Structured Review

Promega dna clean up kit
<t>PCR</t> ‐ RFLP analysis of ‐755 T > G CTNND 1 polymorphism. lane M: <t>DNA</t> ladder; lane 1: TT genotype; lane 2: TG genotype; lane 3: GG genotype.
Dna Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna clean up kit/product/Promega
Average 99 stars, based on 12 article reviews
Price from $9.99 to $1999.99
dna clean up kit - by Bioz Stars, 2020-03
99/100 stars

Images

1) Product Images from "CTNND1 755 T > G Promoter Polymorphism and Risk of Pancreatic Carcinoma in Chinese"

Article Title: CTNND1 755 T > G Promoter Polymorphism and Risk of Pancreatic Carcinoma in Chinese

Journal: Journal of Clinical Laboratory Analysis

doi: 10.1002/jcla.22055

PCR ‐ RFLP analysis of ‐755 T > G CTNND 1 polymorphism. lane M: DNA ladder; lane 1: TT genotype; lane 2: TG genotype; lane 3: GG genotype.
Figure Legend Snippet: PCR ‐ RFLP analysis of ‐755 T > G CTNND 1 polymorphism. lane M: DNA ladder; lane 1: TT genotype; lane 2: TG genotype; lane 3: GG genotype.

Techniques Used: Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Larger competitors, consisting of S. aureus capA, fmtB, esxA, and lukED 5′ non-coding DNAs, were PCR amplified, and cloned into pCR2.1 (Invitrogen, Grand Island, NY, USA), generating pBLJ506, 507, 508, and 509, respectively. .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Amplification:

Article Title: DNA Methylation and Transcription in a Distal Region Upstream from the Bovine AlphaS1 Casein Gene after Once or Twice Daily Milking
Article Snippet: Paragraph title: Bisulfite treatment, amplification and pyrosequencing of the CSN1S1 regulatory region ... Bisulfite treated gDNA was then purified using the Wizard DNA clean-up system (Promega, Cat. N°.

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: The amplification procedure was denaturation for 5 min at 94°C and 30 cycles of 1 min at 94°C, 1 min at 60°C, and 45 sec at 72°C, followed by a final elongation step for 10 min at 72°C. .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: By contrast, when DNA extracted from microbial cells was used as the template, we always amplified 16S rRNA genes. .. Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation.

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Larger competitors, consisting of S. aureus capA, fmtB, esxA, and lukED 5′ non-coding DNAs, were PCR amplified, and cloned into pCR2.1 (Invitrogen, Grand Island, NY, USA), generating pBLJ506, 507, 508, and 509, respectively. .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense).

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.). .. For the DNase I footprint assays, oligonuclotide primers fleQ2F and fleQ2R (Table ) (Integrated DNA Technologies) were used to PCR amplify a 158-bp fragment containing the fleQ promoter region by using placΩQ as a template.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: .. One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification. .. During this modification unmethylated C residues are converted to U (T in PCR products), while methylated C residues are not.

Filtration:

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: .. When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Reaction products were resolved by Tris-acetate EDTA (pH 7.6) agarose gel electrophoresis as stated in the figure legends.

Construct:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: These constructs were then used as templates for PCR generation of specific competitors ( ). .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Electrophoresis:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors. .. When appropriate, competitor concentrations and oligonucleotide annealing efficiencies were also confirmed using relative ethidium bromide-stained band intensity following electrophoresis through native 20% polyacrylamide gels (Invitrogen, Grand Island, NY).

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Following electrophoresis, the gels were dried onto DE81 chromatography paper (Whatman), analyzed and quantitated by storage phosphor analysis with a Molecular Dynamics Storm 820.

Incubation:

Article Title: DNA Methylation and Transcription in a Distal Region Upstream from the Bovine AlphaS1 Casein Gene after Once or Twice Daily Milking
Article Snippet: Briefly, one µg of the EcoRI-linearised gDNA was incubated in the dark in 0.5 ml freshly prepared sodium bisulphite 5 M and hydroquinone 130 mM at 55°C for 4 hours. .. Bisulfite treated gDNA was then purified using the Wizard DNA clean-up system (Promega, Cat. N°.

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: .. Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water. .. In order to complete the conversion of unmethylated cytosines, NaOH was added to a final concentration of 0.3 M and the samples were incubated for 15 minutes at 37°C.

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: The reactions were quenched by the addition of termination buffer (final concentration: 50 mM EDTA and 3 µg/µl proteinase K) followed by incubation for 20 min at 30°C. .. When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA.

Article Title: Comparison and transfer testing of multiplex ligation detection methods for GM plants
Article Snippet: Subsequently, 20 μl 20 mg/ml Proteinase K (Fermentas Molecular Biology, Germany) was added and the mix was incubated for 15 min at 65°C. .. For GTS 40-3-2, 100% Bt176 and 100% TC1507 the DNA Wizard Clean up system for genomic DNA (Promega) was used.

Mass Spectrometry:

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: Methylation specific PCR (MSP) The genomic DNA from cultured cells was extracted and modified by bisulfate treatment for MS-PCR analyses[ ]. .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites.

Modification:

Article Title: Complete Genome Sequence of Klebsiella pneumoniae Myophage Menlow
Article Snippet: .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ). .. Pooled indexed DNA libraries were prepared using the Illumina TruSeq Nano LT kit, and a sequence was obtained from the Illumina MiSeq platform using the MiSeq v2 500-cycle reagent kit following the manufacturer’s instructions, producing 447,621 paired-end reads for the index containing the phage genome.

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: Methylation specific PCR (MSP) The genomic DNA from cultured cells was extracted and modified by bisulfate treatment for MS-PCR analyses[ ]. .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites.

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: Paragraph title: Bisulphite modification of DNA and methylation-specific polymerase chain reaction (MSP) ... Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water.

Article Title: Complete Genome Sequence of Salmonella enterica Serovar Heidelberg Myophage Meda
Article Snippet: .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol, as described previously ( ). .. Pooled indexed DNA libraries were prepared using the Illumina TruSeq Nano low-throughput (LT) kit, and the sequence was obtained from the Illumina MiSeq platform using the MiSeq V2 500-cycle reagent kit, following the manufacturer’s instructions, producing 312,918 paired-end reads for the index containing the phage genome.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Paragraph title: Cell lines, DNA preparation and bisulfite modification ... One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

Hybridization:

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation. .. Dot blot analyses carried out with a digoxigenin-labeled probe (prepared by PCR amplification of the 16S rRNA gene of E. coli ) indicated a lack of hybridization with extracellular DNA recovered from all sediment samples (data not shown).

Electron Microscopy:

Article Title: Complete Genome Sequences of Staphylococcus epidermidis Myophages Quidividi, Terranova, and Twillingate
Article Snippet: The three phages were identified as myophages using negative-stain transmission electron microscopy performed at the University of Alabama Optical Analysis Facility as described previously ( ). .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Chromatography:

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: Briefly, the Cas9 protein was expressed in E. coli Rosetta2 (DE3) (Novagen), and was purified by chromatography on Ni-NTA Superflow (QIAGEN), HiTrap SP HP (GE Healthcare), and HiLoad Superdex 200 16/60 (GE Healthcare) columns. .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega).

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Following electrophoresis, the gels were dried onto DE81 chromatography paper (Whatman), analyzed and quantitated by storage phosphor analysis with a Molecular Dynamics Storm 820.

Cell Culture:

Article Title: Complete Genome Sequence of Klebsiella pneumoniae Myophage Menlow
Article Snippet: Host bacteria were cultured on tryptic soy broth or agar (Difco) at 37°C with aeration. .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: Methylation specific PCR (MSP) The genomic DNA from cultured cells was extracted and modified by bisulfate treatment for MS-PCR analyses[ ]. .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Human colon carcinoma cell lines RKO and Cla (from the University of California, San Francisco, CA), human gastric carcinoma cell lines PACM82, MGC803, MKN45 and AGS and the human embryonic kidney cell line HEK293 were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum at 37°C with 5% CO2 . .. One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

Generated:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Unlabeled competitor DNAs were also generated via PCR or by annealing oligonucleotides. .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: For electrophoretic mobility shift assays (EMSAs), 88-bp DNA fragments containing the fleQ promoter and the mutant fleQ promoter (ACA → CGC) were generated by PCR amplification by using oligonucleotide primers fleQ1F and fleQ1R (Table ) (Integrated DNA Technologies, Inc., Coralville, Iowa). placΩQ and pBS- fleQ pmutV (Table ) served as the templates. .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.).

Transmission Assay:

Article Title: Complete Genome Sequences of Staphylococcus epidermidis Myophages Quidividi, Terranova, and Twillingate
Article Snippet: The three phages were identified as myophages using negative-stain transmission electron microscopy performed at the University of Alabama Optical Analysis Facility as described previously ( ). .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Sequencing:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: Rhodamine-labeled 1-kb DNA was produced by using PCR amplification with pUC18 plasmid DNA as a template and primers containing the border sequence of pTiA6 (underlined) with VirD2 cleavage site (∧ ) and template sequence: primer p3 (5′- CCACGGTATATATCCTG∧ CCA GGGTATTTCACACCGCATATGG-3′) and primer p4 (5′- CAACGGTATAT ATCCTG∧ CCA GGCTAGAGTAAGTAGTCGCC-3′). .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Article Title: Complete Genome Sequence of Klebsiella pneumoniae Myophage Menlow
Article Snippet: Phage Menlow was isolated from influent water at the Carter Creek Wastewater treatment plant in College Station, TX, against a carbapenemase-producing K. pneumoniae isolate of the sequence type 258 (ST258) lineage. .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega). ..

Article Title: Complete Genome Sequences of Staphylococcus epidermidis Myophages Quidividi, Terranova, and Twillingate
Article Snippet: Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ). .. Pooled indexed DNA libraries were prepared using the Illumina TruSeq Nano low-throughput (LT) kit, and sequencing was obtained from the Illumina MiSeq platform using the MiSeq V2 500-cycle reagent kit following the manufacturer’s instructions, producing 539,431, 484,323, and 538,626 reads for the indexes containing Quidividi, Terranova, and Twillingate, respectively.

Article Title: Complete Genome Sequence of Salmonella enterica Serovar Heidelberg Myophage Meda
Article Snippet: Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol, as described previously ( ). .. Pooled indexed DNA libraries were prepared using the Illumina TruSeq Nano low-throughput (LT) kit, and the sequence was obtained from the Illumina MiSeq platform using the MiSeq V2 500-cycle reagent kit, following the manufacturer’s instructions, producing 312,918 paired-end reads for the index containing the phage genome.

DNA Extraction:

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense).

Article Title: Comparison and transfer testing of multiplex ligation detection methods for GM plants
Article Snippet: Paragraph title: DNA extraction ... For GTS 40-3-2, 100% Bt176 and 100% TC1507 the DNA Wizard Clean up system for genomic DNA (Promega) was used.

Nucleic Acid Electrophoresis:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: PCR-synthesized probes were purified by gel electrophoresis. .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Radioactivity:

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: Radiolabeling of the DNA fragments was accomplished by inclusion of [α-32 P]dCTP (800 Ci/mmol; Perkin-Elmer Life Sciences Inc., Boston, Mass.) in the PCR mixtures. .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.).

Methylation:

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense).

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: Paragraph title: Bisulphite modification of DNA and methylation-specific polymerase chain reaction (MSP) ... Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification. .. During this modification unmethylated C residues are converted to U (T in PCR products), while methylated C residues are not.

Mutagenesis:

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.). .. For the DNase I footprint assays, oligonuclotide primers fleQ2F and fleQ2R (Table ) (Integrated DNA Technologies) were used to PCR amplify a 158-bp fragment containing the fleQ promoter region by using placΩQ as a template.

Isolation:

Article Title: Complete Genome Sequence of Klebsiella pneumoniae Myophage Menlow
Article Snippet: Phages were isolated and propagated by the soft agar overlay method ( ). .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense).

Article Title: Complete Genome Sequences of Staphylococcus epidermidis Myophages Quidividi, Terranova, and Twillingate
Article Snippet: Twillingate was isolated from a wastewater treatment plant in Northport, Alabama, in 2016 using S. epidermidis strain RP62a ( ) as the host. .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ).

Article Title: Complete Genome Sequence of Salmonella enterica Serovar Heidelberg Myophage Meda
Article Snippet: Phages were isolated and propagated by the soft agar overlay method ( ). .. Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol, as described previously ( ).

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Genomic DNA from these cells in log phase and tissue samples was isolated using phenol/chloroform as previously described ( ). .. One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

Size-exclusion Chromatography:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: The amplification procedure was denaturation for 5 min at 94°C and 30 cycles of 1 min at 94°C, 1 min at 60°C, and 45 sec at 72°C, followed by a final elongation step for 10 min at 72°C. .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The amplification was performed in an Mastercycler unit ( Eppendorf) under the program conditions as follows: 95°C for 5 min; then 40 cycles of 95°C for 45 sec, 60°C for 45 sec, 72°C for 45 sec; and finally 10 min at 72°C.

Labeling:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: Paragraph title: Production of Fluorescently Labeled ssDNA. ... The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Smaller, labeled DNA fragments were annealed by an initial high-temperature melting step, followed by incremental decreases in temperature using a thermocycler . .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Purification:

Article Title: DNA Methylation and Transcription in a Distal Region Upstream from the Bovine AlphaS1 Casein Gene after Once or Twice Daily Milking
Article Snippet: .. Bisulfite treated gDNA was then purified using the Wizard DNA clean-up system (Promega, Cat. N°. .. A7280), incubated in 0.3M NaOH at 37°C for 20 min and then ethanol precipitated overnight at −20°C in the presence of 2M ammonium acetate.

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice. ..

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors. ..

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega). ..

Article Title: Prophage Carriage as a Molecular Epidemiological Marker in Streptococcus pneumoniae
Article Snippet: .. The 1.2-kb fragment containing the lytA gene was purified from the gel by using the Wizard DNA Cleanup kit. .. A second DNA probe was generated by PCR to include an 890-nt internal fragment of lytA from which the first 57 and last 10 nt of the lytA gene were missing.

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: .. Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water. .. In order to complete the conversion of unmethylated cytosines, NaOH was added to a final concentration of 0.3 M and the samples were incubated for 15 minutes at 37°C.

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: .. When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Reaction products were resolved by Tris-acetate EDTA (pH 7.6) agarose gel electrophoresis as stated in the figure legends.

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.). .. For the DNase I footprint assays, oligonuclotide primers fleQ2F and fleQ2R (Table ) (Integrated DNA Technologies) were used to PCR amplify a 158-bp fragment containing the fleQ promoter region by using placΩQ as a template.

Dot Blot:

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation. .. Dot blot analyses carried out with a digoxigenin-labeled probe (prepared by PCR amplification of the 16S rRNA gene of E. coli ) indicated a lack of hybridization with extracellular DNA recovered from all sediment samples (data not shown).

Polymerase Chain Reaction:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice. ..

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: .. Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation. .. Dot blot analyses carried out with a digoxigenin-labeled probe (prepared by PCR amplification of the 16S rRNA gene of E. coli ) indicated a lack of hybridization with extracellular DNA recovered from all sediment samples (data not shown).

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: These constructs were then used as templates for PCR generation of specific competitors ( ). .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Article Title: Complete Genome Sequence of Klebsiella pneumoniae Myophage Menlow
Article Snippet: Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol as described previously ( ). .. The genome was closed by PCR using primers (5′-CGATGAATCCCTCTCGTTCTT-3′ and 5′-CATGGGAGAGCTTCTTGTACTT-3′) facing off the ends of the assembled contig and Sanger sequencing of the resulting product, with the contig sequence manually corrected to match the resulting Sanger sequencing read.

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega). ..

Article Title: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin
Article Snippet: .. DNA from cell cultures under different conditions was isolated with the Tissue/Cell Genomic DNA Isolation Kit (Pearl, China), employing the Wizard DNA Clean-Up System (Promega, USA), and amplified by PCR with two sets of gene promoter specific primer pairs that recognize the methylated (M) and the unmethylated (U) CpG sites. .. The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense).

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: Paragraph title: Bisulphite modification of DNA and methylation-specific polymerase chain reaction (MSP) ... Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water.

Article Title: Complete Genome Sequence of Salmonella enterica Serovar Heidelberg Myophage Meda
Article Snippet: Phage genomic DNA was prepared using a modified Promega Wizard DNA cleanup kit protocol, as described previously ( ). .. The assembled contig completion was confirmed by PCR using primers (5′-TGAGCATGGTTTCCGTTAGAG-3′ and 5′-GTGATTCTAGGCCAGTTGGTAG-3′) facing off the ends of the assembled contig and Sanger sequencing of the resulting product, with the contig sequence manually corrected to match the resulting Sanger sequencing read.

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.). .. For the DNase I footprint assays, oligonuclotide primers fleQ2F and fleQ2R (Table ) (Integrated DNA Technologies) were used to PCR amplify a 158-bp fragment containing the fleQ promoter region by using placΩQ as a template.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: .. One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification. .. During this modification unmethylated C residues are converted to U (T in PCR products), while methylated C residues are not.

Electrophoretic Mobility Shift Assay:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: Paragraph title: Electromobility Gel Shift Assays (EMSA) ... Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors.

Article Title: fleQ, the Gene Encoding the Major Flagellar Regulator of Pseudomonas aeruginosa, Is ?70 Dependent and Is Downregulated by Vfr, a Homolog of Escherichia coli Cyclic AMP Receptor Protein
Article Snippet: For electrophoretic mobility shift assays (EMSAs), 88-bp DNA fragments containing the fleQ promoter and the mutant fleQ promoter (ACA → CGC) were generated by PCR amplification by using oligonucleotide primers fleQ1F and fleQ1R (Table ) (Integrated DNA Technologies, Inc., Coralville, Iowa). placΩQ and pBS- fleQ pmutV (Table ) served as the templates. .. Following PCR amplification, the wild-type and mutant fleQ promoter fragments were purified by using the Promega Wizard DNA Cleanup system (Promega Corp., Madison, Wis.).

Polyacrylamide Gel Electrophoresis:

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: The 98-nt guide RNA was transcribed in vitro, and then purified by denaturing urea polyacrylamide gel electrophoresis, as described . .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega).

Agarose Gel Electrophoresis:

Article Title: Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins
Article Snippet: .. Amplicons were separated by agarose gel electrophoresis and purified using Wizard DNA Clean-up Systems (Promega, Madison, WI) before use as EMSA competitors. ..

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Reaction products were resolved by Tris-acetate EDTA (pH 7.6) agarose gel electrophoresis as stated in the figure legends.

Plasmid Preparation:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: Rhodamine-labeled 1-kb DNA was produced by using PCR amplification with pUC18 plasmid DNA as a template and primers containing the border sequence of pTiA6 (underlined) with VirD2 cleavage site (∧ ) and template sequence: primer p3 (5′- CCACGGTATATATCCTG∧ CCA GGGTATTTCACACCGCATATGG-3′) and primer p4 (5′- CAACGGTATAT ATCCTG∧ CCA GGCTAGAGTAAGTAGTCGCC-3′). .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega). ..

Sample Prep:

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: Paragraph title: Sample preparation ... The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega).

In Vitro:

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: The 98-nt guide RNA was transcribed in vitro, and then purified by denaturing urea polyacrylamide gel electrophoresis, as described . .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega).

Column Chromatography:

Article Title: Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy
Article Snippet: Sample preparation Wild-type S. pyogenes Cas9 and GFP-dCas9(D10A/C81L/C574E/H840A) were expressed in Escherichia coli Rosetta2 (DE3), and then purified to homogeneity by column chromatography, as described with minor modifications . .. The 600-bp target DNA was PCR-amplified using the pUC119 plasmid containing the 20-nt target sequence and the TGG PAM as the template, and then purified using a Wizard DNA Clean-Up System (Promega).

Quantitation Assay:

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA. .. Quantitation of D-loop formation is reported after subtracting the protein-independent D-loop reaction from that catalyzed by ICP8.

Spectrophotometry:

Article Title: Comparison and transfer testing of multiplex ligation detection methods for GM plants
Article Snippet: For GTS 40-3-2, 100% Bt176 and 100% TC1507 the DNA Wizard Clean up system for genomic DNA (Promega) was used. .. DNA concentrations and the purity of the DNAs (A260/A280 and A260/A230) were measured with NanoDrop spectrophotometer (NanoDrop ND-1000, V3.5.2).

Produced:

Article Title: Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium
Article Snippet: Rhodamine-labeled 1-kb DNA was produced by using PCR amplification with pUC18 plasmid DNA as a template and primers containing the border sequence of pTiA6 (underlined) with VirD2 cleavage site (∧ ) and template sequence: primer p3 (5′- CCACGGTATATATCCTG∧ CCA GGGTATTTCACACCGCATATGG-3′) and primer p4 (5′- CAACGGTATAT ATCCTG∧ CCA GGCTAGAGTAAGTAGTCGCC-3′). .. The PCR product was purified and concentrated by using the Wizard DNA Clean-Up System (Promega). ssDNA was obtained by heat denaturation for 10 min at 94°C and fast cooling on ice.

Concentration Assay:

Article Title: DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets
Article Snippet: .. Hydroquinone (Sigma Chemical Co., St. Louis, MO, USA) and sodium bisulphite (Sigma Chemical Co, USA) at pH 5.0 were added to the samples to a final concentration of one mM and 3.7 M, respectively, prior to incubation at 50°C for 16 h. Bisulphite treated DNA was purified using the Wizard DNA clean-up kit (Promega Corp, Madison, WI, USA) and eluted in 100 μL MQ water. .. In order to complete the conversion of unmethylated cytosines, NaOH was added to a final concentration of 0.3 M and the samples were incubated for 15 minutes at 37°C.

Article Title: On the mechanism of strand assimilation by the herpes simplex virus type-1 single-strand DNA-binding protein (ICP8)
Article Snippet: The reactions were quenched by the addition of termination buffer (final concentration: 50 mM EDTA and 3 µg/µl proteinase K) followed by incubation for 20 min at 30°C. .. When stated, D-loops were purified using the Promega Wizard DNA clean-up system followed by removal of excess un-annealed PB11 by gel filtration through Biogel A15M (BioRad) in 25 mM Tris-acetate pH 7.5 and 1 mM EDTA.

DNA Purification:

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: .. Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation. .. Dot blot analyses carried out with a digoxigenin-labeled probe (prepared by PCR amplification of the 16S rRNA gene of E. coli ) indicated a lack of hybridization with extracellular DNA recovered from all sediment samples (data not shown).

Lysis:

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: The results of PCR amplification revealed that extracellular DNA recovered from the surface sediments investigated did not contain amplifiable 16S rRNA genes (Fig. ), thus confirming the lack of any DNA contamination due to cell lysis. .. Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation.

Gradient Centrifugation:

Article Title: Simultaneous Recovery of Extracellular and Intracellular DNA Suitable for Molecular Studies from Marine Sediments
Article Snippet: .. Moreover, no PCR products were obtained after additional extracellular DNA purification with the Wizard DNA Clean-up system (Promega) or by conventional cesium chloride density gradient centrifugation. .. Dot blot analyses carried out with a digoxigenin-labeled probe (prepared by PCR amplification of the 16S rRNA gene of E. coli ) indicated a lack of hybridization with extracellular DNA recovered from all sediment samples (data not shown).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega wizard pcr preps dna purification system
    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the <t>LSSP-PCR</t> reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb <t>DNA</t> ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.
    Wizard Pcr Preps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 208 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr preps dna purification system/product/Promega
    Average 99 stars, based on 208 article reviews
    Price from $9.99 to $1999.99
    wizard pcr preps dna purification system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Promega wizard dna clean up system
    <t>PCR</t> amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 <t>DNA/</t> Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.
    Wizard Dna Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard dna clean up system/product/Promega
    Average 99 stars, based on 289 article reviews
    Price from $9.99 to $1999.99
    wizard dna clean up system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Promega wizard sv gel and pcr clean up system
    Identification of osKaR insertion site Arbitrary-primed <t>PCR</t> (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer <t>Deg4.</t> The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.
    Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard sv gel and pcr clean up system/product/Promega
    Average 99 stars, based on 101 article reviews
    Price from $9.99 to $1999.99
    wizard sv gel and pcr clean up system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Migration

    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Negative Control, Migration

    PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Journal: Journal of Clinical Microbiology

    Article Title: Ribosomal DNA-Directed PCR for Identification of Achromobacter (Alcaligenes) xylosoxidans Recovered from Sputum Samples from Cystic Fibrosis Patients

    doi: 10.1128/JCM.40.4.1210-1213.2002

    Figure Lengend Snippet: PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Article Snippet: The resultant amplicons were purified by using the Promega Wizard PCR Prep DNA purification kit (Promega, Madison, Wis.) according to the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction, Marker

    PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Polymerase Chain Reaction, Amplification, Marker, Modification

    Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Amplification, Polymerase Chain Reaction

    Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Journal: Current protocols in microbiology

    Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

    doi: 10.1002/9780471729259.mc09d03s30

    Figure Lengend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Article Snippet: Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282)

    Techniques: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing