deparaffinization solution  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Deparaffinization Solution
    Description:
    For deparaffinization of FFPE samples Kit contents Qiagen Deparaffinization Solution 2 x 8mL Non odorous and is easily Tracked with its Blue Tracer Dye For Deparaffinization of FFPE Samples
    Catalog Number:
    19093
    Price:
    180
    Category:
    Deparaffinization Solution
    Buy from Supplier


    Structured Review

    Qiagen deparaffinization solution
    Deparaffinization Solution
    For deparaffinization of FFPE samples Kit contents Qiagen Deparaffinization Solution 2 x 8mL Non odorous and is easily Tracked with its Blue Tracer Dye For Deparaffinization of FFPE Samples
    https://www.bioz.com/result/deparaffinization solution/product/Qiagen
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deparaffinization solution - by Bioz Stars, 2021-03
    98/100 stars

    Images

    Related Articles

    Formalin-fixed Paraffin-Embedded:

    Article Title: The G-Protein-Coupled Estrogen Receptor (GPER/GPR30) in Ovarian Granulosa Cell Tumors
    Article Snippet: FSHR and LHCGR expression in GPER positive GCTs was analyzed by RT-PCR. .. Following deparaffinization of GCT sections (2–3 µm) in a descending series of alcohols, mRNA was extracted by using the RNeasy FFPE Kit (Quiagen, Hilden, Germany), as per the manufacturer’s instructions, and total mRNA was subjected to reverse transcription employing SuperScript II reverse transcriptase (Invitrogen, Darmstadt, Germany). .. FSHR and LHCGR were amplified by using the following primers: FSHR -5' CTGCTCCTGGTCTCTTTGCT, 3' GGTCCCCAAATCCTGAAAAT; 5' nested GAGCTTGGGCTCAGGATGT, 3' nested GCACCTTTTTGGATGACTCG; LHCGR -5' TGGAGAAGATGCACAATGGA, 3' GGCAATTAGCCTCTGAATGG; 5' nested GCCTTCCGTGGGGCCACAG.

    Article Title: Aberrant microRNA-137 promoter methylation is associated with lymph node metastasis and poor clinical outcomes in non-small cell lung cancer
    Article Snippet: Total tissue RNA was extracted from FFPE tissue sections using the miRNeasy FFPE kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. .. Paraffin was removed from freshly cut FFPE tissue sections each up to 10-µm thick using deparaffinization solution using the miRNeasy FFPE kit (Qiagen, Inc.), and samples under went protease digestion at room temperature to release RNA from the sections, then short incubation (at 56°C for 15 min, then at 80°C for 15 min) to reverse formalin cross-linking of the released nucleic acids and DNase digestion to remove DNA. ..

    Article Title: FOXP3 and CEACAM6 expression and T cell infiltration in the occurrence and development of colon cancer
    Article Snippet: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) Purification of total RNA from FFPE tissue sections was performed using an RNeasy FFPE Kit (#73504; Qiagen, Inc., Valencia, CA, USA). .. Initially, all paraffin was removed from freshly cut FFPE tissue sections by treating with deparaffinization solution (Qiagen, Inc.). .. Next, samples were incubated in an optimized lysis buffer, containing proteinase K, to release RNA from the sections.

    Article Title: A Computational Workflow Translates a 58-Gene Signature to a Formalin-Fixed, Paraffin-Embedded Sample-Based Companion Diagnostic for Personalized Treatment of the BRAF-Mutation-Like Subtype of Colorectal Cancers
    Article Snippet: .. Deparaffinization and total RNA extraction was performed using an RNeasy FFPE kit (Qiagen) according to the manufacturer’s instructions. .. RNA yield was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) as described previously [ ].

    Lysis:

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis
    Article Snippet: High throughput and automated FFPE extraction protocol Confirming the findings of others [ ], we observed the Qiagen Allprep DNA/RNA Extraction Kit to have superior performance relative to other column-based protocols ( ). .. The manual lysis, deparaffinization, proteinase K treatment and reverse crosslinking of the samples as well as the automation of the subsequent purification steps on Qiagen’s QIAcube robot allows the processing of 96 samples in 8–9 separate one-day runs (with > 6hrs total hands-on time). .. Clearly, this is still rate limiting for large scale studies and thus we sought an alternative approach that (1) could increase the throughput of extraction through automation while ensuring that nucleic acids were of sufficient quality and quantity for downstream NGS applications and (2) allowed extraction of RNA, miRNA, and gDNA in one protocol.

    Purification:

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis
    Article Snippet: High throughput and automated FFPE extraction protocol Confirming the findings of others [ ], we observed the Qiagen Allprep DNA/RNA Extraction Kit to have superior performance relative to other column-based protocols ( ). .. The manual lysis, deparaffinization, proteinase K treatment and reverse crosslinking of the samples as well as the automation of the subsequent purification steps on Qiagen’s QIAcube robot allows the processing of 96 samples in 8–9 separate one-day runs (with > 6hrs total hands-on time). .. Clearly, this is still rate limiting for large scale studies and thus we sought an alternative approach that (1) could increase the throughput of extraction through automation while ensuring that nucleic acids were of sufficient quality and quantity for downstream NGS applications and (2) allowed extraction of RNA, miRNA, and gDNA in one protocol.

    Incubation:

    Article Title: Aberrant microRNA-137 promoter methylation is associated with lymph node metastasis and poor clinical outcomes in non-small cell lung cancer
    Article Snippet: Total tissue RNA was extracted from FFPE tissue sections using the miRNeasy FFPE kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. .. Paraffin was removed from freshly cut FFPE tissue sections each up to 10-µm thick using deparaffinization solution using the miRNeasy FFPE kit (Qiagen, Inc.), and samples under went protease digestion at room temperature to release RNA from the sections, then short incubation (at 56°C for 15 min, then at 80°C for 15 min) to reverse formalin cross-linking of the released nucleic acids and DNase digestion to remove DNA. ..

    Article Title: Gene expression array testing of FFPE archival breast tumor samples: an optimized protocol for WG-DASL® sample preparation
    Article Snippet: We found that the modified Qiagen method led to substantially better results in terms of median yield (by eight fold; ) and higher consistency of purity. .. This enhanced performance compared to the Roche method may be attributable to a combination of several factors: (a) the additional deparaffinization and alcohol wash steps; (b) the lengthened proteinase k incubation time, using a stabilized and highly active proteinase k formulation (provided by Qiagen); and (c) inclusion of a high temperature heat pulse step for the reversal of RNA cross-linking (Qiagen). .. There was a wide spread in sample quality, as measured by RPL13a RT-PCR , with a median Ct of 29.43 ± 4.71.

    Isolation:

    Article Title: Fibroblast growth factor receptor 1 amplification in laryngeal squamous cell carcinoma
    Article Snippet: The deparaffinization solution was removed from the cell pellet and the tubes were incubated at 37°C for 10 minutes to allow evaporation of residual liquid. .. After deparaffinization, DNA was isolated by an automated extraction in a QiaCube instrument using the QIAamp DNA FFPE Tissue Kit (QIAGEN, Hilden, Germany). .. Quantity and quality of the DNA were evaluated using a spectral photometer (NanoDrop, PEQLab, Erlangen, Germany).

    RNA Extraction:

    Article Title: A Computational Workflow Translates a 58-Gene Signature to a Formalin-Fixed, Paraffin-Embedded Sample-Based Companion Diagnostic for Personalized Treatment of the BRAF-Mutation-Like Subtype of Colorectal Cancers
    Article Snippet: .. Deparaffinization and total RNA extraction was performed using an RNeasy FFPE kit (Qiagen) according to the manufacturer’s instructions. .. RNA yield was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) as described previously [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Qiagen deparaffinization
    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the <t>lysis/deparaffinization</t> steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.
    Deparaffinization, supplied by Qiagen, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deparaffinization/product/Qiagen
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deparaffinization - by Bioz Stars, 2021-03
    98/100 stars
      Buy from Supplier

    Image Search Results


    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Journal: PLoS ONE

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis

    doi: 10.1371/journal.pone.0178706

    Figure Lengend Snippet: Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Article Snippet: The manual lysis, deparaffinization, proteinase K treatment and reverse crosslinking of the samples as well as the automation of the subsequent purification steps on Qiagen’s QIAcube robot allows the processing of 96 samples in 8–9 separate one-day runs (with > 6hrs total hands-on time).

    Techniques: High Throughput Screening Assay, Flow Cytometry, Incubation, Modification, Lysis, Formalin-fixed Paraffin-Embedded