internal control (panel a). Data were quantified after three independent experiments (panel b). (B) Different titer of adeno-GFP-Sp1 virus was infected IMR-90 cells for 48 h. The miR-182 level was determined by stem-loop RT-PCR (panel a). Data were quantified after three independent experiments (panel b). (C) Plasmids, pGL2 or pGL2-miR-182 (-1000/+50), and GFP or GFP-Sp1 were co-transfected into H1299 cells for 24h. Cells were harvested to study the luciferase activity. Data were quantified after three independent experiments. (D) The plasmids, pGL2 or pGL2-miR-182, were transfected into H1299 cells with mithramycin A treatment for 24 h. Cells were harvested for luciferase activity assays. (E) Schematic diagram indicates the location of putative Sp1 binding sites on miR-182 promoter region (panel a). ChIP assays were performed with anti-acetyl-H3 (panel b), and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes, and samples were analyzed by Western blotting using anti-Sp1 antibodies (panel a). Data were quantified after three independent experiments (panel b). (G) Plasmids, GFP or GFP-Sp1, were co-transfected with pGL2, pGL2-miR-182 WT or mutation plasmids into H1299 cells for 24 h, and then cells were harvested for luciferase activity assays. Data are representative of three independent experiments, each of which was performed in triplicate, and presented as the mean ± SEM. The level of statistical significance determined by t -test (*, p
    Figure Legend Snippet: Sp1 regulates miR-182 expression (A) Scramble (shScr) and different doses of Sp1 shRNAs (shSp1) were transfected into A549 for 48 h. The miR-182 level was determined by stem-loop RT-PCR. U6 served as the internal control (panel a). Data were quantified after three independent experiments (panel b). (B) Different titer of adeno-GFP-Sp1 virus was infected IMR-90 cells for 48 h. The miR-182 level was determined by stem-loop RT-PCR (panel a). Data were quantified after three independent experiments (panel b). (C) Plasmids, pGL2 or pGL2-miR-182 (-1000/+50), and GFP or GFP-Sp1 were co-transfected into H1299 cells for 24h. Cells were harvested to study the luciferase activity. Data were quantified after three independent experiments. (D) The plasmids, pGL2 or pGL2-miR-182, were transfected into H1299 cells with mithramycin A treatment for 24 h. Cells were harvested for luciferase activity assays. (E) Schematic diagram indicates the location of putative Sp1 binding sites on miR-182 promoter region (panel a). ChIP assays were performed with anti-acetyl-H3 (panel b), and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes, and samples were analyzed by Western blotting using anti-Sp1 antibodies (panel a). Data were quantified after three independent experiments (panel b). (G) Plasmids, GFP or GFP-Sp1, were co-transfected with pGL2, pGL2-miR-182 WT or mutation plasmids into H1299 cells for 24 h, and then cells were harvested for luciferase activity assays. Data are representative of three independent experiments, each of which was performed in triplicate, and presented as the mean ± SEM. The level of statistical significance determined by t -test (*, p

    Techniques Used: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Infection, Luciferase, Activity Assay, Binding Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Western Blot, Mutagenesis

    8) Product Images from "Refined Requirements for Protein Regions Important for Activity of the TALE AvrBs3"

    Article Title: Refined Requirements for Protein Regions Important for Activity of the TALE AvrBs3

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0120214

    Cysteines in AvrBs3 repeats are required for target gene induction. ( A ) Constructs used for Agrobacterium -mediated T-DNA delivery into leaves of N . benthamiana . The effector construct allows expression of 4× c-Myc-tagged AvrBs3 derivatives under control of the 35S promoter. The reporter construct contains the 19-bp effector binding element (EBE) of AvrBs3 in front of the tomato Bs4 -minimal promoter driving the uidA (GUS) reporter gene [ 47 ]. LB, left border; RB, right border. ( B ) GUS activity was determined in N . benthamiana leaves three days after Agrobacterium -mediated co-delivery of the reporter construct with silencing inhibitor p19 and effector constructs encoding AvrBs3 or derivatives. GFP served as negative, 35S : uidA as positive control. Gene-inducing activities of the AvrBs3 derivatives were determined relative to the GUS activity induced by the WT AvrBs3 protein (set to 100%). Grey box, T3S signal; black boxes, NLSs; black arrow, AD. White ovals represent WT repeats, grey and black ovals denote repeats with C30S and C30A substitutions, respectively. The C-terminal region of AvrBs3 containing C912S and C963S substitutions is indicated in grey. Errors bars indicate standard deviations (SD). Asterisks indicate statistically significant differences to GUS activity induced by WT AvrBs3 ( t -test; *, P
    Figure Legend Snippet: Cysteines in AvrBs3 repeats are required for target gene induction. ( A ) Constructs used for Agrobacterium -mediated T-DNA delivery into leaves of N . benthamiana . The effector construct allows expression of 4× c-Myc-tagged AvrBs3 derivatives under control of the 35S promoter. The reporter construct contains the 19-bp effector binding element (EBE) of AvrBs3 in front of the tomato Bs4 -minimal promoter driving the uidA (GUS) reporter gene [ 47 ]. LB, left border; RB, right border. ( B ) GUS activity was determined in N . benthamiana leaves three days after Agrobacterium -mediated co-delivery of the reporter construct with silencing inhibitor p19 and effector constructs encoding AvrBs3 or derivatives. GFP served as negative, 35S : uidA as positive control. Gene-inducing activities of the AvrBs3 derivatives were determined relative to the GUS activity induced by the WT AvrBs3 protein (set to 100%). Grey box, T3S signal; black boxes, NLSs; black arrow, AD. White ovals represent WT repeats, grey and black ovals denote repeats with C30S and C30A substitutions, respectively. The C-terminal region of AvrBs3 containing C912S and C963S substitutions is indicated in grey. Errors bars indicate standard deviations (SD). Asterisks indicate statistically significant differences to GUS activity induced by WT AvrBs3 ( t -test; *, P

    Techniques Used: Construct, Expressing, Binding Assay, Activity Assay, Positive Control

    AvrBs3 cysteine mutants do not compete with AvrBs3 for DNA binding in planta . ( A ) T-DNA constructs used. Two different effector constructs, A and B, allow expression of (A) GFP- or (B) 4× c-Myc tagged AvrBs3 and derivatives under control of the 35S promoter. The reporter construct contains the 19-bp UPA20 UPA box in front of the tomato Bs4 minimal promoter driving a promoterless uidA reporter gene [ 48 ]. LB, left border; RB, right border. ( B ) GUS activity was determined in N . benthamiana leaves three days after Agrobacterium -mediated co-delivery of the reporter construct with the avrBs3 - or gfp construct (effector construct A) and effector construct B encoding one of the indicated proteins. Values are displayed relative to the GUS activity induced by GFP and WT AvrBs3. Error bars indicate SD. 35S : uidA served as control. Asterisks indicate statistically significant differences to the GUS activity induced by GFP and WT AvrBs3 ( t -test, P
    Figure Legend Snippet: AvrBs3 cysteine mutants do not compete with AvrBs3 for DNA binding in planta . ( A ) T-DNA constructs used. Two different effector constructs, A and B, allow expression of (A) GFP- or (B) 4× c-Myc tagged AvrBs3 and derivatives under control of the 35S promoter. The reporter construct contains the 19-bp UPA20 UPA box in front of the tomato Bs4 minimal promoter driving a promoterless uidA reporter gene [ 48 ]. LB, left border; RB, right border. ( B ) GUS activity was determined in N . benthamiana leaves three days after Agrobacterium -mediated co-delivery of the reporter construct with the avrBs3 - or gfp construct (effector construct A) and effector construct B encoding one of the indicated proteins. Values are displayed relative to the GUS activity induced by GFP and WT AvrBs3. Error bars indicate SD. 35S : uidA served as control. Asterisks indicate statistically significant differences to the GUS activity induced by GFP and WT AvrBs3 ( t -test, P

    Techniques Used: Binding Assay, Construct, Expressing, Activity Assay

    AvrBs3 complex formation interferes with DNA binding. ( A ) AvrBs3 dimerizes via disulfide bonds. 0.5 μg purified His 6 ::AvrBs3, treated with different DTT concentrations for 1 h at room temperature (RT) or with 10 mM DTT overnight at 8°C (10*), was separated by a non-reducing SDS-polyacrylamide gel and analyzed by immunoblot with an α-His antibody. a, multimeric His 6 ::AvrBs3; b, monomeric His 6 ::AvrBs3. ( B ) AvrBs3 binds to DNA as a monomer. Electromobility shift assay (EMSA) using 333 fmol biotin-labeled 36-bp DNA-fragments derived from the UPA20 promoter (WT) as a probe. The DNA was incubated with untreated or DTT-treated His 6 ::AvrBs3 (+, 10 mM DTT overnight). Unlabeled WT and mutant ubm2 fragments (m, [ 8 ]) were used as competitor DNA. The experiments were repeated at least once with similar results.
    Figure Legend Snippet: AvrBs3 complex formation interferes with DNA binding. ( A ) AvrBs3 dimerizes via disulfide bonds. 0.5 μg purified His 6 ::AvrBs3, treated with different DTT concentrations for 1 h at room temperature (RT) or with 10 mM DTT overnight at 8°C (10*), was separated by a non-reducing SDS-polyacrylamide gel and analyzed by immunoblot with an α-His antibody. a, multimeric His 6 ::AvrBs3; b, monomeric His 6 ::AvrBs3. ( B ) AvrBs3 binds to DNA as a monomer. Electromobility shift assay (EMSA) using 333 fmol biotin-labeled 36-bp DNA-fragments derived from the UPA20 promoter (WT) as a probe. The DNA was incubated with untreated or DTT-treated His 6 ::AvrBs3 (+, 10 mM DTT overnight). Unlabeled WT and mutant ubm2 fragments (m, [ 8 ]) were used as competitor DNA. The experiments were repeated at least once with similar results.

    Techniques Used: Binding Assay, Purification, Electro Mobility Shift Assay, Labeling, Derivative Assay, Incubation, Mutagenesis

    AvrBs3 NTR and CTR contribute to DNA binding to different extents. Fluorescence polarization titrations of fluorescein-labeled dsDNA by AvrBs3 and deletion mutants. Increasing concentrations of purified His 6 -tagged AvrBs3 (open circles), AvrBs3ΔN152 (closed circles) and AvrBs3ΔN152-C16 (CTR deleted, except for the first 16 aa downstream of the repeats; open squares) were incubated under reducing conditions with fluorescein-labeled 36-bp DNA fragments derived from the UPA20 promoter. Fluorescence polarization intensities were normalized and plotted as function of protein concentration. The results are representative of three independent measurements. Dissociation constants (K D app ) were determined by curve fitting with a one-site saturation and nonspecific binding model using Kaleidagraph 4.0 (Synergy Software). The K D app for AvrBs3 is 23.2 ± 1.6 nM, and K D values of 99.2 ± 7.5 nM and 282.2 ± 18.1 nM were calculated for the truncated derivatives AvrBs3ΔN152 and AvrBs3ΔN151-C16, respectively.
    Figure Legend Snippet: AvrBs3 NTR and CTR contribute to DNA binding to different extents. Fluorescence polarization titrations of fluorescein-labeled dsDNA by AvrBs3 and deletion mutants. Increasing concentrations of purified His 6 -tagged AvrBs3 (open circles), AvrBs3ΔN152 (closed circles) and AvrBs3ΔN152-C16 (CTR deleted, except for the first 16 aa downstream of the repeats; open squares) were incubated under reducing conditions with fluorescein-labeled 36-bp DNA fragments derived from the UPA20 promoter. Fluorescence polarization intensities were normalized and plotted as function of protein concentration. The results are representative of three independent measurements. Dissociation constants (K D app ) were determined by curve fitting with a one-site saturation and nonspecific binding model using Kaleidagraph 4.0 (Synergy Software). The K D app for AvrBs3 is 23.2 ± 1.6 nM, and K D values of 99.2 ± 7.5 nM and 282.2 ± 18.1 nM were calculated for the truncated derivatives AvrBs3ΔN152 and AvrBs3ΔN151-C16, respectively.

    Techniques Used: Binding Assay, Fluorescence, Labeling, Purification, Incubation, Derivative Assay, Protein Concentration, Software

    The AvrBs3 cysteine mutant is monomeric and binds specifically to DNA in vitro . ( A ) 0.5 μg purified His 6 ::AvrBs3ΔN152 and His 6 ::AvrBs3ΔN152(C30S) Rep , respectively, were treated with different concentrations of DTT for 1 h at RT or with 10 mM DTT overnight at 8°C (10*). Samples were separated by a non-reducing SDS-polyacrylamide gel and analyzed by immunoblot with an α-His antibody. a, multimeric His 6 ::AvrBs3ΔN152; b, monomeric His 6 ::AvrBs3ΔN152. ( B ) EMSA. 333 fmol biotin-labeled 36-bp DNA-fragments derived from the UPA20 promoter were incubated with reduced His 6 ::AvrBs3ΔN152 and His 6 ::AvrBs3ΔN152(C30S) Rep (+, incubation with 10 mM DTT overnight). Unlabeled WT and mutant ubm2 DNA fragments (m, [ 8 ]) were used as competitor DNA. The experiments were repeated at least twice with similar results.
    Figure Legend Snippet: The AvrBs3 cysteine mutant is monomeric and binds specifically to DNA in vitro . ( A ) 0.5 μg purified His 6 ::AvrBs3ΔN152 and His 6 ::AvrBs3ΔN152(C30S) Rep , respectively, were treated with different concentrations of DTT for 1 h at RT or with 10 mM DTT overnight at 8°C (10*). Samples were separated by a non-reducing SDS-polyacrylamide gel and analyzed by immunoblot with an α-His antibody. a, multimeric His 6 ::AvrBs3ΔN152; b, monomeric His 6 ::AvrBs3ΔN152. ( B ) EMSA. 333 fmol biotin-labeled 36-bp DNA-fragments derived from the UPA20 promoter were incubated with reduced His 6 ::AvrBs3ΔN152 and His 6 ::AvrBs3ΔN152(C30S) Rep (+, incubation with 10 mM DTT overnight). Unlabeled WT and mutant ubm2 DNA fragments (m, [ 8 ]) were used as competitor DNA. The experiments were repeated at least twice with similar results.

    Techniques Used: Mutagenesis, In Vitro, Purification, Labeling, Derivative Assay, Incubation

    9) Product Images from "A restriction-free method for gene reconstitution using two single-primer PCRs in parallel to generate compatible cohesive ends"

    Article Title: A restriction-free method for gene reconstitution using two single-primer PCRs in parallel to generate compatible cohesive ends

    Journal: BMC Biotechnology

    doi: 10.1186/s12896-017-0346-5

    Gel electrophoresis separation of double-primer and single-primer PCR products. 1: Parental plasmid pET22b alone; 2: PCR product from reaction with primers pet22b1/pet22b2 using plasmid pET22b as template; 3: PCR product from reaction with primers radA1/radA2 using E. coli genomic DNA as template; 4: PCR product from reaction with primers GeneCluster3-1/GeneCluster3-2 using E. coli genomic DNA as template; 5: annealed PCR products from two single-primer linear reactions using primer pet22b3 or pet22b4, and the DNA sample from lane 2 as template; 6: annealed PCR products from two single-primer linear reactions using the primer radA2fw or radA2rv, and the DNA sample from lane 3 as template; 7: annealed PCR products from two single-primer linear reactions using the primer GeneCluster3-3 or GeneCluster3-4, and the DNA sample from lane 4 as template; 8: mixture of DNA samples from lanes 5 and 6 in a molar ratio of 1:3, ready for ligation; 9: mixture of DNA samples from lanes 5 and 6 in a molar ratio of 1:3, after ligation; 10: mixture of DNA samples from lanes 5 and 7 in a molar ratio of 6:1, ready for ligation; 11: mixture of DNA samples from lanes 5 and 7 in a molar ratio of 6:1, after ligation; 12: DNA ladder. PCR products were purified using a QIAquick purification kit (Qiagen) and electrophoresed in 1% agarose with Tris-acetate (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA, pH 8.0) as the running buffer
    Figure Legend Snippet: Gel electrophoresis separation of double-primer and single-primer PCR products. 1: Parental plasmid pET22b alone; 2: PCR product from reaction with primers pet22b1/pet22b2 using plasmid pET22b as template; 3: PCR product from reaction with primers radA1/radA2 using E. coli genomic DNA as template; 4: PCR product from reaction with primers GeneCluster3-1/GeneCluster3-2 using E. coli genomic DNA as template; 5: annealed PCR products from two single-primer linear reactions using primer pet22b3 or pet22b4, and the DNA sample from lane 2 as template; 6: annealed PCR products from two single-primer linear reactions using the primer radA2fw or radA2rv, and the DNA sample from lane 3 as template; 7: annealed PCR products from two single-primer linear reactions using the primer GeneCluster3-3 or GeneCluster3-4, and the DNA sample from lane 4 as template; 8: mixture of DNA samples from lanes 5 and 6 in a molar ratio of 1:3, ready for ligation; 9: mixture of DNA samples from lanes 5 and 6 in a molar ratio of 1:3, after ligation; 10: mixture of DNA samples from lanes 5 and 7 in a molar ratio of 6:1, ready for ligation; 11: mixture of DNA samples from lanes 5 and 7 in a molar ratio of 6:1, after ligation; 12: DNA ladder. PCR products were purified using a QIAquick purification kit (Qiagen) and electrophoresed in 1% agarose with Tris-acetate (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA, pH 8.0) as the running buffer

    Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Plasmid Preparation, Ligation, Purification

    Schematic representation of MRF cloning. The insert gene or vector was amplified by regular double-primer PCR using genomic DNA, cDNA, or the original vector as template. Compatible cohesive ends of insert gene or vector were created by two single-primer linear PCRs performed in parallel, followed by annealing of the two PCR products. Inserts and acceptors with compatible cohesive ends were then assembled by ligation
    Figure Legend Snippet: Schematic representation of MRF cloning. The insert gene or vector was amplified by regular double-primer PCR using genomic DNA, cDNA, or the original vector as template. Compatible cohesive ends of insert gene or vector were created by two single-primer linear PCRs performed in parallel, followed by annealing of the two PCR products. Inserts and acceptors with compatible cohesive ends were then assembled by ligation

    Techniques Used: Clone Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Ligation

    10) Product Images from "Transcription factors mediate condensin recruitment and global chromosomal organization in fission yeast"

    Article Title: Transcription factors mediate condensin recruitment and global chromosomal organization in fission yeast

    Journal: Nature genetics

    doi: 10.1038/ng.3647

    Condensin recruited by Ace2 and Ams2 associates a gene locus with centromeres ( a ) Co-IP result showing the protein interaction between the Cut14-Pk and Ace2-Myc. Epitope-tagged proteins were expressed from the endogenous gene loci with their own promoters. Co-IP assay was performed with and without DNase I treatment. DNA digestion was verified by a PCR-based assay to detect act1 gene region as a control (bottom panel). ( b ) Co-IP result showing the interaction between the Cut14-Pk and Ams2-Myc. ( c ) A schematic explanation of the tethering assay. ( d ) Tethering of Ace2- or Ams2-LacI-3Flag is sufficient to recruit condensin to the lacO locus. Cells expressing Ace2 or Ams2 fused to LacI-3Flag were subjected to ChIP experiments to detect LacI-3Flag fusion proteins (left) and the Cut14-Pk condensin subunit (right) at the lacO repeats-flanking region. As a negative control (N.C.), cells carrying an empty vector were used for the same analysis. Experiments were independently repeated three times, and data are represented as mean ± SD. ( e ) The c887 lacO locus frequently localizes near centromeres in cells expressing Ace2- or Ams2-LacI-3Flag. The distance between the lacO locus and centromeres was measured in more than 100 cells and binned into one of the three categories. Representative FISH images are shown below the graph. ( f ) The same FISH analysis as described in panel e was performed with the cut14-208 condensin mutant. The cut14-208 mutant was cultured at the restrictive temperature (36°C) for 1 hour.
    Figure Legend Snippet: Condensin recruited by Ace2 and Ams2 associates a gene locus with centromeres ( a ) Co-IP result showing the protein interaction between the Cut14-Pk and Ace2-Myc. Epitope-tagged proteins were expressed from the endogenous gene loci with their own promoters. Co-IP assay was performed with and without DNase I treatment. DNA digestion was verified by a PCR-based assay to detect act1 gene region as a control (bottom panel). ( b ) Co-IP result showing the interaction between the Cut14-Pk and Ams2-Myc. ( c ) A schematic explanation of the tethering assay. ( d ) Tethering of Ace2- or Ams2-LacI-3Flag is sufficient to recruit condensin to the lacO locus. Cells expressing Ace2 or Ams2 fused to LacI-3Flag were subjected to ChIP experiments to detect LacI-3Flag fusion proteins (left) and the Cut14-Pk condensin subunit (right) at the lacO repeats-flanking region. As a negative control (N.C.), cells carrying an empty vector were used for the same analysis. Experiments were independently repeated three times, and data are represented as mean ± SD. ( e ) The c887 lacO locus frequently localizes near centromeres in cells expressing Ace2- or Ams2-LacI-3Flag. The distance between the lacO locus and centromeres was measured in more than 100 cells and binned into one of the three categories. Representative FISH images are shown below the graph. ( f ) The same FISH analysis as described in panel e was performed with the cut14-208 condensin mutant. The cut14-208 mutant was cultured at the restrictive temperature (36°C) for 1 hour.

    Techniques Used: Co-Immunoprecipitation Assay, Polymerase Chain Reaction, Expressing, Chromatin Immunoprecipitation, Negative Control, Plasmid Preparation, Fluorescence In Situ Hybridization, Mutagenesis, Cell Culture

    11) Product Images from "Long Span DNA Paired-End-Tag (DNA-PET) Sequencing Strategy for the Interrogation of Genomic Structural Mutations and Fusion-Point-Guided Reconstruction of Amplicons"

    Article Title: Long Span DNA Paired-End-Tag (DNA-PET) Sequencing Strategy for the Interrogation of Genomic Structural Mutations and Fusion-Point-Guided Reconstruction of Amplicons

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0046152

    DNA-PET library construction, sequencing and mapping. (A) The genomic DNA was randomly sheared to different size range. (B) The very narrow region DNA fragments were obtained after size selection. (C) The purified DNA fragments were circularized, EcoP15I digested, sequencing adaptor ligated, and finally sequenced by SOLiD sequencer. (D) PET mapping span distribution of 1 kb (blue), 10 kb (red) and 20 kb (green) libraries. Based on the mapping pattern, PETs can be distinguished as concordant PETs and discordant PETs.
    Figure Legend Snippet: DNA-PET library construction, sequencing and mapping. (A) The genomic DNA was randomly sheared to different size range. (B) The very narrow region DNA fragments were obtained after size selection. (C) The purified DNA fragments were circularized, EcoP15I digested, sequencing adaptor ligated, and finally sequenced by SOLiD sequencer. (D) PET mapping span distribution of 1 kb (blue), 10 kb (red) and 20 kb (green) libraries. Based on the mapping pattern, PETs can be distinguished as concordant PETs and discordant PETs.

    Techniques Used: Positron Emission Tomography, Sequencing, Selection, Purification

    12) Product Images from "Role of Human DNA Glycosylase Nei-like 2 (NEIL2) and Single Strand Break Repair Protein Polynucleotide Kinase 3?-Phosphatase in Maintenance of Mitochondrial Genome *"

    Article Title: Role of Human DNA Glycosylase Nei-like 2 (NEIL2) and Single Strand Break Repair Protein Polynucleotide Kinase 3?-Phosphatase in Maintenance of Mitochondrial Genome *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.272179

    Quantitation of mitochondrial DNA damage in NEIL2- and PNKP-depleted cells. Upper panel , representative gel showing PCR-amplified fragments of the long amplicon (8.9-kb region) and 211-bp region. The relative levels of endogenous DNA damage were calculated
    Figure Legend Snippet: Quantitation of mitochondrial DNA damage in NEIL2- and PNKP-depleted cells. Upper panel , representative gel showing PCR-amplified fragments of the long amplicon (8.9-kb region) and 211-bp region. The relative levels of endogenous DNA damage were calculated

    Techniques Used: Quantitation Assay, Polymerase Chain Reaction, Amplification

    13) Product Images from "Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter"

    Article Title: Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter

    Journal:

    doi: 10.1128/JB.187.18.6290-6299.2005

    Single-round in vitro transcription assays of the bipA promoter with E. coli RNAP as a function of BvgA or BvgA-P concentration. A. wt DNA fragment (lanes 1 to 11) and the ΔIR2 promoter derivative (lanes 12 to 22). Lanes 2 to 6 and 13 to 17 contain
    Figure Legend Snippet: Single-round in vitro transcription assays of the bipA promoter with E. coli RNAP as a function of BvgA or BvgA-P concentration. A. wt DNA fragment (lanes 1 to 11) and the ΔIR2 promoter derivative (lanes 12 to 22). Lanes 2 to 6 and 13 to 17 contain

    Techniques Used: In Vitro, Concentration Assay

    14) Product Images from "A Unique 45-Amino-Acid Region in the Toprim Domain of Plasmodium falciparum Gyrase B Is Essential for Its Activity ▿ Gyrase B Is Essential for Its Activity ▿ †"

    Article Title: A Unique 45-Amino-Acid Region in the Toprim Domain of Plasmodium falciparum Gyrase B Is Essential for Its Activity ▿ Gyrase B Is Essential for Its Activity ▿ †

    Journal:

    doi: 10.1128/EC.00149-09

    Closure of the ATP-operated clamp inhibits the DNA binding activity of PfGyrB. (A) SDS-PAGE analysis of wild-type PfGyrB and PfGyrB(K220A) with a point mutation at the ATP binding site. (B) ATPase activity of wild-type and ATP binding-site mutant proteins.
    Figure Legend Snippet: Closure of the ATP-operated clamp inhibits the DNA binding activity of PfGyrB. (A) SDS-PAGE analysis of wild-type PfGyrB and PfGyrB(K220A) with a point mutation at the ATP binding site. (B) ATPase activity of wild-type and ATP binding-site mutant proteins.

    Techniques Used: Binding Assay, Activity Assay, SDS Page, Mutagenesis

    15) Product Images from "Molecular and Functional Analyses of the Fast Skeletal Myosin Light Chain2 Gene of the Korean Oily Bitterling, Acheilognathus koreensis"

    Article Title: Molecular and Functional Analyses of the Fast Skeletal Myosin Light Chain2 Gene of the Korean Oily Bitterling, Acheilognathus koreensis

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms140816672

    Analysis of DsRed reporter activity of the Akmlc2f promoter in the zebrafish embryo. The fluorescent protein reporter of the Akmlc2f promoter, pDsRed2-1/Akmlc2f P2657 was digested with the restriction endonuclease Apa LI and then the DNA solution at concentrations of 25 ng/mL was injected into the one-cell stage embryos using an air-pressure microinjector (WPI). Digital images of embryo (6 days post hatching) were captured using a macro zoom fluorescence microscope (Olympus, Tokyo, Japan). Scale bar = 200 μm
    Figure Legend Snippet: Analysis of DsRed reporter activity of the Akmlc2f promoter in the zebrafish embryo. The fluorescent protein reporter of the Akmlc2f promoter, pDsRed2-1/Akmlc2f P2657 was digested with the restriction endonuclease Apa LI and then the DNA solution at concentrations of 25 ng/mL was injected into the one-cell stage embryos using an air-pressure microinjector (WPI). Digital images of embryo (6 days post hatching) were captured using a macro zoom fluorescence microscope (Olympus, Tokyo, Japan). Scale bar = 200 μm

    Techniques Used: Activity Assay, Injection, Fluorescence, Microscopy

    16) Product Images from "The TyrR Transcription Factor Regulates the Divergent akr-ipdC Operons of Enterobacter cloacae UW5"

    Article Title: The TyrR Transcription Factor Regulates the Divergent akr-ipdC Operons of Enterobacter cloacae UW5

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0121241

    Binding of TyrR to the TyrR boxes within the akr-ipdC intergenic region. DIG-labeled DNA probes correspond to the akr-ipdC intergenic sequence of the template plasmid from which they were generated, wild-type sequence (Lanes 1–3); weak box mutant (Lanes 4–6); strong box mutant (Lanes 7–9); double weak and strong box mutant (Lanes 10–12) and double strong boxes (lanes 13–15). DNA probes were incubated with either no TyrR (Lanes 1, 4, 7, 10 and 13) or increasing concentrations of TyrR (87 nM: Lanes 2, 5, 8, 11 and 14; 877 nM: Lanes 3, 6, 9, 12 and 15). Arrows indicate the positions of free DNA (F) and the two resolved TyrR-DNA complexes (I, II).
    Figure Legend Snippet: Binding of TyrR to the TyrR boxes within the akr-ipdC intergenic region. DIG-labeled DNA probes correspond to the akr-ipdC intergenic sequence of the template plasmid from which they were generated, wild-type sequence (Lanes 1–3); weak box mutant (Lanes 4–6); strong box mutant (Lanes 7–9); double weak and strong box mutant (Lanes 10–12) and double strong boxes (lanes 13–15). DNA probes were incubated with either no TyrR (Lanes 1, 4, 7, 10 and 13) or increasing concentrations of TyrR (87 nM: Lanes 2, 5, 8, 11 and 14; 877 nM: Lanes 3, 6, 9, 12 and 15). Arrows indicate the positions of free DNA (F) and the two resolved TyrR-DNA complexes (I, II).

    Techniques Used: Binding Assay, Labeling, Sequencing, Plasmid Preparation, Generated, Mutagenesis, Incubation

    17) Product Images from "TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres"

    Article Title: TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt1132

    TRF1- and TRF2-QDs retain DNA-binding activity. ( A ) Schematic representations of the domain structures of TRF1 and TRF2. A: Acidic domain, B: Basic domain. M: Myb type domain. ( B ) Schematic representations of TRF1- and TRF2-QD conjugates (left), BT tris-NTA compound (middle) and the DNA substrate (T270) with two tandem (TTAGGG) 135 repeats connected by a short linker region (right, 5.4 kb in length). (C–E) Representative AFM images of DNA in the presence of ( C) only QDs and BT tris-NTA compound, ( D ) TRF1-QDs or ( E ) TRF2-QDs. The scale bar is 200 nm. White arrows point to QDs bound to DNA. The numbers in (C–E) indicate the percent of DNA molecules bound with QDs in each condition. The total numbers of complexes analyzed were 200, 250 and 250, for no protein, TRF1-QDs and TRF2-QDs, respectively.
    Figure Legend Snippet: TRF1- and TRF2-QDs retain DNA-binding activity. ( A ) Schematic representations of the domain structures of TRF1 and TRF2. A: Acidic domain, B: Basic domain. M: Myb type domain. ( B ) Schematic representations of TRF1- and TRF2-QD conjugates (left), BT tris-NTA compound (middle) and the DNA substrate (T270) with two tandem (TTAGGG) 135 repeats connected by a short linker region (right, 5.4 kb in length). (C–E) Representative AFM images of DNA in the presence of ( C) only QDs and BT tris-NTA compound, ( D ) TRF1-QDs or ( E ) TRF2-QDs. The scale bar is 200 nm. White arrows point to QDs bound to DNA. The numbers in (C–E) indicate the percent of DNA molecules bound with QDs in each condition. The total numbers of complexes analyzed were 200, 250 and 250, for no protein, TRF1-QDs and TRF2-QDs, respectively.

    Techniques Used: Binding Assay, Activity Assay

    18) Product Images from "Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato"

    Article Title: Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato

    Journal: Scientific Reports

    doi: 10.1038/srep27078

    Molecular characterization of SlRPT4 protein. ( A ) Thin-layer chromatography (TLC) to evaluate ATPase activity. Figure shows dissociation of Pi from γP 32 -labelled ATP. Level of Pi was enriched upon increasing the amount of protein. GST protein was used as a negative control of the experiment. ( B ) DNA binding activity of SlRPT4-GST protein. Binding of SlRPT4 protein onto αP 32 -dCTP-labeled corresponding fragment of DNA-A-IR, DNA-B-IR and Rep regions are shown by retarded DNA-protein complex through EMSA on 6% native polyacrylamide gel. Signs, +/− represent the presence/absence of components. GST protein was used as a control substrate. In vivo binding assay was performed by transiently overexpressing SlRPT4 ( C ); SlRNA PolII subunit-3-gfp construct ( D ); and SlRPT4 and SlRNA PolII subunit-3 co-infiltration ( E ), in ToLCNDV infected leaves. Figures depict the amplification of IR fragments from the chomatin immuno-precipitated from the sample by using tag-corresponding to c -myc and gfp. ( E ) Relative abundance of IR specific fragments in the experimental samples. ( F ) Accumulation of Tomato leaf curl New Delhi virus ToLCNDV specific Rep transcripts in H T (ToLCNDV infected cultivar H-88-78-1) and H SlRPT4+T ( SlRPT4 silenced H-88-78-1 infected with ToLCNDV), ( G ) Northern hybridization showing the accumulation of Rep transcripts, ( H ) Relative accumulation of Rep transcripts in the leaf samples infiltrated with empty vector (EV), SlRPT4 -myc and RNA Pol II-3-gfp construct alone, and co-infiltrated with RNA Pol II-3-gfp and SlRPT4-myc construct. Fragment corresponding to ToLCNDV-Rep gene was used as probe. Total RNA is shown as equivalent loading in the experiment. Data depicts means ± SD of three independent experiments (n = 3); * P
    Figure Legend Snippet: Molecular characterization of SlRPT4 protein. ( A ) Thin-layer chromatography (TLC) to evaluate ATPase activity. Figure shows dissociation of Pi from γP 32 -labelled ATP. Level of Pi was enriched upon increasing the amount of protein. GST protein was used as a negative control of the experiment. ( B ) DNA binding activity of SlRPT4-GST protein. Binding of SlRPT4 protein onto αP 32 -dCTP-labeled corresponding fragment of DNA-A-IR, DNA-B-IR and Rep regions are shown by retarded DNA-protein complex through EMSA on 6% native polyacrylamide gel. Signs, +/− represent the presence/absence of components. GST protein was used as a control substrate. In vivo binding assay was performed by transiently overexpressing SlRPT4 ( C ); SlRNA PolII subunit-3-gfp construct ( D ); and SlRPT4 and SlRNA PolII subunit-3 co-infiltration ( E ), in ToLCNDV infected leaves. Figures depict the amplification of IR fragments from the chomatin immuno-precipitated from the sample by using tag-corresponding to c -myc and gfp. ( E ) Relative abundance of IR specific fragments in the experimental samples. ( F ) Accumulation of Tomato leaf curl New Delhi virus ToLCNDV specific Rep transcripts in H T (ToLCNDV infected cultivar H-88-78-1) and H SlRPT4+T ( SlRPT4 silenced H-88-78-1 infected with ToLCNDV), ( G ) Northern hybridization showing the accumulation of Rep transcripts, ( H ) Relative accumulation of Rep transcripts in the leaf samples infiltrated with empty vector (EV), SlRPT4 -myc and RNA Pol II-3-gfp construct alone, and co-infiltrated with RNA Pol II-3-gfp and SlRPT4-myc construct. Fragment corresponding to ToLCNDV-Rep gene was used as probe. Total RNA is shown as equivalent loading in the experiment. Data depicts means ± SD of three independent experiments (n = 3); * P

    Techniques Used: Thin Layer Chromatography, Activity Assay, Negative Control, Binding Assay, Protein Binding, Labeling, In Vivo, Construct, Infection, Amplification, Northern Blot, Hybridization, Plasmid Preparation

    19) Product Images from "A Markerless Method for Genome Engineering in Zymomonas mobilis ZM4"

    Article Title: A Markerless Method for Genome Engineering in Zymomonas mobilis ZM4

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2019.02216

    Deletion of ldh gene. (A) Workflow for enrichment of non-fluorescent cells and screening for the modified genome. (B) Plot from FACS of Z. mobilis strain PK15557 that has suicide plasmid (pPK15535) recombined into the genome. The X -axis represents fluorescence intensity and Y -axis represents the total number of sorted events. The sorting gate for collecting the non-fluorescent cells (red peak) is indicated by the bar. (C) Top plate shows the fluorescence image of colonies from FACS sorted non-fluorescent cells plated on non-selective media. Bottom plate shows the same colonies viewed with visible light. (D) The location of primers used to screen non-fluorescent candidates for wild-type (wt) and deletion genotypes by PCR is indicated by arrows. (E,F) Agarose gel electrophoresis of products from PCR amplification of 10 non-fluorescent-candidate colonies. Selected size markers are indicated on the left (M R ). (E) Amplification using primers P34 and P35 yielded a 1.25-kb DNA fragment for the ldh deletion whereas the wt ldh DNA fragment was 2.97 kb. Strains that still possess the plasmid integrated into the genome (Rec) are expected to have a band of 7.8 kb. (F) Amplification using P34 and P38 yielded a DNA fragment of 0.8 kb, confirming those strains that still possess the ldh gene, while strains in which ldh has been deleted (six total) lacked the equivalent amplified fragment. Labels are the same as in panel E . Similar results were obtained when this experiment was biologically replicated three times.
    Figure Legend Snippet: Deletion of ldh gene. (A) Workflow for enrichment of non-fluorescent cells and screening for the modified genome. (B) Plot from FACS of Z. mobilis strain PK15557 that has suicide plasmid (pPK15535) recombined into the genome. The X -axis represents fluorescence intensity and Y -axis represents the total number of sorted events. The sorting gate for collecting the non-fluorescent cells (red peak) is indicated by the bar. (C) Top plate shows the fluorescence image of colonies from FACS sorted non-fluorescent cells plated on non-selective media. Bottom plate shows the same colonies viewed with visible light. (D) The location of primers used to screen non-fluorescent candidates for wild-type (wt) and deletion genotypes by PCR is indicated by arrows. (E,F) Agarose gel electrophoresis of products from PCR amplification of 10 non-fluorescent-candidate colonies. Selected size markers are indicated on the left (M R ). (E) Amplification using primers P34 and P35 yielded a 1.25-kb DNA fragment for the ldh deletion whereas the wt ldh DNA fragment was 2.97 kb. Strains that still possess the plasmid integrated into the genome (Rec) are expected to have a band of 7.8 kb. (F) Amplification using P34 and P38 yielded a DNA fragment of 0.8 kb, confirming those strains that still possess the ldh gene, while strains in which ldh has been deleted (six total) lacked the equivalent amplified fragment. Labels are the same as in panel E . Similar results were obtained when this experiment was biologically replicated three times.

    Techniques Used: Modification, FACS, Plasmid Preparation, Fluorescence, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification

    Scheme for deleting genes in Z. mobilis . Deletion of a gene in Z. mobilis is accomplished by cloning 500 bp of DNA from upstream (UP) of and downstream (DN) of the gene to be deleted into the suicide plasmid pPK15534. Next, the plasmid is introduced into Z. mobilis by conjugation and single crossover homologous recombination events are selected for with chloramphenicol. Shown here is a crossover that occurred at the UP location, but recombination at the DN location is equally possible. Lastly, growing cells without selection allow detection of a second recombination event that results in plasmid loss by screening for the loss of fluorescence from GFP. Wild-type and deletion mutant genotypes were distinguished by PCR amplification.
    Figure Legend Snippet: Scheme for deleting genes in Z. mobilis . Deletion of a gene in Z. mobilis is accomplished by cloning 500 bp of DNA from upstream (UP) of and downstream (DN) of the gene to be deleted into the suicide plasmid pPK15534. Next, the plasmid is introduced into Z. mobilis by conjugation and single crossover homologous recombination events are selected for with chloramphenicol. Shown here is a crossover that occurred at the UP location, but recombination at the DN location is equally possible. Lastly, growing cells without selection allow detection of a second recombination event that results in plasmid loss by screening for the loss of fluorescence from GFP. Wild-type and deletion mutant genotypes were distinguished by PCR amplification.

    Techniques Used: Clone Assay, Plasmid Preparation, Conjugation Assay, Homologous Recombination, Selection, Fluorescence, Mutagenesis, Polymerase Chain Reaction, Amplification

    Insertion of a functional CRT cassette. (A) A heterologous pathway for production of the carotenoid neuroporene by introduction of the crtIBE genes from Rhodobacter sphaeroides. Dotted arrows indicate the reactions mediated by the R. sphaeroides gene products. (B) Schematic of suicide plasmid used to deliver crtIBE to Z. mobilis ldh. UP and DN are the same 500 bp sequences used to delete the ldh gene. (C) Non-fluorescent candidates containing crtIBE replacing Z. mobilis ldh were isolated using the same workflow as outlined for ldh and screened for insertions first by the presence of orange colored colonies. (D) The location of primers used to distinguish between the wt and the insertion genotype is indicated by arrows. (E) Agarose gel electrophoresis of products from PCR amplification of orange colored colonies. Amplification using primers P 34 and P 35 yielded a DNA fragment of 5.4 kb for the insertion of crtIBE , whereas wt cells are expected to produce an amplicon of 2.9 kb. Selected size markers are indicated on the left (M R ). (F) Absorption spectrum of acetone:methanol extracts from orange colored colonies containing crtIBE compared to wt. Peak maxima characteristic of neurosporene are marked. We examined more than five isolates for insertion of the CRT cassette in independent experiments, and measured neurosporene from three different isolates. We conducted two independent experiments both resulting in the successful insertion of the CRT cassette at the ldh locus.
    Figure Legend Snippet: Insertion of a functional CRT cassette. (A) A heterologous pathway for production of the carotenoid neuroporene by introduction of the crtIBE genes from Rhodobacter sphaeroides. Dotted arrows indicate the reactions mediated by the R. sphaeroides gene products. (B) Schematic of suicide plasmid used to deliver crtIBE to Z. mobilis ldh. UP and DN are the same 500 bp sequences used to delete the ldh gene. (C) Non-fluorescent candidates containing crtIBE replacing Z. mobilis ldh were isolated using the same workflow as outlined for ldh and screened for insertions first by the presence of orange colored colonies. (D) The location of primers used to distinguish between the wt and the insertion genotype is indicated by arrows. (E) Agarose gel electrophoresis of products from PCR amplification of orange colored colonies. Amplification using primers P 34 and P 35 yielded a DNA fragment of 5.4 kb for the insertion of crtIBE , whereas wt cells are expected to produce an amplicon of 2.9 kb. Selected size markers are indicated on the left (M R ). (F) Absorption spectrum of acetone:methanol extracts from orange colored colonies containing crtIBE compared to wt. Peak maxima characteristic of neurosporene are marked. We examined more than five isolates for insertion of the CRT cassette in independent experiments, and measured neurosporene from three different isolates. We conducted two independent experiments both resulting in the successful insertion of the CRT cassette at the ldh locus.

    Techniques Used: Functional Assay, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

    Deletion of bcsABC operon. Non-fluorescent deletion candidates for bcsABC were isolated using the same workflow as outlined for ldh and screened for deletions or wild-type (wt) alleles by PCR amplification. (A) The location of primers used to distinguish between the wt and the deletion genotype is indicated by arrows. (B,C) Agarose gel electrophoresis of products from PCR amplification of five non-fluorescent candidate colonies. (B) Amplification using primers P 22 and P 23 yielded a DNA fragment of 1.4 kb for the deletion of bcsABC (three total), while wt cells are expected to produce an amplicon of ∼10 kb, which was poorly amplified under our reaction conditions. (C) To verify the genotype of wt strains, a second PCR experiment using primers P21 and P22 was included. In this case, wt strains are expected to yield an amplicon of 0.7 kb while the deletion strain should not produce a band. Similar results were obtained from six biological replicates of this workflow. (D) To test the phenotype of our mutant, we compared flocculation of the wt (left) and deletion strain (right) after growth for 15 h in glucose minimal media under aerobic conditions. Flocs are indicated by the arrow. (E) Growth curve of wt and mutant strains grown in glucose minimal media under anaerobic conditions.
    Figure Legend Snippet: Deletion of bcsABC operon. Non-fluorescent deletion candidates for bcsABC were isolated using the same workflow as outlined for ldh and screened for deletions or wild-type (wt) alleles by PCR amplification. (A) The location of primers used to distinguish between the wt and the deletion genotype is indicated by arrows. (B,C) Agarose gel electrophoresis of products from PCR amplification of five non-fluorescent candidate colonies. (B) Amplification using primers P 22 and P 23 yielded a DNA fragment of 1.4 kb for the deletion of bcsABC (three total), while wt cells are expected to produce an amplicon of ∼10 kb, which was poorly amplified under our reaction conditions. (C) To verify the genotype of wt strains, a second PCR experiment using primers P21 and P22 was included. In this case, wt strains are expected to yield an amplicon of 0.7 kb while the deletion strain should not produce a band. Similar results were obtained from six biological replicates of this workflow. (D) To test the phenotype of our mutant, we compared flocculation of the wt (left) and deletion strain (right) after growth for 15 h in glucose minimal media under aerobic conditions. Flocs are indicated by the arrow. (E) Growth curve of wt and mutant strains grown in glucose minimal media under anaerobic conditions.

    Techniques Used: Isolation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Flocculation

    20) Product Images from "Functionally Active Fc Mutant Antibodies Recognizing Cancer Antigens Generated Rapidly at High Yields"

    Article Title: Functionally Active Fc Mutant Antibodies Recognizing Cancer Antigens Generated Rapidly at High Yields

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2017.01112

    Schematic representation of the pipeline for generation and production of wild-type (WT) and Fc mutant IgG antibodies. (A) WT antibody construct in pVitro1-hygro-mcs. (B) Polymerase incomplete primer extension (PIPE) PCR linearization and mutagenesis of the WT construct to generate pVitro1 DNA fragments carrying the N297Q (left, fragments 1 and 4) or S239D/I332E (right, fragments 1, 2, and 4) mutations. Mutations indicated by “*”. (C) Introduction of mutations in WT constructs through mutagenic PIPE primers. (D) DpnI digestion. (E) Enzyme-independent assembly of the linear pVitro1 fragments. (F) Bacterial transformation of the assembled constructs. (G) Confirmation of the insertion of desired mutations. (H,I) Recombinant expression in Expi293F cells (H) and purification (I) of antibody WT and mutant variants.
    Figure Legend Snippet: Schematic representation of the pipeline for generation and production of wild-type (WT) and Fc mutant IgG antibodies. (A) WT antibody construct in pVitro1-hygro-mcs. (B) Polymerase incomplete primer extension (PIPE) PCR linearization and mutagenesis of the WT construct to generate pVitro1 DNA fragments carrying the N297Q (left, fragments 1 and 4) or S239D/I332E (right, fragments 1, 2, and 4) mutations. Mutations indicated by “*”. (C) Introduction of mutations in WT constructs through mutagenic PIPE primers. (D) DpnI digestion. (E) Enzyme-independent assembly of the linear pVitro1 fragments. (F) Bacterial transformation of the assembled constructs. (G) Confirmation of the insertion of desired mutations. (H,I) Recombinant expression in Expi293F cells (H) and purification (I) of antibody WT and mutant variants.

    Techniques Used: Mutagenesis, Construct, Polymerase Chain Reaction, Electroporation Bacterial Transformation, Recombinant, Expressing, Purification

    21) Product Images from "Mutations in Pdd1 Reveal Distinct Requirements for Its Chromodomain and Chromoshadow Domain in Directing Histone Methylation and Heterochromatin Elimination"

    Article Title: Mutations in Pdd1 Reveal Distinct Requirements for Its Chromodomain and Chromoshadow Domain in Directing Histone Methylation and Heterochromatin Elimination

    Journal: Eukaryotic Cell

    doi: 10.1128/EC.00219-13

    CD1, but not CD2 and the CSD, is required for IES excision. PCR assessment of IES rearrangement of genomic DNA in cells expressing untagged, mutant PDD1 alleles. (A) M-element rearrangement of Pdd1 mutants. Unrearranged DNA results in a 1.2-kb product
    Figure Legend Snippet: CD1, but not CD2 and the CSD, is required for IES excision. PCR assessment of IES rearrangement of genomic DNA in cells expressing untagged, mutant PDD1 alleles. (A) M-element rearrangement of Pdd1 mutants. Unrearranged DNA results in a 1.2-kb product

    Techniques Used: Polymerase Chain Reaction, Expressing, Mutagenesis

    22) Product Images from "Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent"

    Article Title: Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent

    Journal: Wellcome Open Research

    doi: 10.12688/wellcomeopenres.14741.2

    DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.
    Figure Legend Snippet: DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.

    Techniques Used: DNA Methylation Assay, Methylated DNA Immunoprecipitation, Infection, Clone Assay, Polymerase Chain Reaction

    23) Product Images from "The SS18-SSX oncoprotein hijacks KDM2B-PRC1.1 to drive synovial sarcoma"

    Article Title: The SS18-SSX oncoprotein hijacks KDM2B-PRC1.1 to drive synovial sarcoma

    Journal: Cancer cell

    doi: 10.1016/j.ccell.2018.01.018

    The DNA binding domain of KDM2B and the non-canonical PRC1.1 complex are essential for synovial sarcoma proliferation ( A ) Schematics showing human KDM2B JmjC and ZF-CxxC protein domains in long and short KDM2B isoforms and location of single guide RNAs (sgRNA). ( B ) Depletion assays based on the % of GFP + cells at day 3 and at day 21 following sgRNA transduction. Error bars correspond to mean + s.d. of two independent experiments. ( C ) Bright field images of HS-SY-II cells transduced with the indicated shRNAs 10 days following shRNA induction. Scale bar=25 μm ( D ) Clonogenic assay of HS-SY-II cells transduced with the indicated shRNAs. ( E ) Quantitative RT-PCR for KDM2B , PCGF1 and BCOR expression. Error bars correspond to mean +z s.d. (n=2). ( F ) Schematics of guide RNAs designed against the first exon or against the RAWUL domain of PCGF1 (surrounding Valine 206). Depletion assays based on the % of GFP + .
    Figure Legend Snippet: The DNA binding domain of KDM2B and the non-canonical PRC1.1 complex are essential for synovial sarcoma proliferation ( A ) Schematics showing human KDM2B JmjC and ZF-CxxC protein domains in long and short KDM2B isoforms and location of single guide RNAs (sgRNA). ( B ) Depletion assays based on the % of GFP + cells at day 3 and at day 21 following sgRNA transduction. Error bars correspond to mean + s.d. of two independent experiments. ( C ) Bright field images of HS-SY-II cells transduced with the indicated shRNAs 10 days following shRNA induction. Scale bar=25 μm ( D ) Clonogenic assay of HS-SY-II cells transduced with the indicated shRNAs. ( E ) Quantitative RT-PCR for KDM2B , PCGF1 and BCOR expression. Error bars correspond to mean +z s.d. (n=2). ( F ) Schematics of guide RNAs designed against the first exon or against the RAWUL domain of PCGF1 (surrounding Valine 206). Depletion assays based on the % of GFP + .

    Techniques Used: Binding Assay, Transduction, shRNA, Clonogenic Assay, Quantitative RT-PCR, Expressing

    24) Product Images from "Genomic Diversification among Archival Strains of Salmonella enterica Serovar Typhimurium LT7"

    Article Title: Genomic Diversification among Archival Strains of Salmonella enterica Serovar Typhimurium LT7

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.185.7.2131-2142.2003

    Genomic inversion exemplified by strain 8111D323. (A) PFGE gels of LT7 and 8111D323. Lanes: 1, LT7 DNA cleaved by Xba I; 2, 8111D323 DNA cleaved by Xba I; 3, LT7 DNA cleaved by Avr II; and 4, 8111D323 DNA cleaved by Avr II. (B) Local comparison of LT7 and 8111D323 showing the inversion of I- Ceu I A, which resulted in two hybrid rrn operons, the disappearance of Xba I B and Avr II A, and appearance of two new fragments each from Xba I (411 and 322 kb) and Avr II (777 and 757 kb) digestions.
    Figure Legend Snippet: Genomic inversion exemplified by strain 8111D323. (A) PFGE gels of LT7 and 8111D323. Lanes: 1, LT7 DNA cleaved by Xba I; 2, 8111D323 DNA cleaved by Xba I; 3, LT7 DNA cleaved by Avr II; and 4, 8111D323 DNA cleaved by Avr II. (B) Local comparison of LT7 and 8111D323 showing the inversion of I- Ceu I A, which resulted in two hybrid rrn operons, the disappearance of Xba I B and Avr II A, and appearance of two new fragments each from Xba I (411 and 322 kb) and Avr II (777 and 757 kb) digestions.

    Techniques Used:

    PFGE patterns of genomic DNA of the wild serovar Typhimurium LT7 strain stored at −70°C cleaved with the endonucleases Xba I, Avr II, I- Ceu I, and Spe I. Lanes: 1, Xba I cleavage of LT7 (3 small fragments—W [6.5 kb], X [6.4 kb], and Y [1 kb]—had run out of the gel); 2, I- Ceu I cleavage of LT7; 3 and 4, Avr II cleavages of LT2 and LT7, respectively, for a comparison; two small fragments of LT7 had run out of the gel, including L (4 kb) and M (2 kb); 5, Spe I cleavage of LT7 (12 small fragments, X through II, ranging from 49 to 7 kb, had run out of the gel); 6, Spe I cleavage of LT7 serB ::Tn 10 , showing the size shift of S112 with the Tn 10 insertion (it is now 112 + 9, i.e., 121 kb).
    Figure Legend Snippet: PFGE patterns of genomic DNA of the wild serovar Typhimurium LT7 strain stored at −70°C cleaved with the endonucleases Xba I, Avr II, I- Ceu I, and Spe I. Lanes: 1, Xba I cleavage of LT7 (3 small fragments—W [6.5 kb], X [6.4 kb], and Y [1 kb]—had run out of the gel); 2, I- Ceu I cleavage of LT7; 3 and 4, Avr II cleavages of LT2 and LT7, respectively, for a comparison; two small fragments of LT7 had run out of the gel, including L (4 kb) and M (2 kb); 5, Spe I cleavage of LT7 (12 small fragments, X through II, ranging from 49 to 7 kb, had run out of the gel); 6, Spe I cleavage of LT7 serB ::Tn 10 , showing the size shift of S112 with the Tn 10 insertion (it is now 112 + 9, i.e., 121 kb).

    Techniques Used:

    Genomic translocation exemplified by strain 8111B. (A) PFGE gels of LT7 and 8111B. Lanes: 1, LT7 DNA cleaved by Xba I, with the fragments and their sizes indicated on the left of the PFGE gel; 2, 8111B DNA cleaved by Xba I, with deviations of the cleavage pattern from that of LT7 indicated on the right of the PFGE gel; 3, LT7 DNA cleaved by I- Ceu I, with the fragments and their sizes indicated on the left of the PFGE gel; and 4, 8111B DNA cleaved by I- Ceu I, with deviations of the cleavage pattern from that of LT7 indicated on the right of the PFGE gel. (B) Local comparison of LT7 and 8111B showing the translocation of I- Ceu I D, which resulted in three hybrid rrn operons, disappearance of two Xba I fragments (F and E) and two Spe I fragments (K and A [not shown on the PFGE picture]), and appearance of two new fragments each from Xba I (198 and 478 kb) and Spe I (377 and 240 kb) digestions.
    Figure Legend Snippet: Genomic translocation exemplified by strain 8111B. (A) PFGE gels of LT7 and 8111B. Lanes: 1, LT7 DNA cleaved by Xba I, with the fragments and their sizes indicated on the left of the PFGE gel; 2, 8111B DNA cleaved by Xba I, with deviations of the cleavage pattern from that of LT7 indicated on the right of the PFGE gel; 3, LT7 DNA cleaved by I- Ceu I, with the fragments and their sizes indicated on the left of the PFGE gel; and 4, 8111B DNA cleaved by I- Ceu I, with deviations of the cleavage pattern from that of LT7 indicated on the right of the PFGE gel. (B) Local comparison of LT7 and 8111B showing the translocation of I- Ceu I D, which resulted in three hybrid rrn operons, disappearance of two Xba I fragments (F and E) and two Spe I fragments (K and A [not shown on the PFGE picture]), and appearance of two new fragments each from Xba I (198 and 478 kb) and Spe I (377 and 240 kb) digestions.

    Techniques Used: Translocation Assay

    Genomic duplication exemplified by strain 8117C. (A) PFGE gels of LT7 and 8117C. Lanes: 1, LT7 DNA cleaved by Xba I; 2, 8117C DNA cleaved by Xba I; 3, LT7 DNA cleaved by I- Ceu I; and 4, 8117C DNA cleaved by I- Ceu I. (B) Local comparison of LT7 and 8117C showing the duplication of I- Ceu I E, which resulted in two hybrid rrn operons, the disappearance of the Xba I fragment F and Spe I fragment K (not shown on the PFGE picture), and the appearance of one new fragment each from Xba I (449 kb) and Spe I (334 kb) digestions.
    Figure Legend Snippet: Genomic duplication exemplified by strain 8117C. (A) PFGE gels of LT7 and 8117C. Lanes: 1, LT7 DNA cleaved by Xba I; 2, 8117C DNA cleaved by Xba I; 3, LT7 DNA cleaved by I- Ceu I; and 4, 8117C DNA cleaved by I- Ceu I. (B) Local comparison of LT7 and 8117C showing the duplication of I- Ceu I E, which resulted in two hybrid rrn operons, the disappearance of the Xba I fragment F and Spe I fragment K (not shown on the PFGE picture), and the appearance of one new fragment each from Xba I (449 kb) and Spe I (334 kb) digestions.

    Techniques Used:

    Long-range PCR to confirm the genomic changes revealed by PFGE. (A) PCR products on an agarose gel, with the templates and primers shown on the right; (B) locations and orientations of the primers shown on the genome of LT7. Hin dIII-cleaved λ DNA was used as the DNA fragment size marker; negative controls of PCR products are not shown in this figure.
    Figure Legend Snippet: Long-range PCR to confirm the genomic changes revealed by PFGE. (A) PCR products on an agarose gel, with the templates and primers shown on the right; (B) locations and orientations of the primers shown on the genome of LT7. Hin dIII-cleaved λ DNA was used as the DNA fragment size marker; negative controls of PCR products are not shown in this figure.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

    25) Product Images from "Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines"

    Article Title: Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0163436

    a, b and c. MBT meat analysis in model meat products . In all figures (a-c), lanes 1 , 3 , 4 and 6 , 8 , 9 are PCR products from 1%, 0.1% and 0.01% MBT meat-spiked chicken ( lanes 1 , 3 and 4 ) and beef ( lanes 6 , 8 , 9 ) meatballs (a), burgers (b), and frankfurters (c), respectively. Lanes 5 and 10 represent the Bfa1 digestion of the PCR products obtained from 0.01% MBT meat-spiked chicken and beef meatballs (a), burgers (b), and frankfurters (c). Lanes 2 and 7 are the Bfa1 digestion of the PCR products obtained from 1% MBT meat-spiked chicken and beef meatballs (a), burgers (b), and frankfurters (c) after autoclaving. Lane L : ladder DNA, and lane 11 : negative control (NC).
    Figure Legend Snippet: a, b and c. MBT meat analysis in model meat products . In all figures (a-c), lanes 1 , 3 , 4 and 6 , 8 , 9 are PCR products from 1%, 0.1% and 0.01% MBT meat-spiked chicken ( lanes 1 , 3 and 4 ) and beef ( lanes 6 , 8 , 9 ) meatballs (a), burgers (b), and frankfurters (c), respectively. Lanes 5 and 10 represent the Bfa1 digestion of the PCR products obtained from 0.01% MBT meat-spiked chicken and beef meatballs (a), burgers (b), and frankfurters (c). Lanes 2 and 7 are the Bfa1 digestion of the PCR products obtained from 1% MBT meat-spiked chicken and beef meatballs (a), burgers (b), and frankfurters (c) after autoclaving. Lane L : ladder DNA, and lane 11 : negative control (NC).

    Techniques Used: Polymerase Chain Reaction, Negative Control

    Cross-specificity analysis of Malayan box turtle (MBT)-specific primers against 20 different non-target animal and plant species. Lane L : ladder DNA (15–1500 bp) and lanes 1–21 : PCR products from the MBT target (120 bp) and eukaryotic endogenous control (141 bp). Please note that the Malayan box turtle-specific product was only amplified from the Malayan box turtle ( lane 1), but the endogenous control was obtained from the Malayan box turtle, the pond slider turtle, chicken, lamb, goat, cow, buffalo, deer, pig, duck, pigeon, dog, monkey, cat, rat, salmon, carp, cod, prawn, wheat and cucumber ( lanes 1–21 , respectively). Lane 22 : negative control (NC).
    Figure Legend Snippet: Cross-specificity analysis of Malayan box turtle (MBT)-specific primers against 20 different non-target animal and plant species. Lane L : ladder DNA (15–1500 bp) and lanes 1–21 : PCR products from the MBT target (120 bp) and eukaryotic endogenous control (141 bp). Please note that the Malayan box turtle-specific product was only amplified from the Malayan box turtle ( lane 1), but the endogenous control was obtained from the Malayan box turtle, the pond slider turtle, chicken, lamb, goat, cow, buffalo, deer, pig, duck, pigeon, dog, monkey, cat, rat, salmon, carp, cod, prawn, wheat and cucumber ( lanes 1–21 , respectively). Lane 22 : negative control (NC).

    Techniques Used: Polymerase Chain Reaction, Amplification, Negative Control

    Sensitivity analysis of pure, binary and ternary admixtures. In the gel image, lanes 1–6 : PCR products from 10, 1, 0.1, 0.01, 0.001, and 0.0001 ng MBT DNA, respectively. Lanes 7–10 (MBT and beef) and lanes 12–15 (MBT and goat) represent PCR products from 10%, 1%, 0.1%, and 0.01% MBT-adulterated binary admixtures, respectively. The Bfa1 digestions of the MBT-specific PCR product realized from 0.01% MBT admixed with beef and goat are shown in lanes 11 and 16 , respectively. In the gel image, lanes 17–20 represent PCR products from the ternary mixture (MBT, chicken and wheat flour) containing 10%, 1%, 0.1%, and 0.01% MBT meat, and lane 21 shows the Bfa1 digestion of the MBT-specific PCR products obtained from the ternary admix containing 0.01% MBT. Lane L : ladder DNA, and lane 22 : negative control (NC).
    Figure Legend Snippet: Sensitivity analysis of pure, binary and ternary admixtures. In the gel image, lanes 1–6 : PCR products from 10, 1, 0.1, 0.01, 0.001, and 0.0001 ng MBT DNA, respectively. Lanes 7–10 (MBT and beef) and lanes 12–15 (MBT and goat) represent PCR products from 10%, 1%, 0.1%, and 0.01% MBT-adulterated binary admixtures, respectively. The Bfa1 digestions of the MBT-specific PCR product realized from 0.01% MBT admixed with beef and goat are shown in lanes 11 and 16 , respectively. In the gel image, lanes 17–20 represent PCR products from the ternary mixture (MBT, chicken and wheat flour) containing 10%, 1%, 0.1%, and 0.01% MBT meat, and lane 21 shows the Bfa1 digestion of the MBT-specific PCR products obtained from the ternary admix containing 0.01% MBT. Lane L : ladder DNA, and lane 22 : negative control (NC).

    Techniques Used: Polymerase Chain Reaction, Negative Control

    26) Product Images from "Long Span DNA Paired-End-Tag (DNA-PET) Sequencing Strategy for the Interrogation of Genomic Structural Mutations and Fusion-Point-Guided Reconstruction of Amplicons"

    Article Title: Long Span DNA Paired-End-Tag (DNA-PET) Sequencing Strategy for the Interrogation of Genomic Structural Mutations and Fusion-Point-Guided Reconstruction of Amplicons

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0046152

    DNA-PET library construction, sequencing and mapping. (A) The genomic DNA was randomly sheared to different size range. (B) The very narrow region DNA fragments were obtained after size selection. (C) The purified DNA fragments were circularized, EcoP15I digested, sequencing adaptor ligated, and finally sequenced by SOLiD sequencer. (D) PET mapping span distribution of 1 kb (blue), 10 kb (red) and 20 kb (green) libraries. Based on the mapping pattern, PETs can be distinguished as concordant PETs and discordant PETs.
    Figure Legend Snippet: DNA-PET library construction, sequencing and mapping. (A) The genomic DNA was randomly sheared to different size range. (B) The very narrow region DNA fragments were obtained after size selection. (C) The purified DNA fragments were circularized, EcoP15I digested, sequencing adaptor ligated, and finally sequenced by SOLiD sequencer. (D) PET mapping span distribution of 1 kb (blue), 10 kb (red) and 20 kb (green) libraries. Based on the mapping pattern, PETs can be distinguished as concordant PETs and discordant PETs.

    Techniques Used: Positron Emission Tomography, Sequencing, Selection, Purification

    27) Product Images from "Protein-mediated looping of DNA under tension requires supercoiling"

    Article Title: Protein-mediated looping of DNA under tension requires supercoiling

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky021

    Experimental schematics and representative data. ( A ) A representative recording of mean squared excursion versus time shows intermittent changes in the average excursion of the bead as LacI-induced looping changes the overall tether length in a 909 bp Os-400-O1 DNA tether. At right, a histogram of the excursion values for the recordings exhibits three peaks which represent the two looped states and the unlooped state fitted with Gaussian curves, shown in red, yellow, and purple respectively. Similar data were recorded for 831-bp-long O1-400-O2 tethers (not shown). ( B ) A schematic representation of tether length changes due to LacI-induced DNA looping during a TPM experiment (not to scale). ( C ) A schematic representation of writhe created using a magnetic tweezer and trapped within a LacI-mediated loop (not to scale). Red/green dots indicate biotin/streptavidin linkages of DNA to beads. Orange diamonds/blue crosses indicate digoxigenin/antidigoxigenin linkages of DNA to glass. O1-400-O2 DNA looped by LacI is shown to trap three negative (-) supercoils. The north and south poles of magnets above the microscope stage create a magnetic field to attract and rotate the bead to allow stretching and twisting of the DNA. ( D ) Recordings of the extension of a 2115 bp-long O1–400-O2 DNA tether under 0.45 pN of tension at different levels of negative supercoiling in the absence (blue) and in the presence (black) of LacI. Extended (unlooped) states dominate at low negative linking number values but become intermittent and finally disappear altogether as negative supercoiling increases and favors the looped state.
    Figure Legend Snippet: Experimental schematics and representative data. ( A ) A representative recording of mean squared excursion versus time shows intermittent changes in the average excursion of the bead as LacI-induced looping changes the overall tether length in a 909 bp Os-400-O1 DNA tether. At right, a histogram of the excursion values for the recordings exhibits three peaks which represent the two looped states and the unlooped state fitted with Gaussian curves, shown in red, yellow, and purple respectively. Similar data were recorded for 831-bp-long O1-400-O2 tethers (not shown). ( B ) A schematic representation of tether length changes due to LacI-induced DNA looping during a TPM experiment (not to scale). ( C ) A schematic representation of writhe created using a magnetic tweezer and trapped within a LacI-mediated loop (not to scale). Red/green dots indicate biotin/streptavidin linkages of DNA to beads. Orange diamonds/blue crosses indicate digoxigenin/antidigoxigenin linkages of DNA to glass. O1-400-O2 DNA looped by LacI is shown to trap three negative (-) supercoils. The north and south poles of magnets above the microscope stage create a magnetic field to attract and rotate the bead to allow stretching and twisting of the DNA. ( D ) Recordings of the extension of a 2115 bp-long O1–400-O2 DNA tether under 0.45 pN of tension at different levels of negative supercoiling in the absence (blue) and in the presence (black) of LacI. Extended (unlooped) states dominate at low negative linking number values but become intermittent and finally disappear altogether as negative supercoiling increases and favors the looped state.

    Techniques Used: Microscopy

    28) Product Images from "Measuring glycolytic flux in single yeast cells with an orthogonal synthetic biosensor"

    Article Title: Measuring glycolytic flux in single yeast cells with an orthogonal synthetic biosensor

    Journal: Molecular Systems Biology

    doi: 10.15252/msb.20199071

    Illustration of the biosensor concept to measure glycolytic fluxes in single S. cerevisiae cells Expression of the bacterial transcriptional repressor CggR at constant levels, i.e., independent of growth rate and substrates. Binding of CggR as a dimer of dimers to the operator (CggRO) of the synthetic cis‐regulatory region, forming the CggR–DNA complex repressing transcription. At high glycolytic fluxes, fructose‐1,6‐bisphosphate (FBP) levels are high and FBP binds to CggR disrupting the dimer–dimer contacts, which induces a conformational change in the repressor, such that transcription of the reporter gene (YFP) can occur. The binding of FBP to CggR and consequent transcription is dependent on the FBP concentration, which correlates with glycolytic flux. The activity of the glycolytic flux biosensor is measured by quantifying YFP expression. YFP expression levels are normalized through a second reporter, mCherry, under the control of TEF1 mutant 8 promoter (P TEFmut8 ), to control for global variation in protein expression activity.
    Figure Legend Snippet: Illustration of the biosensor concept to measure glycolytic fluxes in single S. cerevisiae cells Expression of the bacterial transcriptional repressor CggR at constant levels, i.e., independent of growth rate and substrates. Binding of CggR as a dimer of dimers to the operator (CggRO) of the synthetic cis‐regulatory region, forming the CggR–DNA complex repressing transcription. At high glycolytic fluxes, fructose‐1,6‐bisphosphate (FBP) levels are high and FBP binds to CggR disrupting the dimer–dimer contacts, which induces a conformational change in the repressor, such that transcription of the reporter gene (YFP) can occur. The binding of FBP to CggR and consequent transcription is dependent on the FBP concentration, which correlates with glycolytic flux. The activity of the glycolytic flux biosensor is measured by quantifying YFP expression. YFP expression levels are normalized through a second reporter, mCherry, under the control of TEF1 mutant 8 promoter (P TEFmut8 ), to control for global variation in protein expression activity.

    Techniques Used: Expressing, Binding Assay, Concentration Assay, Activity Assay, Mutagenesis

    29) Product Images from "A ligation-based single-stranded library preparation method to analyze cell-free DNA and synthetic oligos"

    Article Title: A ligation-based single-stranded library preparation method to analyze cell-free DNA and synthetic oligos

    Journal: BMC Genomics

    doi: 10.1186/s12864-019-6355-0

    Schematic overview of SRSLY. A DNA input pool of diverse template molecules is denatured with heat and maintained as single-stranded molecules through a cold-snap and use of a thermostable single-stranded DNA binding protein (SSB). Template DNA is phosphorylated and SRSLY splint adapters are ligated in a combined phosphorylation/ligation reaction. Adapters contain a random single-stranded splint overhang and ligation blocking modifications on all termini except for the ones that facilitate correctly oriented library molecules. After clean up, molecules are ready for index PCR
    Figure Legend Snippet: Schematic overview of SRSLY. A DNA input pool of diverse template molecules is denatured with heat and maintained as single-stranded molecules through a cold-snap and use of a thermostable single-stranded DNA binding protein (SSB). Template DNA is phosphorylated and SRSLY splint adapters are ligated in a combined phosphorylation/ligation reaction. Adapters contain a random single-stranded splint overhang and ligation blocking modifications on all termini except for the ones that facilitate correctly oriented library molecules. After clean up, molecules are ready for index PCR

    Techniques Used: Binding Assay, Ligation, Blocking Assay, Polymerase Chain Reaction

    30) Product Images from "Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent"

    Article Title: Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent

    Journal: Wellcome Open Research

    doi: 10.12688/wellcomeopenres.14741.2

    DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.
    Figure Legend Snippet: DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.

    Techniques Used: DNA Methylation Assay, Methylated DNA Immunoprecipitation, Infection, Clone Assay, Polymerase Chain Reaction

    31) Product Images from "Reversed paired-gRNA plasmid cloning strategy for efficient genome editing in Escherichia coli"

    Article Title: Reversed paired-gRNA plasmid cloning strategy for efficient genome editing in Escherichia coli

    Journal: bioRxiv

    doi: 10.1101/839555

    The design and stability of RPGPs pDG-R-100K in E. coli . A) The modular construction strategy of pDG-R-X series. pKT plasmid was designed for PCR amplification of DNA part 1 and part 2 series. DNA part 1 which contained pDG-R-X backbone and two reversed repeated gRNA scaffolds was amplified by using only one prime. DNA part 2 contained two different promoters followed by a 20-bp target sequence respectively. For the PCR reaction, the 20-bp sequences specific for two targeted loci and another 20-bp overlap sequences for assembly were embedded in primers as a part of insert. Gibson Assembly method was preformed to assemble these parts into pDG-R1-X or pDG-R2-X series. B) Representative PCR results of pDG-R1-100K after re-transformation process in E. coli . C) The double restriction enzyme digestion analyses of pDG-R1-100K and its derivations.
    Figure Legend Snippet: The design and stability of RPGPs pDG-R-100K in E. coli . A) The modular construction strategy of pDG-R-X series. pKT plasmid was designed for PCR amplification of DNA part 1 and part 2 series. DNA part 1 which contained pDG-R-X backbone and two reversed repeated gRNA scaffolds was amplified by using only one prime. DNA part 2 contained two different promoters followed by a 20-bp target sequence respectively. For the PCR reaction, the 20-bp sequences specific for two targeted loci and another 20-bp overlap sequences for assembly were embedded in primers as a part of insert. Gibson Assembly method was preformed to assemble these parts into pDG-R1-X or pDG-R2-X series. B) Representative PCR results of pDG-R1-100K after re-transformation process in E. coli . C) The double restriction enzyme digestion analyses of pDG-R1-100K and its derivations.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Amplification, Sequencing, Transformation Assay

    The design and stability of DRs-involved paired-gRNA plasmids pDG-A-100K in E. coli . A) The modular construction strategy of pDG-A-X series. pKB plasmid was used for PCR amplification of DNA part 1, which contained pDG-A-X backbone, one constitutive promoter J23119, and a gRNA scaffold. pKI plasmid was used for PCR amplification of part 2 series, which contained a gRNA fragment followed by another constitutive promoter J23119 and 20-bp target sequence. For the PCR reaction, the 20-bp sequences specific for two targeted loci and the 20-bp overlap sequences for Gibson Assembly were embedded in primers as a part of insert. Gibson Assembly method was preformed to assemble these parts into pDG-A-X series. B) Representative PCR results for the deletion rate of pDG-A-100K after re-transformation process in E. coli . C) The double restriction enzyme digestion analyses of pDG-A-100K and its deletion derivations. D) The deletion rates of pDG-A-100K when introduced by chemical transformation or electroporation and cultured in the condition of Luria-Bertani (LB) medium or Terrific Broth (TB) medium. Data are expressed as means ±s.d. from three independent experiments. E) The deletion rates of pDG-A-100K after the re-transformation process in various strains of E. coli . Data are expressed as means ±s.d. from three independent experiments.
    Figure Legend Snippet: The design and stability of DRs-involved paired-gRNA plasmids pDG-A-100K in E. coli . A) The modular construction strategy of pDG-A-X series. pKB plasmid was used for PCR amplification of DNA part 1, which contained pDG-A-X backbone, one constitutive promoter J23119, and a gRNA scaffold. pKI plasmid was used for PCR amplification of part 2 series, which contained a gRNA fragment followed by another constitutive promoter J23119 and 20-bp target sequence. For the PCR reaction, the 20-bp sequences specific for two targeted loci and the 20-bp overlap sequences for Gibson Assembly were embedded in primers as a part of insert. Gibson Assembly method was preformed to assemble these parts into pDG-A-X series. B) Representative PCR results for the deletion rate of pDG-A-100K after re-transformation process in E. coli . C) The double restriction enzyme digestion analyses of pDG-A-100K and its deletion derivations. D) The deletion rates of pDG-A-100K when introduced by chemical transformation or electroporation and cultured in the condition of Luria-Bertani (LB) medium or Terrific Broth (TB) medium. Data are expressed as means ±s.d. from three independent experiments. E) The deletion rates of pDG-A-100K after the re-transformation process in various strains of E. coli . Data are expressed as means ±s.d. from three independent experiments.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Amplification, Sequencing, Transformation Assay, Electroporation, Cell Culture

    32) Product Images from "The innate immune sensor IFI16 recognizes foreign DNA in the nucleus by scanning along the duplex"

    Article Title: The innate immune sensor IFI16 recognizes foreign DNA in the nucleus by scanning along the duplex

    Journal: eLife

    doi: 10.7554/eLife.11721

    Reconstituted nucleosomes on restricted λdsDNA: EcoRI digestion generated l-DNA fragments of 21 kbp, 7.5 kbp, 5.8 kbp, 5.6 kbp, 4.8 kbp, and 3.5 kbp. DOI: http://dx.doi.org/10.7554/eLife.11721.015
    Figure Legend Snippet: Reconstituted nucleosomes on restricted λdsDNA: EcoRI digestion generated l-DNA fragments of 21 kbp, 7.5 kbp, 5.8 kbp, 5.6 kbp, 4.8 kbp, and 3.5 kbp. DOI: http://dx.doi.org/10.7554/eLife.11721.015

    Techniques Used: Generated

    33) Product Images from "Molecular and Functional Analyses of the Fast Skeletal Myosin Light Chain2 Gene of the Korean Oily Bitterling, Acheilognathus koreensis"

    Article Title: Molecular and Functional Analyses of the Fast Skeletal Myosin Light Chain2 Gene of the Korean Oily Bitterling, Acheilognathus koreensis

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms140816672

    Analysis of DsRed reporter activity of the Akmlc2f promoter in the zebrafish embryo. The fluorescent protein reporter of the Akmlc2f promoter, pDsRed2-1/Akmlc2f P2657 was digested with the restriction endonuclease Apa LI and then the DNA solution at concentrations of 25 ng/mL was injected into the one-cell stage embryos using an air-pressure microinjector (WPI). Digital images of embryo (6 days post hatching) were captured using a macro zoom fluorescence microscope (Olympus, Tokyo, Japan). Scale bar = 200 μm
    Figure Legend Snippet: Analysis of DsRed reporter activity of the Akmlc2f promoter in the zebrafish embryo. The fluorescent protein reporter of the Akmlc2f promoter, pDsRed2-1/Akmlc2f P2657 was digested with the restriction endonuclease Apa LI and then the DNA solution at concentrations of 25 ng/mL was injected into the one-cell stage embryos using an air-pressure microinjector (WPI). Digital images of embryo (6 days post hatching) were captured using a macro zoom fluorescence microscope (Olympus, Tokyo, Japan). Scale bar = 200 μm

    Techniques Used: Activity Assay, Injection, Fluorescence, Microscopy

    34) Product Images from "Differential Methylation of the HPV 16 Upstream Regulatory Region during Epithelial Differentiation and Neoplastic Transformation"

    Article Title: Differential Methylation of the HPV 16 Upstream Regulatory Region during Epithelial Differentiation and Neoplastic Transformation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0024451

    Differentiation dependent HPV16 URR methylation in the latent infections. The methylation status of the HPV16 URR was determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR as indicated by the blue arrows in the upper part of the Figure. DNA derived from laser-microdissected basal, intermediated and superficial layers of the cervical normal HPV 16 infected epithelium was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV-16 genomes. The analyzed region encompasses 3 functionally distinct segments that have been referred to as the 5′ LCR, the enhancer, and the promoter. Open circles represent an unmethylated CpGs, filled circles represent methylated CpGs.
    Figure Legend Snippet: Differentiation dependent HPV16 URR methylation in the latent infections. The methylation status of the HPV16 URR was determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR as indicated by the blue arrows in the upper part of the Figure. DNA derived from laser-microdissected basal, intermediated and superficial layers of the cervical normal HPV 16 infected epithelium was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV-16 genomes. The analyzed region encompasses 3 functionally distinct segments that have been referred to as the 5′ LCR, the enhancer, and the promoter. Open circles represent an unmethylated CpGs, filled circles represent methylated CpGs.

    Techniques Used: Methylation, DNA Sequencing, Amplification, Derivative Assay, Infection, Clone Assay

    HPV16 URR methylation in the transforming infections. The methylation status of the HPV16 URR determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR. DNA derived from laser-microdissected p16 INK4a -positive transformed epithelium was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV 16 genomes. Open circles represent unmethylated CpGs, filled circles represent methylated CpGs.
    Figure Legend Snippet: HPV16 URR methylation in the transforming infections. The methylation status of the HPV16 URR determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR. DNA derived from laser-microdissected p16 INK4a -positive transformed epithelium was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV 16 genomes. Open circles represent unmethylated CpGs, filled circles represent methylated CpGs.

    Techniques Used: Methylation, DNA Sequencing, Amplification, Derivative Assay, Transformation Assay, Clone Assay

    Differentiation dependent HPV16 URR methylation in the permissive infections. The methylation status of the HPV16 URR determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR. DNA derived from laser-microdissected basal, intermediated and superficial layers of the cervical epithelium with permissive HPV16 infection was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV 16 genomes. Open circles represent unmethylated CpGs, filled circles represent methylated CpGs.
    Figure Legend Snippet: Differentiation dependent HPV16 URR methylation in the permissive infections. The methylation status of the HPV16 URR determined by bisulfite treatment followed by direct DNA sequencing of amplified DNA fragments using 3 sets of primers covering the complete HPV16 URR. DNA derived from laser-microdissected basal, intermediated and superficial layers of the cervical epithelium with permissive HPV16 infection was amplified and cloned. 12 individual clones were sequenced to identify the presence and patterns of the methylated CpG dinucleotides. The Figure visualizes schematically the methylation of 16 CpG dinucleotides (positions from 7198 to 161) in the URR of HPV 16 genomes. Open circles represent unmethylated CpGs, filled circles represent methylated CpGs.

    Techniques Used: Methylation, DNA Sequencing, Amplification, Derivative Assay, Infection, Clone Assay

    Methylation of the E2BS1 increases the p97 promoter activity. A. To measure the impact of methylation of the E2BS1 on the p97 promoter activity site specific modifications within the E2BS1 of LCR HPV16 of pGLuc reporter vector construct were generated using modified oligonucleotides. Three constructs containing either an unmethylated (wt E2BS1), a mutated (mutE2BS1) or a methylated (methE2BS1) E2BS1 were used. B and C. These plasmid constructs were co-transfected into C33A and NHK cells and increasing amount of E2 expression vector. The secreted Gaussia luciferase activities were normalized using the corresponding internal ß-galactosidase activities. Each value represents the mean ±standard deviation of at least three independent transfection experiments, each performed in triplicate. D. To analyze the impact of methylation of E2BS1 on the early promoter activity in the natural context of the HPV 16 genome where E2 expression is under control of the p97 early promoter, NHK were transiently transfected with full length HPV16 genome (wt or methylated E2BS1). E. The effect of selective E2BS1 methylation in full-length HPV16 on E6 gene expression was measured by real-time PCR. Wild type and HPV16 full-length genome and the full length HPV16 genome with 2 selectively methylated CpGs within E2BS1 were transfected into normal human foreskin keratinocytes (NHK.f.). Total RNA from cells 24, 48 and 72 hours after transfection was assayed for the expression of E6 mRNA. Relative luciferase activities were calculated with respect to the values of the wt construct, which was set to 1, for each time point. The data represent the mean of four independent experiments performed with each sample in triplicate with error bars indicating ± S.D. Mean values and SDs were calculated from Sigma Plot 10.0. F. To test whether methylation recruits other binding of transcription factors to the region of E2BS1, we performed EMSA analysis using nuclear cell extracts isolated from NHK. Methylated and unmethylated DNA probes spanning the regions containing the E2BS1 were used. The methylated probes showed three shifted bands by adding nuclear cell extracts (line 4, 6). Unmethylated probes were not shifted by the same nuclear extract (lane 3, 5). Competition experiments were performed with non-labeled probes (lines 7 and 8).
    Figure Legend Snippet: Methylation of the E2BS1 increases the p97 promoter activity. A. To measure the impact of methylation of the E2BS1 on the p97 promoter activity site specific modifications within the E2BS1 of LCR HPV16 of pGLuc reporter vector construct were generated using modified oligonucleotides. Three constructs containing either an unmethylated (wt E2BS1), a mutated (mutE2BS1) or a methylated (methE2BS1) E2BS1 were used. B and C. These plasmid constructs were co-transfected into C33A and NHK cells and increasing amount of E2 expression vector. The secreted Gaussia luciferase activities were normalized using the corresponding internal ß-galactosidase activities. Each value represents the mean ±standard deviation of at least three independent transfection experiments, each performed in triplicate. D. To analyze the impact of methylation of E2BS1 on the early promoter activity in the natural context of the HPV 16 genome where E2 expression is under control of the p97 early promoter, NHK were transiently transfected with full length HPV16 genome (wt or methylated E2BS1). E. The effect of selective E2BS1 methylation in full-length HPV16 on E6 gene expression was measured by real-time PCR. Wild type and HPV16 full-length genome and the full length HPV16 genome with 2 selectively methylated CpGs within E2BS1 were transfected into normal human foreskin keratinocytes (NHK.f.). Total RNA from cells 24, 48 and 72 hours after transfection was assayed for the expression of E6 mRNA. Relative luciferase activities were calculated with respect to the values of the wt construct, which was set to 1, for each time point. The data represent the mean of four independent experiments performed with each sample in triplicate with error bars indicating ± S.D. Mean values and SDs were calculated from Sigma Plot 10.0. F. To test whether methylation recruits other binding of transcription factors to the region of E2BS1, we performed EMSA analysis using nuclear cell extracts isolated from NHK. Methylated and unmethylated DNA probes spanning the regions containing the E2BS1 were used. The methylated probes showed three shifted bands by adding nuclear cell extracts (line 4, 6). Unmethylated probes were not shifted by the same nuclear extract (lane 3, 5). Competition experiments were performed with non-labeled probes (lines 7 and 8).

    Techniques Used: Methylation, Activity Assay, Plasmid Preparation, Construct, Generated, Modification, Transfection, Expressing, Luciferase, Standard Deviation, Real-time Polymerase Chain Reaction, Binding Assay, Isolation, Labeling

    35) Product Images from "Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli"

    Article Title: Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli

    Journal: Microbial biotechnology

    doi: 10.1111/j.1751-7915.2010.00164.x

    Excision of Rac prophage. Rac prophage in E. coli has two conserved attachment sites (5′‐TTGTTCAGGTTGTATTGTTCTTTCTT‐3′, 26 bp) at the left and the right ends of Rac indicated as red lines (A). Rac excision is induced by H‐NS K57N, and circularized to form a phage‐like circle. Rac excision and phage‐like circle were verified by DNA sequencing using primers Rac up and Rac down (Table S3) and by PCR using primer sets; green arrows indicate primers for Rac excision (Rac‐f and Rac‐r) and red arrows for the Rac circle (Rac‐cf and Rac‐cr) (Table S3). Excision of Rac in LB at 37°C for BW25113 hha hns cells producing H‐NS K57N and wild‐type H‐NS after 7 h and 24 h (B), for BW25113, BW25113 hha , BW25113 hns and BW25113 hha hns without a plasmid after 15 h (C), and for BW25113 intR producing H‐NS K57N and IntR after 24 h (D). The number of chromosomes was quantified by qPCR using a reference gene, purA , using primers purA‐f and purA‐r and the number of chromosomes devoid of Rac was quantified using primers Rac‐f and Rac‐r (Table S3). Each data point is the average of at least four replicates from each of two independent cultures, and one standard deviation is shown. H‐NS K57N, H‐NS and IntR were produced using 1 mM IPTG.
    Figure Legend Snippet: Excision of Rac prophage. Rac prophage in E. coli has two conserved attachment sites (5′‐TTGTTCAGGTTGTATTGTTCTTTCTT‐3′, 26 bp) at the left and the right ends of Rac indicated as red lines (A). Rac excision is induced by H‐NS K57N, and circularized to form a phage‐like circle. Rac excision and phage‐like circle were verified by DNA sequencing using primers Rac up and Rac down (Table S3) and by PCR using primer sets; green arrows indicate primers for Rac excision (Rac‐f and Rac‐r) and red arrows for the Rac circle (Rac‐cf and Rac‐cr) (Table S3). Excision of Rac in LB at 37°C for BW25113 hha hns cells producing H‐NS K57N and wild‐type H‐NS after 7 h and 24 h (B), for BW25113, BW25113 hha , BW25113 hns and BW25113 hha hns without a plasmid after 15 h (C), and for BW25113 intR producing H‐NS K57N and IntR after 24 h (D). The number of chromosomes was quantified by qPCR using a reference gene, purA , using primers purA‐f and purA‐r and the number of chromosomes devoid of Rac was quantified using primers Rac‐f and Rac‐r (Table S3). Each data point is the average of at least four replicates from each of two independent cultures, and one standard deviation is shown. H‐NS K57N, H‐NS and IntR were produced using 1 mM IPTG.

    Techniques Used: DNA Sequencing, Polymerase Chain Reaction, Plasmid Preparation, Real-time Polymerase Chain Reaction, Standard Deviation, Produced

    Cell lysis by H‐NS K57N in wild‐type BW25113 (WT), BW25113 hha hns ( hha hns ), BW25113 Δ rac (Δ rac ), BW25113 hokD ( hokD ) and BW25113 Δ rac hokD (Δ rac hokD ) in LB at 37°C after 11 h. Extracellular DNA (eDNA) and intracellular DNA (iDNA) were quantified by qPCR using reference gene purA via the purA‐f and purA‐r primers. Cell lysis was calculated by dividing the amount of eDNA by the sum of eDNA and iDNA. Each data point is the average of at least four replicates from two independent cultures, and one standard deviation is shown. H‐NS K57N and H‐NS were produced using 1 mM IPTG.
    Figure Legend Snippet: Cell lysis by H‐NS K57N in wild‐type BW25113 (WT), BW25113 hha hns ( hha hns ), BW25113 Δ rac (Δ rac ), BW25113 hokD ( hokD ) and BW25113 Δ rac hokD (Δ rac hokD ) in LB at 37°C after 11 h. Extracellular DNA (eDNA) and intracellular DNA (iDNA) were quantified by qPCR using reference gene purA via the purA‐f and purA‐r primers. Cell lysis was calculated by dividing the amount of eDNA by the sum of eDNA and iDNA. Each data point is the average of at least four replicates from two independent cultures, and one standard deviation is shown. H‐NS K57N and H‐NS were produced using 1 mM IPTG.

    Techniques Used: Lysis, Real-time Polymerase Chain Reaction, Standard Deviation, Produced

    36) Product Images from "Quality of TCR signaling encoded by differential enhancer affinities for the composite BATF-IRF4 transcription factor complex"

    Article Title: Quality of TCR signaling encoded by differential enhancer affinities for the composite BATF-IRF4 transcription factor complex

    Journal: Nature immunology

    doi: 10.1038/ni.3714

    Human CTLA4 SNP affects BATF-IRF4 DNA binding affinity and enhancer activity. ( a ) Flow cytometry analyzing CTLA-4 expression in indicated helper T cell subsets cultured on crosslinked anti-CD3ε and anti-CD28 for 4 days under T H 1 (anti-IL-4, IL-12 and IFN-γ), T H 2 (anti-IL-12, anti-IFN-γ and IL-4), T H 17 (anti-IFN-γ, anti-IL-12, anti-IL-4, IL-6, TGF-β and IL-1β), Treg (anti-IFN-γ, anti-IL-12, anti-IL-4, TGF-β) conditions. ( b ) Flow cytometry analyzing CTLA-4 expression in CD3 + CD4 + Foxp3 + T cells in mesenteric lymph node. Data are representative of two replicates. ( c ) Sequences of human SNP rs231735 ( CTLA4 -38kb). ( d ) EMSA using nuclear extract of HEK293 FT cells expressing BATF, JUNB and varying amounts of IRF4 with probes based on of rs231735-G and rs231735-T. ( e ) Structure of reporter retrovirus for ( f ). ( f ) Integrated MFI analysis of reporter activity in T H 2 cells expressing retroviral reporter construct containing no AICE, rs231735-G, or rs231735-T. Two-way ANOVA with Tukey’s multiple comparison; **** P
    Figure Legend Snippet: Human CTLA4 SNP affects BATF-IRF4 DNA binding affinity and enhancer activity. ( a ) Flow cytometry analyzing CTLA-4 expression in indicated helper T cell subsets cultured on crosslinked anti-CD3ε and anti-CD28 for 4 days under T H 1 (anti-IL-4, IL-12 and IFN-γ), T H 2 (anti-IL-12, anti-IFN-γ and IL-4), T H 17 (anti-IFN-γ, anti-IL-12, anti-IL-4, IL-6, TGF-β and IL-1β), Treg (anti-IFN-γ, anti-IL-12, anti-IL-4, TGF-β) conditions. ( b ) Flow cytometry analyzing CTLA-4 expression in CD3 + CD4 + Foxp3 + T cells in mesenteric lymph node. Data are representative of two replicates. ( c ) Sequences of human SNP rs231735 ( CTLA4 -38kb). ( d ) EMSA using nuclear extract of HEK293 FT cells expressing BATF, JUNB and varying amounts of IRF4 with probes based on of rs231735-G and rs231735-T. ( e ) Structure of reporter retrovirus for ( f ). ( f ) Integrated MFI analysis of reporter activity in T H 2 cells expressing retroviral reporter construct containing no AICE, rs231735-G, or rs231735-T. Two-way ANOVA with Tukey’s multiple comparison; **** P

    Techniques Used: Binding Assay, Activity Assay, Flow Cytometry, Cytometry, Expressing, Cell Culture, Construct

    37) Product Images from "Mycoplasma CG- and GATC-specific DNA methyltransferases selectively and efficiently methylate the host genome and alter the epigenetic landscape in human cells"

    Article Title: Mycoplasma CG- and GATC-specific DNA methyltransferases selectively and efficiently methylate the host genome and alter the epigenetic landscape in human cells

    Journal: Epigenetics

    doi: 10.1080/15592294.2015.1020000

    Detection of mycoplasma in colorectal cancer specimens. A 270 bp PCR product specific to the mycoplasma rRNA gene was amplified from the total DNA isolated from colorectal cancer tumor (T) and matching normal (N) specimens (negative cases Cs661
    Figure Legend Snippet: Detection of mycoplasma in colorectal cancer specimens. A 270 bp PCR product specific to the mycoplasma rRNA gene was amplified from the total DNA isolated from colorectal cancer tumor (T) and matching normal (N) specimens (negative cases Cs661

    Techniques Used: Polymerase Chain Reaction, Amplification, Isolation

    38) Product Images from "Covalent genomic DNA modification patterns revealed by denaturing gradient gel blots"

    Article Title: Covalent genomic DNA modification patterns revealed by denaturing gradient gel blots

    Journal: Gene

    doi: 10.1016/j.gene.2006.12.002

    Tissue-specific modifications in the mouse F8 gene. (A) DGG blot containing Dde I-digested DNA isolated from various tissues from a single mouse, electrophoresed on a 20–80% DGG for 1500 VH, and hybridized with a 1.5 kb Nco I mouse F8 cDNA fragment
    Figure Legend Snippet: Tissue-specific modifications in the mouse F8 gene. (A) DGG blot containing Dde I-digested DNA isolated from various tissues from a single mouse, electrophoresed on a 20–80% DGG for 1500 VH, and hybridized with a 1.5 kb Nco I mouse F8 cDNA fragment

    Techniques Used: Isolation

    39) Product Images from "High-throughput sequencing of sorted expression libraries reveals inhibitors of bacterial cell division"

    Article Title: High-throughput sequencing of sorted expression libraries reveals inhibitors of bacterial cell division

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-5187-7

    Overexpression of the pptE and pdhR ORFs cause E. coli filamentation independent of recA (SOS response). The pptE and pdhR ORFs from UTI89 were cloned into pBAD24, transformed into BW25113, and BW25113 (Δ recA ), and cultures induced with 0.2% L-arabinose in M9 medium. Fixed cells were analysed by microscopy ( a ) and Coulter cytometry to obtain cell volume distributions ( b ). c Fixed cells were stained using the Hoechst 33342 (DNA) and FM4–64 (membrane) and imaged by fluorescence microscopy. An overlay of the Hoechst and FM4–64 channels is also shown, indicating the obvious anti-correlation between the two stains, suggesting a possible physical exclusion of these features
    Figure Legend Snippet: Overexpression of the pptE and pdhR ORFs cause E. coli filamentation independent of recA (SOS response). The pptE and pdhR ORFs from UTI89 were cloned into pBAD24, transformed into BW25113, and BW25113 (Δ recA ), and cultures induced with 0.2% L-arabinose in M9 medium. Fixed cells were analysed by microscopy ( a ) and Coulter cytometry to obtain cell volume distributions ( b ). c Fixed cells were stained using the Hoechst 33342 (DNA) and FM4–64 (membrane) and imaged by fluorescence microscopy. An overlay of the Hoechst and FM4–64 channels is also shown, indicating the obvious anti-correlation between the two stains, suggesting a possible physical exclusion of these features

    Techniques Used: Over Expression, Clone Assay, Transformation Assay, Microscopy, Cytometry, Staining, Fluorescence

    40) Product Images from "IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿"

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿

    Journal:

    doi: 10.1128/JCM.01322-06

    IS 1301 insertion sites within the strain DE9246 characterized in more detail. The external reference digoxigenin-labeled DNA molecular weight marker III (Roche Diagnostics GmbH, Penzberg, Germany) is displayed for comparison and marked ‘Ref.’
    Figure Legend Snippet: IS 1301 insertion sites within the strain DE9246 characterized in more detail. The external reference digoxigenin-labeled DNA molecular weight marker III (Roche Diagnostics GmbH, Penzberg, Germany) is displayed for comparison and marked ‘Ref.’

    Techniques Used: Labeling, Molecular Weight, Marker

    Related Articles

    Amplification:

    Article Title: Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response
    Article Snippet: .. DNA fragments containing target sites were PCR amplified and digested with T7E1 (NEB, #M0302) and analyzed via agarose gel electrophoresis. .. Non-perfectly matched DNA would be cleaved by T7E1.

    Article Title: Refined Requirements for Protein Regions Important for Activity of the TALE AvrBs3
    Article Snippet: .. Construction of AvrBs3 derivatives and controls Generally, DNA fragments were amplified using oligonucleotides providing Bsa I sites and Phusion polymerase (New England Biolabs GmbH, Frankfurt/Main, Germany). .. AvrBs3 and derivatives were cloned in a two-step cut-ligation reaction using the Golden TAL Technology [ ].

    Article Title: Sp1-mediated microRNA-182 expression regulates lung cancer progression
    Article Snippet: .. After amplification and purification, the DNA fragments were ligated to pGL2 vector using restriction enzymes, KpnI and BglII for pGL2-miR-182, MluI and BglII for pGL2-FOXO3 (New England Biolabs, Ipswich, MA). ..

    Agarose Gel Electrophoresis:

    Article Title: Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response
    Article Snippet: .. DNA fragments containing target sites were PCR amplified and digested with T7E1 (NEB, #M0302) and analyzed via agarose gel electrophoresis. .. Non-perfectly matched DNA would be cleaved by T7E1.

    Plasmid Preparation:

    Article Title: Sp1-mediated microRNA-182 expression regulates lung cancer progression
    Article Snippet: .. After amplification and purification, the DNA fragments were ligated to pGL2 vector using restriction enzymes, KpnI and BglII for pGL2-miR-182, MluI and BglII for pGL2-FOXO3 (New England Biolabs, Ipswich, MA). ..

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo
    Article Snippet: .. First, a homology plasmid was constructed by subcloning two DNA fragments derived from wild-type HSV-2 MS genomic DNA into a pUC19 plasmid vector (New England Biolabs), encompassing sequences homologous to 517 bp upstream of the HSV-2 ICP0 start codon and 545 bp downstream of the ICP0 stop codon. .. During cloning, XbaI and BamHI restriction sites were introduced in-between the two homology arms.

    Subcloning:

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo
    Article Snippet: .. First, a homology plasmid was constructed by subcloning two DNA fragments derived from wild-type HSV-2 MS genomic DNA into a pUC19 plasmid vector (New England Biolabs), encompassing sequences homologous to 517 bp upstream of the HSV-2 ICP0 start codon and 545 bp downstream of the ICP0 stop codon. .. During cloning, XbaI and BamHI restriction sites were introduced in-between the two homology arms.

    Labeling:

    Article Title: Conversion of 5-Methylcytosine to 5-Hydroxymethylcytosine in Mammalian DNA by MLL Partner TET1
    Article Snippet: .. 400 ng of eluted DNA fragments were end-labeled with T4 Polynucleotide Kinase (T4 PNK) (NEB) and 10 μCi of [γ32- P]-ATP for 1 hour at 37 C. Labeled fragments were precipitated by the addition of 30 μg of linear polyacrylamide, 1/10 volume of 3 M NaAcetate, pH 7.2 and 2.5 volumes of ethanol at left at −80 C for 1 hour. .. Samples were spun at 14,000 rpm, for 20 minutes at 4 C and washed twice with 70% EtOH at 25 C. Pellets were resuspended in 30 mM Tris, pH 8.9, 15 mM MgCl2 , 2 mM CaCl, with 10 μg of DNaseI (Worthington) and 10 μg SVPD (Worthington) and incubated for 3 hours at 37 C. 3 μl was spotted on cellulose TLC plates (20 cm × 20 cm, Merck) and developed in isobutyric acid: H2 0: NH3 (66:20:1).

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6
    Article Snippet: .. Electrophoretic mobility shift assays For DNA probes larger than 100 bp, DNA fragments were produced by PCR, and 5 pmole was labeled with 32 P using T4 polynucleotide kinase (NEB). .. For DNA probes less than 100 bp, one oligonucleotide was labeled with 32 P, then annealed with the complementary oligonucleotide.

    Purification:

    Article Title: Sp1-mediated microRNA-182 expression regulates lung cancer progression
    Article Snippet: .. After amplification and purification, the DNA fragments were ligated to pGL2 vector using restriction enzymes, KpnI and BglII for pGL2-miR-182, MluI and BglII for pGL2-FOXO3 (New England Biolabs, Ipswich, MA). ..

    Produced:

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6
    Article Snippet: .. Electrophoretic mobility shift assays For DNA probes larger than 100 bp, DNA fragments were produced by PCR, and 5 pmole was labeled with 32 P using T4 polynucleotide kinase (NEB). .. For DNA probes less than 100 bp, one oligonucleotide was labeled with 32 P, then annealed with the complementary oligonucleotide.

    Electrophoretic Mobility Shift Assay:

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6
    Article Snippet: .. Electrophoretic mobility shift assays For DNA probes larger than 100 bp, DNA fragments were produced by PCR, and 5 pmole was labeled with 32 P using T4 polynucleotide kinase (NEB). .. For DNA probes less than 100 bp, one oligonucleotide was labeled with 32 P, then annealed with the complementary oligonucleotide.

    Construct:

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo
    Article Snippet: .. First, a homology plasmid was constructed by subcloning two DNA fragments derived from wild-type HSV-2 MS genomic DNA into a pUC19 plasmid vector (New England Biolabs), encompassing sequences homologous to 517 bp upstream of the HSV-2 ICP0 start codon and 545 bp downstream of the ICP0 stop codon. .. During cloning, XbaI and BamHI restriction sites were introduced in-between the two homology arms.

    Mass Spectrometry:

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo
    Article Snippet: .. First, a homology plasmid was constructed by subcloning two DNA fragments derived from wild-type HSV-2 MS genomic DNA into a pUC19 plasmid vector (New England Biolabs), encompassing sequences homologous to 517 bp upstream of the HSV-2 ICP0 start codon and 545 bp downstream of the ICP0 stop codon. .. During cloning, XbaI and BamHI restriction sites were introduced in-between the two homology arms.

    Polymerase Chain Reaction:

    Article Title: Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response
    Article Snippet: .. DNA fragments containing target sites were PCR amplified and digested with T7E1 (NEB, #M0302) and analyzed via agarose gel electrophoresis. .. Non-perfectly matched DNA would be cleaved by T7E1.

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6
    Article Snippet: .. Electrophoretic mobility shift assays For DNA probes larger than 100 bp, DNA fragments were produced by PCR, and 5 pmole was labeled with 32 P using T4 polynucleotide kinase (NEB). .. For DNA probes less than 100 bp, one oligonucleotide was labeled with 32 P, then annealed with the complementary oligonucleotide.

    Derivative Assay:

    Article Title: Interaction between the cellular E3 ubiquitin ligase SIAH-1 and the viral immediate-early protein ICP0 enables efficient replication of Herpes Simplex Virus type 2 in vivo
    Article Snippet: .. First, a homology plasmid was constructed by subcloning two DNA fragments derived from wild-type HSV-2 MS genomic DNA into a pUC19 plasmid vector (New England Biolabs), encompassing sequences homologous to 517 bp upstream of the HSV-2 ICP0 start codon and 545 bp downstream of the ICP0 stop codon. .. During cloning, XbaI and BamHI restriction sites were introduced in-between the two homology arms.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs terminal restriction fragment trf assay genomic dna
    Identification of the telomeric <t>DNA</t> sequence in A. viride . Dot blotting of A. viride genomic DNA (gDNA) using oligonucleotide ( a ) or double-stranded ( b ) telomeric probes. Control oligonucleotides and genomic DNA were included for comparison. The oligo dT 48 and bacterial genomic DNA are negative controls. ( c ) Telomeric sequences of A. viride are located at the ends of genomic DNA. Genomic DNA of A. viride was treated with Bal-31 exonuclease and then subjected to <t>TRF</t> assay using a double-stranded TTAGGG telomeric probe. In: intact genomic DNA. I: internal repetitive sequences. ( d,e ) A. viride telomeres detected by FISH in interphase nuclei ( d ) and metaphase spreads ( e ). Red fluorescent signals denote the TTAGGG telomeric sequences. Nuclei and chromosomes are in blue (DAPI). Scale bars: 10 μm.
    Terminal Restriction Fragment Trf Assay Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/terminal restriction fragment trf assay genomic dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    terminal restriction fragment trf assay genomic dna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    New England Biolabs 4837 bp atcwinv4 genomic dna fragment
    Identification of cwinv4 mutants. Two independent Arabidopsis <t>T-DNA</t> mutant lines ( Alonso et al. , 2003 ), cwinv4-1 (SALK_130163) and cwinv4-2 (SALK_017466C), were obtained from the Arabidopsis Biological Resource Centre and genotyped to obtain homozygous mutant plants. The relative locations of each T-DNA insertion are shown in (A). RT-PCR, performed on RNA isolated from whole flowers, demonstrated that cwinv4-1 is a null mutant, and that <t>AtCWINV4</t> is expressed significantly lower in cwinv4-2 flowers than in wild-type (B).
    4837 Bp Atcwinv4 Genomic Dna Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/4837 bp atcwinv4 genomic dna fragment/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    4837 bp atcwinv4 genomic dna fragment - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    94
    New England Biolabs dna fragments
    Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo <t>DNA</t> methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by <t>LM-PCR</t> and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.
    Dna Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 502 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna fragments/product/New England Biolabs
    Average 94 stars, based on 502 article reviews
    Price from $9.99 to $1999.99
    dna fragments - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Identification of the telomeric DNA sequence in A. viride . Dot blotting of A. viride genomic DNA (gDNA) using oligonucleotide ( a ) or double-stranded ( b ) telomeric probes. Control oligonucleotides and genomic DNA were included for comparison. The oligo dT 48 and bacterial genomic DNA are negative controls. ( c ) Telomeric sequences of A. viride are located at the ends of genomic DNA. Genomic DNA of A. viride was treated with Bal-31 exonuclease and then subjected to TRF assay using a double-stranded TTAGGG telomeric probe. In: intact genomic DNA. I: internal repetitive sequences. ( d,e ) A. viride telomeres detected by FISH in interphase nuclei ( d ) and metaphase spreads ( e ). Red fluorescent signals denote the TTAGGG telomeric sequences. Nuclei and chromosomes are in blue (DAPI). Scale bars: 10 μm.

    Journal: Scientific Reports

    Article Title: Telomere maintenance during anterior regeneration and aging in the freshwater annelid Aeolosoma viride

    doi: 10.1038/s41598-018-36396-y

    Figure Lengend Snippet: Identification of the telomeric DNA sequence in A. viride . Dot blotting of A. viride genomic DNA (gDNA) using oligonucleotide ( a ) or double-stranded ( b ) telomeric probes. Control oligonucleotides and genomic DNA were included for comparison. The oligo dT 48 and bacterial genomic DNA are negative controls. ( c ) Telomeric sequences of A. viride are located at the ends of genomic DNA. Genomic DNA of A. viride was treated with Bal-31 exonuclease and then subjected to TRF assay using a double-stranded TTAGGG telomeric probe. In: intact genomic DNA. I: internal repetitive sequences. ( d,e ) A. viride telomeres detected by FISH in interphase nuclei ( d ) and metaphase spreads ( e ). Red fluorescent signals denote the TTAGGG telomeric sequences. Nuclei and chromosomes are in blue (DAPI). Scale bars: 10 μm.

    Article Snippet: Terminal restriction fragment (TRF) assay Genomic DNA was digested with an Rsa I and Hinf I (NEB) endonuclease mixture (1:1) at 37 °C overnight and then resolved in a 1% agarose gel.

    Techniques: Sequencing, TRF Assay, Fluorescence In Situ Hybridization

    Identification of cwinv4 mutants. Two independent Arabidopsis T-DNA mutant lines ( Alonso et al. , 2003 ), cwinv4-1 (SALK_130163) and cwinv4-2 (SALK_017466C), were obtained from the Arabidopsis Biological Resource Centre and genotyped to obtain homozygous mutant plants. The relative locations of each T-DNA insertion are shown in (A). RT-PCR, performed on RNA isolated from whole flowers, demonstrated that cwinv4-1 is a null mutant, and that AtCWINV4 is expressed significantly lower in cwinv4-2 flowers than in wild-type (B).

    Journal: Journal of Experimental Botany

    Article Title: CELL WALL INVERTASE 4 is required for nectar production in Arabidopsis

    doi: 10.1093/jxb/erp309

    Figure Lengend Snippet: Identification of cwinv4 mutants. Two independent Arabidopsis T-DNA mutant lines ( Alonso et al. , 2003 ), cwinv4-1 (SALK_130163) and cwinv4-2 (SALK_017466C), were obtained from the Arabidopsis Biological Resource Centre and genotyped to obtain homozygous mutant plants. The relative locations of each T-DNA insertion are shown in (A). RT-PCR, performed on RNA isolated from whole flowers, demonstrated that cwinv4-1 is a null mutant, and that AtCWINV4 is expressed significantly lower in cwinv4-2 flowers than in wild-type (B).

    Article Snippet: AtCWINV4 ::AtCWINV4:GFP analyses A 4837 bp AtCWINV4 genomic DNA fragment was amplified with the AtCWINV4-GFP-F and AtCWINV4-GFP-R primers ( ) using Phusion polymerase (New England BioLabs, Ipswich, MA), and directly cloned into the pCR® Blunt II-TOPO® vector (Invitrogen, Carlsbad, CA).

    Techniques: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation

    Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo DNA methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by LM-PCR and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.

    Journal: Nucleic Acids Research

    Article Title: A highly sensitive in vivo footprinting technique for condition-dependent identification of cis elements

    doi: 10.1093/nar/gkt883

    Figure Lengend Snippet: Schematic presentation of the workflow and generation of final data. The main steps of the software-based, high-throughput in vivo footprinting method comprise growing/incubating the microorganism under conditions to be investigated (e.g. inducing conditions), in vivo DNA methylation using e.g. DMS, DNA extraction, DNA cleavage by e.g. HCl followed by LM-PCR and CGE. A subset of CGE analyses results to be compared (raw data) are submitted to electronic data analysis using the ivFAST software for generation of the results displayed as final heatmap (processed data output). The steps of processing the data by the ivFAST software can be inferred from the flowchart (for more details see the ivFAST manual). Heatmap: x -axis gives the analysed DNA sequence; y -axis shows which samples are referred to each other (e.g. G/ND means ‘glucose repressing conditions referred to naked DNA’); only signals that are statistically different are considered; protected bases are highlighted in red shades and hypersensitive bases are highlighted in blue shades; 1.1- to 1.3-fold difference between compared conditions is shown in light shaded colour, 1.3- to 1.5-fold difference between compared conditions is shown in middle shaded colour and > 1.5-fold difference between compared conditions is shown in dark shaded colour.

    Article Snippet: Traditional, gel-based analysis of DNA fragments via LM-PCR LM-PCR was performed using Vent Polymerase [New England Biolabs (NEB), Ipswich, MA] as described by Garrity and Wold ( ).

    Techniques: Software, High Throughput Screening Assay, In Vivo, Footprinting, DNA Methylation Assay, DNA Extraction, Polymerase Chain Reaction, Sequencing

    Direct transcriptional regulators of lin-39 in the embryo and larva. A) Horizontal lines represent 20 kb of genomic DNA surrounding the lin-39 locus. The lin-39 transcript is shown below the top line, with boxes representing exons. The next horizontal line shows evolutionarily-conserved regions (ECRs; thin vertical lines), the PCR fragments used in the yeast one hybrid assays containing the ECRs (boxes labeled 1–12), and two fragments ( pJW3.9 shown, JW5 unlabeled) identified previously using an enhancerless GFP assay [ 47 ]. Transcription factors that bind the lin-39 gene are shown above the line (previously reported) or below the line (reported in this work). B) Model for positive feedback loop between egl-18 / elt-6 and lin-39 . EGL-18 and ELT-6 act via the GATA site in enhancer pJW3.9 to facilitate initiation of lin-39 expression in the embryo, and then LIN-39 acts to positively regulate egl-18 / elt-6 expression via the Hox/Pbx binding site in the intron of egl-18 [ 55 ].

    Journal: BMC Developmental Biology

    Article Title: Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6

    doi: 10.1186/1471-213X-14-17

    Figure Lengend Snippet: Direct transcriptional regulators of lin-39 in the embryo and larva. A) Horizontal lines represent 20 kb of genomic DNA surrounding the lin-39 locus. The lin-39 transcript is shown below the top line, with boxes representing exons. The next horizontal line shows evolutionarily-conserved regions (ECRs; thin vertical lines), the PCR fragments used in the yeast one hybrid assays containing the ECRs (boxes labeled 1–12), and two fragments ( pJW3.9 shown, JW5 unlabeled) identified previously using an enhancerless GFP assay [ 47 ]. Transcription factors that bind the lin-39 gene are shown above the line (previously reported) or below the line (reported in this work). B) Model for positive feedback loop between egl-18 / elt-6 and lin-39 . EGL-18 and ELT-6 act via the GATA site in enhancer pJW3.9 to facilitate initiation of lin-39 expression in the embryo, and then LIN-39 acts to positively regulate egl-18 / elt-6 expression via the Hox/Pbx binding site in the intron of egl-18 [ 55 ].

    Article Snippet: Electrophoretic mobility shift assays For DNA probes larger than 100 bp, DNA fragments were produced by PCR, and 5 pmole was labeled with 32 P using T4 polynucleotide kinase (NEB).

    Techniques: Polymerase Chain Reaction, Labeling, Activated Clotting Time Assay, Expressing, Binding Assay