Structured Review

Agilent technologies dna chips
Amplification results using the proposed <t>DNA</t> extraction method (on-chip- electrophoresis results). The size of PCR products are 79–115 bp ( <t>CSRM60</t> ), 100–124 bp ( INRA035 ). Left to right: L, ladder; 1, sample washing water control ( CSRM60 ); 2, extraction solution (without hair shaft) control ( CSRM60 ); 3, ddH 2 O control ( CSRM60 ); 4, DNA from hair shafts of pure bred Luxi cattle ( CSRM60 ); 5, DNA from liver of beef cattle ( CSRM60 ); 6, sample washing water control ( INRA035 ); 7, extraction solution (without hair shaft) control ( INRA035 ); 8, ddH 2 O control ( INRA035 ); 9, DNA from hair shafts of pure bred Luxi cattle ( INRA035 ); 10, DNA from liver of beef cattle ( INRA035 ).
Dna Chips, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 91/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna chips/product/Agilent technologies
Average 91 stars, based on 15 article reviews
Price from $9.99 to $1999.99
dna chips - by Bioz Stars, 2020-08
91/100 stars

Images

1) Product Images from "A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder"

Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder

Journal: PLoS ONE

doi: 10.1371/journal.pone.0069588

Amplification results using the proposed DNA extraction method (on-chip- electrophoresis results). The size of PCR products are 79–115 bp ( CSRM60 ), 100–124 bp ( INRA035 ). Left to right: L, ladder; 1, sample washing water control ( CSRM60 ); 2, extraction solution (without hair shaft) control ( CSRM60 ); 3, ddH 2 O control ( CSRM60 ); 4, DNA from hair shafts of pure bred Luxi cattle ( CSRM60 ); 5, DNA from liver of beef cattle ( CSRM60 ); 6, sample washing water control ( INRA035 ); 7, extraction solution (without hair shaft) control ( INRA035 ); 8, ddH 2 O control ( INRA035 ); 9, DNA from hair shafts of pure bred Luxi cattle ( INRA035 ); 10, DNA from liver of beef cattle ( INRA035 ).
Figure Legend Snippet: Amplification results using the proposed DNA extraction method (on-chip- electrophoresis results). The size of PCR products are 79–115 bp ( CSRM60 ), 100–124 bp ( INRA035 ). Left to right: L, ladder; 1, sample washing water control ( CSRM60 ); 2, extraction solution (without hair shaft) control ( CSRM60 ); 3, ddH 2 O control ( CSRM60 ); 4, DNA from hair shafts of pure bred Luxi cattle ( CSRM60 ); 5, DNA from liver of beef cattle ( CSRM60 ); 6, sample washing water control ( INRA035 ); 7, extraction solution (without hair shaft) control ( INRA035 ); 8, ddH 2 O control ( INRA035 ); 9, DNA from hair shafts of pure bred Luxi cattle ( INRA035 ); 10, DNA from liver of beef cattle ( INRA035 ).

Techniques Used: Amplification, DNA Extraction, Chromatin Immunoprecipitation, Electrophoresis, Polymerase Chain Reaction

Comparison of amplification results of DNA extracted from hair shafts using the proposed method and that extracted from liver using commercial Genomic DNA Purification Kit (on-chip-electrophoresis results). The above panel is INRA035 comparison result, sample 6 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 3 is amplification result of liver DNA from beef cattle; The below panel is CSRM60 comparison result, sample 2 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 11 is amplification result of liver DNA from beef cattle.
Figure Legend Snippet: Comparison of amplification results of DNA extracted from hair shafts using the proposed method and that extracted from liver using commercial Genomic DNA Purification Kit (on-chip-electrophoresis results). The above panel is INRA035 comparison result, sample 6 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 3 is amplification result of liver DNA from beef cattle; The below panel is CSRM60 comparison result, sample 2 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 11 is amplification result of liver DNA from beef cattle.

Techniques Used: Amplification, DNA Purification, Chromatin Immunoprecipitation, Electrophoresis

2) Product Images from "AutoMeDIP-seq: A high-throughput, whole genome, DNA methylation assay"

Article Title: AutoMeDIP-seq: A high-throughput, whole genome, DNA methylation assay

Journal: Methods (San Diego, Calif.)

doi: 10.1016/j.ymeth.2010.04.003

Sonicated DNA. An electropherogram produced using an Agilent Bioanalyzer 2100 illustrating the size-range of DNA used in AutoMeDIP-seq. Approximately, 45% of the sample is contained between 150 and 250 bp.
Figure Legend Snippet: Sonicated DNA. An electropherogram produced using an Agilent Bioanalyzer 2100 illustrating the size-range of DNA used in AutoMeDIP-seq. Approximately, 45% of the sample is contained between 150 and 250 bp.

Techniques Used: Sonication, Produced

Related Articles

SYBR Green Assay:

Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b) *
Article Snippet: .. Quantitative real-time PCR for first strand cDNA and for ChIP DNA were performed with the Brilliant SYBR Green quantitative real-time PCR Master Mix (Agilent) and Mx3000p thermal cycler (Agilent) followed by data analysis as per the manufacturer. .. ChIP-PCR primer pairs (mouse) used were as follows: Arid1b (CGGAGTGGTGAATCATAAGCAA and CAAAAGCACTCGGTCTCTCTCA), Cblb (GCTAGCCTAGGTCCATTTCCCAAC and CGCCGGAGGAGGAGACCACTCAC), E2f5 (GAACACTAAAGGCAGGTAAGGAAA and TGATCAGGTGCAAGTATTGTAAGG), Igf2bp2 (TTCAGTAGGTGAAGTCGAGGAGAT and CTAGACCCTTCTAGTACCCCCTTT), Itgam (ACCTGCTAGCATGAACCTGAAT and CAGTGGGCGTCCCAAACAT), Kpna1 (TCATCAGACCCCAGAAAAGG and CCTTCTGCGCTTGTCTAACC), Polr3e (CTTTCGGAAGAGTGGGAAGG and CCACTCTGCTTAAACACAGATCAA), Tbx1 (CACAGAACGCACGTGGACAG and GTCAAGGCTCCGGTGAAGAAG), Top3b (CCGGAAGTGAGTTCGTGAGTG and AGGGCTGGATGGCGAAAAAG), Ub2z (ACTTAAGGCCCCCGTCAGTAG and TACTTCGGATTAAGCGGTGAGC).

Amplification:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Article Title: Global Transcriptome Profiles of Italian Mediterranean Buffalo Embryos with Normal and Retarded Growth
Article Snippet: .. For each of the normal and retarded embryos, three assay replicates were produced and 1.65 µg of Cy3-labeled linearly amplified cRNA was fragmented and hybridized for 17 h to the Agilent bovine (Bos taurus ) 4×44 k oligonucleotide microarray according to the protocol provided by the manufacturer (Agilent Technologies). .. Array scanning and data analysis Agilent Feature Extraction (AFE) 11.0.1.1 image analysis software was used to extract intensity from scanned images (file.tiff) obtained after microarray slides reading.

Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder
Article Snippet: .. Then, amplification products (locus CSRM60 and INRA035 ) were pipette onto DNA Chips (on-chip-electrophoresis, Agilent DNA 1000 Kit, for use with the Agilent 2100 bioanalyzer) and operated as its Guide described, while the others were visualized under UV light on 1.2% agarose gels by staining with GeneGreen (Tiangen Biotech (Beijing) Co., Ltd.). ..

Isolation:

Article Title: The Xenoestrogen Bisphenol A Inhibits Postembryonic Vertebrate Development by Antagonizing Gene Regulation by Thyroid Hormone
Article Snippet: .. RNA was isolated and subjected to cDNA array (slides AMADID 013665; Agilent, Santa Clara, CA) analysis by using a two-color reference design system as described ( , ) (also see supplemental Fig. S1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org). ..

Transferring:

Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder
Article Snippet: .. Then, amplification products (locus CSRM60 and INRA035 ) were pipette onto DNA Chips (on-chip-electrophoresis, Agilent DNA 1000 Kit, for use with the Agilent 2100 bioanalyzer) and operated as its Guide described, while the others were visualized under UV light on 1.2% agarose gels by staining with GeneGreen (Tiangen Biotech (Beijing) Co., Ltd.). ..

Labeling:

Article Title: A 17-molecule set as a predictor of complete response to neoadjuvant chemotherapy with docetaxel, cisplatin, and 5-fluorouracil in esophageal cancer
Article Snippet: .. Labeled cRNA was fragmented and hybridized to the same oligonucleotide microarray (Agilent Technologies). .. The fluorescent intensities were determined with an Agilent DNA Microarray Scanner and analyzed as described using Feature Extraction v.10.7.3.1 (Agilent Technologies).

Purification:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Real-time Polymerase Chain Reaction:

Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b) *
Article Snippet: .. Quantitative real-time PCR for first strand cDNA and for ChIP DNA were performed with the Brilliant SYBR Green quantitative real-time PCR Master Mix (Agilent) and Mx3000p thermal cycler (Agilent) followed by data analysis as per the manufacturer. .. ChIP-PCR primer pairs (mouse) used were as follows: Arid1b (CGGAGTGGTGAATCATAAGCAA and CAAAAGCACTCGGTCTCTCTCA), Cblb (GCTAGCCTAGGTCCATTTCCCAAC and CGCCGGAGGAGGAGACCACTCAC), E2f5 (GAACACTAAAGGCAGGTAAGGAAA and TGATCAGGTGCAAGTATTGTAAGG), Igf2bp2 (TTCAGTAGGTGAAGTCGAGGAGAT and CTAGACCCTTCTAGTACCCCCTTT), Itgam (ACCTGCTAGCATGAACCTGAAT and CAGTGGGCGTCCCAAACAT), Kpna1 (TCATCAGACCCCAGAAAAGG and CCTTCTGCGCTTGTCTAACC), Polr3e (CTTTCGGAAGAGTGGGAAGG and CCACTCTGCTTAAACACAGATCAA), Tbx1 (CACAGAACGCACGTGGACAG and GTCAAGGCTCCGGTGAAGAAG), Top3b (CCGGAAGTGAGTTCGTGAGTG and AGGGCTGGATGGCGAAAAAG), Ub2z (ACTTAAGGCCCCCGTCAGTAG and TACTTCGGATTAAGCGGTGAGC).

Microarray:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Article Title: Global Transcriptome Profiles of Italian Mediterranean Buffalo Embryos with Normal and Retarded Growth
Article Snippet: .. For each of the normal and retarded embryos, three assay replicates were produced and 1.65 µg of Cy3-labeled linearly amplified cRNA was fragmented and hybridized for 17 h to the Agilent bovine (Bos taurus ) 4×44 k oligonucleotide microarray according to the protocol provided by the manufacturer (Agilent Technologies). .. Array scanning and data analysis Agilent Feature Extraction (AFE) 11.0.1.1 image analysis software was used to extract intensity from scanned images (file.tiff) obtained after microarray slides reading.

Article Title: A 17-molecule set as a predictor of complete response to neoadjuvant chemotherapy with docetaxel, cisplatin, and 5-fluorouracil in esophageal cancer
Article Snippet: .. Labeled cRNA was fragmented and hybridized to the same oligonucleotide microarray (Agilent Technologies). .. The fluorescent intensities were determined with an Agilent DNA Microarray Scanner and analyzed as described using Feature Extraction v.10.7.3.1 (Agilent Technologies).

Article Title: Microarray phosphatome profiling of breast cancer patients unveils a complex phosphatase regulatory role of the MAPK and PI3K pathways in estrogen receptor-negative breast cancers
Article Snippet: .. The oligonucleotide microarrays used for the 41 samples were the Whole Human Genome Microarray kit (4×44K) (Agilent Technologies, Palo Alto, CA, USA). .. The amount of total tumor RNA used for labeling was ~300 ng for the first 10 processed samples, and 200 ng for the remaining 31 samples.

Expressing:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Staining:

Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder
Article Snippet: .. Then, amplification products (locus CSRM60 and INRA035 ) were pipette onto DNA Chips (on-chip-electrophoresis, Agilent DNA 1000 Kit, for use with the Agilent 2100 bioanalyzer) and operated as its Guide described, while the others were visualized under UV light on 1.2% agarose gels by staining with GeneGreen (Tiangen Biotech (Beijing) Co., Ltd.). ..

Produced:

Article Title: Global Transcriptome Profiles of Italian Mediterranean Buffalo Embryos with Normal and Retarded Growth
Article Snippet: .. For each of the normal and retarded embryos, three assay replicates were produced and 1.65 µg of Cy3-labeled linearly amplified cRNA was fragmented and hybridized for 17 h to the Agilent bovine (Bos taurus ) 4×44 k oligonucleotide microarray according to the protocol provided by the manufacturer (Agilent Technologies). .. Array scanning and data analysis Agilent Feature Extraction (AFE) 11.0.1.1 image analysis software was used to extract intensity from scanned images (file.tiff) obtained after microarray slides reading.

Chromatin Immunoprecipitation:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b) *
Article Snippet: .. Quantitative real-time PCR for first strand cDNA and for ChIP DNA were performed with the Brilliant SYBR Green quantitative real-time PCR Master Mix (Agilent) and Mx3000p thermal cycler (Agilent) followed by data analysis as per the manufacturer. .. ChIP-PCR primer pairs (mouse) used were as follows: Arid1b (CGGAGTGGTGAATCATAAGCAA and CAAAAGCACTCGGTCTCTCTCA), Cblb (GCTAGCCTAGGTCCATTTCCCAAC and CGCCGGAGGAGGAGACCACTCAC), E2f5 (GAACACTAAAGGCAGGTAAGGAAA and TGATCAGGTGCAAGTATTGTAAGG), Igf2bp2 (TTCAGTAGGTGAAGTCGAGGAGAT and CTAGACCCTTCTAGTACCCCCTTT), Itgam (ACCTGCTAGCATGAACCTGAAT and CAGTGGGCGTCCCAAACAT), Kpna1 (TCATCAGACCCCAGAAAAGG and CCTTCTGCGCTTGTCTAACC), Polr3e (CTTTCGGAAGAGTGGGAAGG and CCACTCTGCTTAAACACAGATCAA), Tbx1 (CACAGAACGCACGTGGACAG and GTCAAGGCTCCGGTGAAGAAG), Top3b (CCGGAAGTGAGTTCGTGAGTG and AGGGCTGGATGGCGAAAAAG), Ub2z (ACTTAAGGCCCCCGTCAGTAG and TACTTCGGATTAAGCGGTGAGC).

Hybridization:

Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry, et al. Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
Article Snippet: .. 2.9 DNA microarray and bioinformatics analysis Total RNA extracted from T24 cells expressing shCtrl or shPNO1 was analysed with the Agilent 2100 Bioanalyzer system (Agilent) and used for preparing amplified RNA (aRNA) with the GeneChip® 3′IVT Express Kit (Affymetrix) according to the manufacturer's instructions. aRNA was purified, and fragmented and hybridized with gene chip probes in a GeneChip Hybridization Oven 645 (Affymetrix). .. Hybridized microarray was washed and stained with the GeneChip Hybridization Wash and Stain Kit (Affymetrix) and finally scanned with GeneChip Fluidics Station 450 (Affymetrix).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Agilent technologies cdna microarray chips
    Practical application of the <t>Cy5-cDNA</t> Bioanalyzer assay. (A) Overlayed electropherogram image of Cy5-dUTP labeled cDNA obtained from control RNAs (MCF7 and HACAT, red and blue traces, respectively) and from test samples (Test #1 and Test #2, brown and purple traces respectively). First and second sharp peaks are as described in legend for Figure 1. (B) Average <t>microarray</t> intensity for MCF7, Test 1 and Test 2. Error bar is standard error from three arrays. Test samples were hybridized to only one microarray each.
    Cdna Microarray Chips, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 88/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna microarray chips/product/Agilent technologies
    Average 88 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    cdna microarray chips - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    86
    Agilent technologies human oligonucleotide microarray analysis
    EP300 downregulation after silencing of HPV-18 E1. Confirmation of micro-array data using real-time RT-PCR. Transcript levels of EP300 and CDKN1A were quantified using RT-PCR. EP300 and CDKN1A gene expressions were affected after siE1.6 and siE1.2 transfections, at 100 nM for 48 h, but not after siControl transfection. Decreased EP300 and increased CDKN1A expression were consistent with the results obtained from the <t>microarray</t> analysis. The relative logarithmic expressions were normalized against the non-treatment control (NTC). GAPDH was used as a reference gene control.
    Human Oligonucleotide Microarray Analysis, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human oligonucleotide microarray analysis/product/Agilent technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human oligonucleotide microarray analysis - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Image Search Results


    Practical application of the Cy5-cDNA Bioanalyzer assay. (A) Overlayed electropherogram image of Cy5-dUTP labeled cDNA obtained from control RNAs (MCF7 and HACAT, red and blue traces, respectively) and from test samples (Test #1 and Test #2, brown and purple traces respectively). First and second sharp peaks are as described in legend for Figure 1. (B) Average microarray intensity for MCF7, Test 1 and Test 2. Error bar is standard error from three arrays. Test samples were hybridized to only one microarray each.

    Journal: BMC Genomics

    Article Title: A qualitative assessment of direct-labeled cDNA products prior to microarray analysis

    doi: 10.1186/1471-2164-6-36

    Figure Lengend Snippet: Practical application of the Cy5-cDNA Bioanalyzer assay. (A) Overlayed electropherogram image of Cy5-dUTP labeled cDNA obtained from control RNAs (MCF7 and HACAT, red and blue traces, respectively) and from test samples (Test #1 and Test #2, brown and purple traces respectively). First and second sharp peaks are as described in legend for Figure 1. (B) Average microarray intensity for MCF7, Test 1 and Test 2. Error bar is standard error from three arrays. Test samples were hybridized to only one microarray each.

    Article Snippet: The cDNA microarray chips were scanned with an Agilent Scanner (Agilent Technologies, Wilmington, DE) using laser excitation at 635 and 100% PMT sensitivity.

    Techniques: Labeling, Microarray

    Amplification results using the proposed DNA extraction method (on-chip- electrophoresis results). The size of PCR products are 79–115 bp ( CSRM60 ), 100–124 bp ( INRA035 ). Left to right: L, ladder; 1, sample washing water control ( CSRM60 ); 2, extraction solution (without hair shaft) control ( CSRM60 ); 3, ddH 2 O control ( CSRM60 ); 4, DNA from hair shafts of pure bred Luxi cattle ( CSRM60 ); 5, DNA from liver of beef cattle ( CSRM60 ); 6, sample washing water control ( INRA035 ); 7, extraction solution (without hair shaft) control ( INRA035 ); 8, ddH 2 O control ( INRA035 ); 9, DNA from hair shafts of pure bred Luxi cattle ( INRA035 ); 10, DNA from liver of beef cattle ( INRA035 ).

    Journal: PLoS ONE

    Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder

    doi: 10.1371/journal.pone.0069588

    Figure Lengend Snippet: Amplification results using the proposed DNA extraction method (on-chip- electrophoresis results). The size of PCR products are 79–115 bp ( CSRM60 ), 100–124 bp ( INRA035 ). Left to right: L, ladder; 1, sample washing water control ( CSRM60 ); 2, extraction solution (without hair shaft) control ( CSRM60 ); 3, ddH 2 O control ( CSRM60 ); 4, DNA from hair shafts of pure bred Luxi cattle ( CSRM60 ); 5, DNA from liver of beef cattle ( CSRM60 ); 6, sample washing water control ( INRA035 ); 7, extraction solution (without hair shaft) control ( INRA035 ); 8, ddH 2 O control ( INRA035 ); 9, DNA from hair shafts of pure bred Luxi cattle ( INRA035 ); 10, DNA from liver of beef cattle ( INRA035 ).

    Article Snippet: Then, amplification products (locus CSRM60 and INRA035 ) were pipette onto DNA Chips (on-chip-electrophoresis, Agilent DNA 1000 Kit, for use with the Agilent 2100 bioanalyzer) and operated as its Guide described, while the others were visualized under UV light on 1.2% agarose gels by staining with GeneGreen (Tiangen Biotech (Beijing) Co., Ltd.).

    Techniques: Amplification, DNA Extraction, Chromatin Immunoprecipitation, Electrophoresis, Polymerase Chain Reaction

    Comparison of amplification results of DNA extracted from hair shafts using the proposed method and that extracted from liver using commercial Genomic DNA Purification Kit (on-chip-electrophoresis results). The above panel is INRA035 comparison result, sample 6 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 3 is amplification result of liver DNA from beef cattle; The below panel is CSRM60 comparison result, sample 2 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 11 is amplification result of liver DNA from beef cattle.

    Journal: PLoS ONE

    Article Title: A Simple Method to Extract DNA from Hair Shafts Using Enzymatic Laundry Powder

    doi: 10.1371/journal.pone.0069588

    Figure Lengend Snippet: Comparison of amplification results of DNA extracted from hair shafts using the proposed method and that extracted from liver using commercial Genomic DNA Purification Kit (on-chip-electrophoresis results). The above panel is INRA035 comparison result, sample 6 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 3 is amplification result of liver DNA from beef cattle; The below panel is CSRM60 comparison result, sample 2 is amplification result of hair shaft DNA from pure bred Luxi cattle and sample 11 is amplification result of liver DNA from beef cattle.

    Article Snippet: Then, amplification products (locus CSRM60 and INRA035 ) were pipette onto DNA Chips (on-chip-electrophoresis, Agilent DNA 1000 Kit, for use with the Agilent 2100 bioanalyzer) and operated as its Guide described, while the others were visualized under UV light on 1.2% agarose gels by staining with GeneGreen (Tiangen Biotech (Beijing) Co., Ltd.).

    Techniques: Amplification, DNA Purification, Chromatin Immunoprecipitation, Electrophoresis

    Venn diagram indicating the number of differentially expressed genes in medulloblastoma from the comparisons of different microarray systems. A total of 4,596 (1,656 up- and 2,940 downregulated) genes from Agilent microarray system, 12,262 (8,306 up- and 3,956 downregulated) genes from GEO GSE7578, and 14,257 (11,274 up- and 2,983 downregulated) genes from GEO GSE22139 were respectively selected according to their differential expression. Gray regions indicated the genes repeated in different experiments. Only 2,544 genes with consistent expression level differences were determined by comparing the data obtained from Agilent and Affymetrix (GEO GSE7578 and GSE22139) microarrays. GEO, Gene Expression Omnibus; GSE, GEO series.

    Journal: International Journal of Molecular Medicine

    Article Title: Detection of lower levels of SNAP25 using multiple microarray systems and its functional significance in medulloblastoma

    doi: 10.3892/ijmm.2017.2925

    Figure Lengend Snippet: Venn diagram indicating the number of differentially expressed genes in medulloblastoma from the comparisons of different microarray systems. A total of 4,596 (1,656 up- and 2,940 downregulated) genes from Agilent microarray system, 12,262 (8,306 up- and 3,956 downregulated) genes from GEO GSE7578, and 14,257 (11,274 up- and 2,983 downregulated) genes from GEO GSE22139 were respectively selected according to their differential expression. Gray regions indicated the genes repeated in different experiments. Only 2,544 genes with consistent expression level differences were determined by comparing the data obtained from Agilent and Affymetrix (GEO GSE7578 and GSE22139) microarrays. GEO, Gene Expression Omnibus; GSE, GEO series.

    Article Snippet: We identified 4,596 candidates based on their significantly up- ( > 1.50-fold) or downregulated ( < 0.67-fold) expression levels in MB cells using Agilent oligonucleotide microarrays.

    Techniques: Microarray, Expressing

    EP300 downregulation after silencing of HPV-18 E1. Confirmation of micro-array data using real-time RT-PCR. Transcript levels of EP300 and CDKN1A were quantified using RT-PCR. EP300 and CDKN1A gene expressions were affected after siE1.6 and siE1.2 transfections, at 100 nM for 48 h, but not after siControl transfection. Decreased EP300 and increased CDKN1A expression were consistent with the results obtained from the microarray analysis. The relative logarithmic expressions were normalized against the non-treatment control (NTC). GAPDH was used as a reference gene control.

    Journal: Open Biology

    Article Title: A systems biology analysis of the changes in gene expression via silencing of HPV-18 E1 expression in HeLa cells

    doi: 10.1098/rsob.130119

    Figure Lengend Snippet: EP300 downregulation after silencing of HPV-18 E1. Confirmation of micro-array data using real-time RT-PCR. Transcript levels of EP300 and CDKN1A were quantified using RT-PCR. EP300 and CDKN1A gene expressions were affected after siE1.6 and siE1.2 transfections, at 100 nM for 48 h, but not after siControl transfection. Decreased EP300 and increased CDKN1A expression were consistent with the results obtained from the microarray analysis. The relative logarithmic expressions were normalized against the non-treatment control (NTC). GAPDH was used as a reference gene control.

    Article Snippet: Expression data analysis identified 2669 differentially expressed cellular genes after silencing E1 endogenous mRNAs in HeLa cells The cellular gene expression profile of HeLa cells was compared before and after siE1.6 transfection using the Agilent human oligonucleotide microarray analysis, which contained 41 000 unique human gene transcripts.

    Techniques: Microarray, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Transfection, Expressing