deoxyribonuclease i  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher deoxyribonuclease i
    Deoxyribonuclease I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxyribonuclease i/product/Thermo Fisher
    Average 99 stars, based on 117 article reviews
    Price from $9.99 to $1999.99
    deoxyribonuclease i - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. To test the cytotoxicity of cell culture supernatants infected with M. bovis , mycoplasma cells were killed by a gentamicin treatment (400 μg/ml) for 3 h at 37°C and mycoplasma cells were depleted by 30 min centrifugation at 12,000 ×g (4°C).

    Amplification:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR amplification was performed with a Biometra Thermal Cycler using Taq ALLin polymerase (Axon Lab, Baden, Switzerland) according to the manufacturer’s instructions with an initial enzyme activation step (95 °C for 2 min) followed by 30 cycles of denaturation (95 °C for 30 s) and hybridization (72 °C for 30 s) and a final elongation (72 °C for 10 min).

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: .. The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3. .. After incubation at 37°C for 7 min, 1 mM EDTA was added, and the mixture was heated to 70°C for 15 min.

    Stable Transfection:

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: U373 cells stably expressing YFP-tagged TLR9 and CFP-tagged CD32 were generated following retroviral infection. .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories).

    Synthesized:

    Article Title: Linking Measures of Colony and Individual Honey Bee Health to Survival among Apiaries Exposed to Varying Agricultural Land Use
    Article Snippet: Contaminating DNA was removed using DNAse I in an 11 μL reaction containing 8 μL (1.5 μg) total RNA, 10 U DNAse I (Invitrogen) in appropriate buffer, 20 U RNAseout (Invitrogen), poly dT12-18 , and 2 mM dNTP. .. The DNAse reaction was performed at 37°C for 1 hr. followed by 75°C for 10 min. First-stand cDNA was synthesized by using 100 U Superscript II Reverse Transcriptase (Invitrogen) and incubation at 42°C for 50 min. followed by 15 min. at 70°C.

    Quantitative RT-PCR:

    Article Title: Are Small Nucleolar RNAs “CRISPRable”? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells
    Article Snippet: .. Real-Time RT-PCR Prior to RT-PCR, total RNA was isolated from the cells and treated with DNase I (Thermo Fisher Scientific). .. Quantitative RT-PCR was performed using BioMaster RT-PCR SYBR Blue reaction mix (BIOLABMIX Ltd., Novosibirsk, Russia) on a LightCycler 96 (Roche, Switzerland) with the following primers: U74: 5’-CTGCCTCTGATGAAGCCTGTG-3’ (U74-f) and 5’-CCACCATCAGAGCGGTTG-3’ (U74-r) or 5’-GAGCGG​TTGGCATTCATC-3’ (U74-all-r); U75: 5’-GTCGTATCCAGT​GCAGGGTCCGAGGTATTCGCACTGGATACGACAG​CCTC-3’ (U75-SL-sl-r), 5’-GTATACAGCCTGTGATG​CTTT-3’ (U75-SL-f), 5’-GTGCAGGGTCCGAGGT-3’ (U75-SL-r), and 5’-FAM-TGGATACGACAGCCTCAG-BHQ1-3’ (U75-SL-probe); U77: 5’-AGATACTATGATGGTTGC-3’ (U77-f) or 5’-ATGATGGTTGCATAGTTCAG-3’ (U77-all-f) and 5’-GA​TACATCAGACAGATAG-3’ (U77-r); U80: 5’-ACAATGATGA​TAACATAG-3’ (U80-f) and 5’-GATAGGAGCGAAAGACT-3’ (U80-all-r) or 5’-CATCAGATAGGAGCGAA-3’ (U80-r); Gas5: 5’-GAGGTAGGAGTCGACTCCTGTGA-3’ (exon 1 forward), 5’-GTGGAGTCCAACTTGCCTGGAC-3’ (exon 6 forward), 5’-CTGCATTTCTTCAATCATGAAT-3’ (exon 9 reverse); U1: 5’-CAGGGGAGATACCATGATCACGAAG-3’ and 5’-CGC​AGTCCCCCACTACCACAAAT-3’ U6: 5’-TCGCTTCGGCAG​CACATATACTAAAAT-3’ and 5’-GAATTTGCGTGTCATCCT​TGCG-3’ U8: 5’- AATCAGACAGGAGCAATCA-3’ and 5’-ATC​GTCAGGTGGGATAATCCT-3’ HPRT: 5’-CATCAAAGCACTG​AATAGAAAT-3’ and 5’-TATCTTCCACAATCAAGACATT-3’ B2M: 5’-CGCTCCGTGGCCTTAGCTGT-3’ _and 5’-AAAGA​CAAGTCTGAATGCTC-3’ 18S rRNA: 5’-GATGGTAGTC​GCCGTGCC-3’ and 5’-GCCTGCTGCCTTCCTTGG-3’ U47: TaqMan MicroRNA Assay #001223 (Thermo Fisher Scientific).

    Cytotoxicity Assay:

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Paragraph title: Co-cultivation of M. bovis With Bovine Lung Cells and Crystal Violet Cell Cytotoxicity Assay ... Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C.

    SYBR Green Assay:

    Article Title: Linking Measures of Colony and Individual Honey Bee Health to Survival among Apiaries Exposed to Varying Agricultural Land Use
    Article Snippet: Contaminating DNA was removed using DNAse I in an 11 μL reaction containing 8 μL (1.5 μg) total RNA, 10 U DNAse I (Invitrogen) in appropriate buffer, 20 U RNAseout (Invitrogen), poly dT12-18 , and 2 mM dNTP. .. Quantitative PCR was performed in a 20 μl reaction mixture consisting of 1X SsoAdvanced™ SYBR® Green supermix (Bio-Rad), 0.2 μM of each primer, and 1μl (~100 ng) of cDNA template (see for primer sequences).

    Incubation:

    Article Title: Systemic Errors In Quantitative PCR Titration of Self-Complementary AAV Vectors and Improved Alternative Methods
    Article Snippet: .. For pretreatment with DNase I, 5 μl of scAAV was mixed with 40 U of DNase I (Invitrogen, Carlsbad, CA) in 40 μl of 1×restriction buffer 3 (New England BioLabs) and incubated for 30 min at 37°C; the sample was then supplemented with 10 μl of proteinase K cocktail (0.5% SDS and proteinase K [20 U/ml; Sigma-Aldrich] in nuclease-free water), incubated for 30 min at 56°C and for 20 min at 96°C, and then cooled to room temperature at a thermal gradient of 3°C/min. ..

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: .. Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. To confirm the removal of contaminant DNA, polymerase chain reaction (PCR) targeting the 16S rRNA gene was performed using the universal primer pair 341f (5′-CCTACGGGNGGCWGCAG-3′) and 785r (5′-GACTACHVGGGTATCTAAKCC-3′) ( ).

    Article Title: Systematic Comparison and Validation of Quantitative Real-Time PCR Methods for the Quantitation of Adeno-Associated Viral Products
    Article Snippet: .. Method A used a treatment protocol incorporating incubation with DNase I and proteinase K, that is, 5 μl of vector was treated with 50 units of DNase I (Life Technologies/Thermo Fisher Scientific) at 37°C for 1 hr to remove residual plasmid DNA in vector samples. .. After the inactivation of DNase I at 65°C for 10 min, proteinase K (0.4 unit) was then added and incubated at 50°C for 1 hr to release vector DNA from AAV capsids before being inactivated at 95°C for 20 min.

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3. .. After incubation at 37°C for 7 min, 1 mM EDTA was added, and the mixture was heated to 70°C for 15 min.

    Article Title: Linking Measures of Colony and Individual Honey Bee Health to Survival among Apiaries Exposed to Varying Agricultural Land Use
    Article Snippet: Contaminating DNA was removed using DNAse I in an 11 μL reaction containing 8 μL (1.5 μg) total RNA, 10 U DNAse I (Invitrogen) in appropriate buffer, 20 U RNAseout (Invitrogen), poly dT12-18 , and 2 mM dNTP. .. The DNAse reaction was performed at 37°C for 1 hr. followed by 75°C for 10 min. First-stand cDNA was synthesized by using 100 U Superscript II Reverse Transcriptase (Invitrogen) and incubation at 42°C for 50 min. followed by 15 min. at 70°C.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: .. Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. Polynucleotides were removed from DNase I digestion products by using the QIAquick PCR Purification Kit (Qiagen).

    Activity Assay:

    Article Title: Inhibition of Aspergillus fumigatus and Its Biofilm by Pseudomonas aeruginosa Is Dependent on the Source, Phenotype and Growth Conditions of the Bacterium
    Article Snippet: .. Effect of DNase I and Proteinase K on Pa supernatant activity To determine whether Pa or phage DNA or a Pa protein(s) were involved in the inhibition of Af , we studied the effect of pretreatment of Pa culture filtrates with DNase I (Life Technologies, Grand Island, NY) or Proteinase K (Sigma) and measured the filtrate inhibitory activity on Af biofilm formation ( ). .. Pa biofilm culture filtrates were prepared as described using a CF non-mucoid Pa isolate, Af biofilm metabolic activity was measured using the XTT assay.

    Infection:

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: U373 cells stably expressing YFP-tagged TLR9 and CFP-tagged CD32 were generated following retroviral infection. .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories).

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. To test the cytotoxicity of cell culture supernatants infected with M. bovis , mycoplasma cells were killed by a gentamicin treatment (400 μg/ml) for 3 h at 37°C and mycoplasma cells were depleted by 30 min centrifugation at 12,000 ×g (4°C).

    Expressing:

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: U373 cells stably expressing YFP-tagged TLR9 and CFP-tagged CD32 were generated following retroviral infection. .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories).

    Modification:

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: We modified the method described by in the following way: 120 pmol of 23S/5S rRNA were diluted in a hybridization buffer containing 75 mM HEPES and 150 mM KCl together with 600 pmol of oligonucleotide, complementary to the 2017- to 2053-nt region with additional five noncomplementary nucleotides at both ends (attatCGGGTACACTGCATCTTCACAGCGAGTTCAtaaag). .. To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    Article Title: Poly(ADP-ribose)-dependent chromatin unfolding facilitates the association of DNA-binding proteins with DNA at sites of damage
    Article Snippet: Micropore irradiation assay A modified protocol previously described by Suzuki et al. was established to quantify PARylation induced chromatin relaxation at sites of microirradiation ( ). .. Cells were fixed with 3% PFA at different time points post-irradiation, washed with 0.5% Triton X-100 in PBS for 10 min and then treated with 0.005 U/μl DNase I (Thermo Fisher Scientific) for 5 min.

    Hybridization:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR amplification was performed with a Biometra Thermal Cycler using Taq ALLin polymerase (Axon Lab, Baden, Switzerland) according to the manufacturer’s instructions with an initial enzyme activation step (95 °C for 2 min) followed by 30 cycles of denaturation (95 °C for 30 s) and hybridization (72 °C for 30 s) and a final elongation (72 °C for 10 min).

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: We modified the method described by in the following way: 120 pmol of 23S/5S rRNA were diluted in a hybridization buffer containing 75 mM HEPES and 150 mM KCl together with 600 pmol of oligonucleotide, complementary to the 2017- to 2053-nt region with additional five noncomplementary nucleotides at both ends (attatCGGGTACACTGCATCTTCACAGCGAGTTCAtaaag). .. To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    High Performance Liquid Chromatography:

    Article Title: Systematic Comparison and Validation of Quantitative Real-Time PCR Methods for the Quantitation of Adeno-Associated Viral Products
    Article Snippet: Method A used a treatment protocol incorporating incubation with DNase I and proteinase K, that is, 5 μl of vector was treated with 50 units of DNase I (Life Technologies/Thermo Fisher Scientific) at 37°C for 1 hr to remove residual plasmid DNA in vector samples. .. To test the efficiency of DNase I and proteinase K treatments, replicates of a crude sample (before HPLC) and HPLC-purified AAV sample were spiked with 1.25×10 copies of the AAV-independent plasmid pRRLSIN.cPPT.PGK-GFP.WPRE (plasmid 12252; Addgene, Cambridge, MA) encoding lentiviral vector sequences.

    Sequencing:

    Article Title: Complete, gene-specific siRNA libraries: Production and expression in mammalian cells
    Article Snippet: PCR-amplified cDNA encoding DsRed was subjected to partial digestion with DNase I in a buffer containing 1 mM MnCl2 , 50 mM Tris-HCl (pH 7.5), 0.5 μg/μL BSA, and 0.1–0.3 U/μg DNase I (Ambion) at 20°C for 1–10 min to generate small, blunt-ended DNA fragments (Fig. 2A ). .. Under these conditions DNase I displays little sequence specificity, cleaving all regions of the DNA (except the terminal nucleotides) at an equal rate ( ).

    Activation Assay:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR amplification was performed with a Biometra Thermal Cycler using Taq ALLin polymerase (Axon Lab, Baden, Switzerland) according to the manufacturer’s instructions with an initial enzyme activation step (95 °C for 2 min) followed by 30 cycles of denaturation (95 °C for 30 s) and hybridization (72 °C for 30 s) and a final elongation (72 °C for 10 min).

    Footprinting:

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: Paragraph title: DNase I Footprinting. ... The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3.

    Purification:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: .. Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. To confirm the removal of contaminant DNA, polymerase chain reaction (PCR) targeting the 16S rRNA gene was performed using the universal primer pair 341f (5′-CCTACGGGNGGCWGCAG-3′) and 785r (5′-GACTACHVGGGTATCTAAKCC-3′) ( ).

    Article Title: Systematic Comparison and Validation of Quantitative Real-Time PCR Methods for the Quantitation of Adeno-Associated Viral Products
    Article Snippet: Viral genome extraction Two methods were used to extract AAV vector DNA from purified AAV vectors. .. Method A used a treatment protocol incorporating incubation with DNase I and proteinase K, that is, 5 μl of vector was treated with 50 units of DNase I (Life Technologies/Thermo Fisher Scientific) at 37°C for 1 hr to remove residual plasmid DNA in vector samples.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. Polynucleotides were removed from DNase I digestion products by using the QIAquick PCR Purification Kit (Qiagen).

    Cell Culture:

    Article Title: Poly(ADP-ribose)-dependent chromatin unfolding facilitates the association of DNA-binding proteins with DNA at sites of damage
    Article Snippet: U2OS cells were cultured as described above and labeled with 50 μM 5-bromo-2′-deoxyuridine (BrdU; Sigma) for 24 h followed by 1 h treatment with 10 μM Olaparib (Selleckchem) or were left untreated prior to UV irradiation. .. Cells were fixed with 3% PFA at different time points post-irradiation, washed with 0.5% Triton X-100 in PBS for 10 min and then treated with 0.005 U/μl DNase I (Thermo Fisher Scientific) for 5 min.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. To test the cytotoxicity of cell culture supernatants infected with M. bovis , mycoplasma cells were killed by a gentamicin treatment (400 μg/ml) for 3 h at 37°C and mycoplasma cells were depleted by 30 min centrifugation at 12,000 ×g (4°C).

    TaqMan microRNA Assay:

    Article Title: Are Small Nucleolar RNAs “CRISPRable”? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells
    Article Snippet: Real-Time RT-PCR Prior to RT-PCR, total RNA was isolated from the cells and treated with DNase I (Thermo Fisher Scientific). .. Quantitative RT-PCR was performed using BioMaster RT-PCR SYBR Blue reaction mix (BIOLABMIX Ltd., Novosibirsk, Russia) on a LightCycler 96 (Roche, Switzerland) with the following primers: U74: 5’-CTGCCTCTGATGAAGCCTGTG-3’ (U74-f) and 5’-CCACCATCAGAGCGGTTG-3’ (U74-r) or 5’-GAGCGG​TTGGCATTCATC-3’ (U74-all-r); U75: 5’-GTCGTATCCAGT​GCAGGGTCCGAGGTATTCGCACTGGATACGACAG​CCTC-3’ (U75-SL-sl-r), 5’-GTATACAGCCTGTGATG​CTTT-3’ (U75-SL-f), 5’-GTGCAGGGTCCGAGGT-3’ (U75-SL-r), and 5’-FAM-TGGATACGACAGCCTCAG-BHQ1-3’ (U75-SL-probe); U77: 5’-AGATACTATGATGGTTGC-3’ (U77-f) or 5’-ATGATGGTTGCATAGTTCAG-3’ (U77-all-f) and 5’-GA​TACATCAGACAGATAG-3’ (U77-r); U80: 5’-ACAATGATGA​TAACATAG-3’ (U80-f) and 5’-GATAGGAGCGAAAGACT-3’ (U80-all-r) or 5’-CATCAGATAGGAGCGAA-3’ (U80-r); Gas5: 5’-GAGGTAGGAGTCGACTCCTGTGA-3’ (exon 1 forward), 5’-GTGGAGTCCAACTTGCCTGGAC-3’ (exon 6 forward), 5’-CTGCATTTCTTCAATCATGAAT-3’ (exon 9 reverse); U1: 5’-CAGGGGAGATACCATGATCACGAAG-3’ and 5’-CGC​AGTCCCCCACTACCACAAAT-3’ U6: 5’-TCGCTTCGGCAG​CACATATACTAAAAT-3’ and 5’-GAATTTGCGTGTCATCCT​TGCG-3’ U8: 5’- AATCAGACAGGAGCAATCA-3’ and 5’-ATC​GTCAGGTGGGATAATCCT-3’ HPRT: 5’-CATCAAAGCACTG​AATAGAAAT-3’ and 5’-TATCTTCCACAATCAAGACATT-3’ B2M: 5’-CGCTCCGTGGCCTTAGCTGT-3’ _and 5’-AAAGA​CAAGTCTGAATGCTC-3’ 18S rRNA: 5’-GATGGTAGTC​GCCGTGCC-3’ and 5’-GCCTGCTGCCTTCCTTGG-3’ U47: TaqMan MicroRNA Assay #001223 (Thermo Fisher Scientific).

    Mutagenesis:

    Article Title: Are Small Nucleolar RNAs “CRISPRable”? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells
    Article Snippet: Real-Time RT-PCR Prior to RT-PCR, total RNA was isolated from the cells and treated with DNase I (Thermo Fisher Scientific). .. For evaluation of the total level of all mutant RNA forms of the target snoRNA in the corresponding clone, the following primers were used: U74-f and U74-all-r (U74 RNA forms); U75-SL-sl-r, U75-SL-f and U75-SL-r (U75 RNA forms); U77-all-f and U77-r (U77 RNA forms); and U80-all-r and U80-f (U80 RNA forms).

    Generated:

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: U373 cells stably expressing YFP-tagged TLR9 and CFP-tagged CD32 were generated following retroviral infection. .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories).

    Inhibition:

    Article Title: Inhibition of Aspergillus fumigatus and Its Biofilm by Pseudomonas aeruginosa Is Dependent on the Source, Phenotype and Growth Conditions of the Bacterium
    Article Snippet: .. Effect of DNase I and Proteinase K on Pa supernatant activity To determine whether Pa or phage DNA or a Pa protein(s) were involved in the inhibition of Af , we studied the effect of pretreatment of Pa culture filtrates with DNase I (Life Technologies, Grand Island, NY) or Proteinase K (Sigma) and measured the filtrate inhibitory activity on Af biofilm formation ( ). .. Pa biofilm culture filtrates were prepared as described using a CF non-mucoid Pa isolate, Af biofilm metabolic activity was measured using the XTT assay.

    Inverted Microscopy:

    Article Title: Poly(ADP-ribose)-dependent chromatin unfolding facilitates the association of DNA-binding proteins with DNA at sites of damage
    Article Snippet: Cells were fixed with 3% PFA at different time points post-irradiation, washed with 0.5% Triton X-100 in PBS for 10 min and then treated with 0.005 U/μl DNase I (Thermo Fisher Scientific) for 5 min. .. Primary antibodies were detected using Alexa Fluor 488 conjugated goat anti-mouse IgG (Invitrogen, A21422 at 1:1000) and Alexa Fluor 555 conjugated goat anti-rabbit IgG (Invitrogen, A21428 at 1:1000). z-stacks of images were acquired using a Visitron spinning disk confocal system (Visitron systems GmBH) equipped with Yokogawa CSU-W1 spinning disk unit, Olympus IX83 inverted microscope (60× oil objective, NA 1.42), Andor Zyla 4.2 Plus camera, with 405, 488 and 561 nm lasers.

    Polymerase Chain Reaction:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. To confirm the removal of contaminant DNA, polymerase chain reaction (PCR) targeting the 16S rRNA gene was performed using the universal primer pair 341f (5′-CCTACGGGNGGCWGCAG-3′) and 785r (5′-GACTACHVGGGTATCTAAKCC-3′) ( ).

    Article Title: Complete, gene-specific siRNA libraries: Production and expression in mammalian cells
    Article Snippet: .. PCR-amplified cDNA encoding DsRed was subjected to partial digestion with DNase I in a buffer containing 1 mM MnCl2 , 50 mM Tris-HCl (pH 7.5), 0.5 μg/μL BSA, and 0.1–0.3 U/μg DNase I (Ambion) at 20°C for 1–10 min to generate small, blunt-ended DNA fragments (Fig. 2A ). .. Under these conditions DNase I displays little sequence specificity, cleaving all regions of the DNA (except the terminal nucleotides) at an equal rate ( ).

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: PCR was used to amplify the 200-bp celC promoter region, using primer 3 labeled with fluorescein and primer 4 ( ). .. The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C. .. Polynucleotides were removed from DNase I digestion products by using the QIAquick PCR Purification Kit (Qiagen).

    Injection:

    Article Title: TLR9 acts as a sensor for tumor-released DNA to modulate anti-tumor immunity after chemotherapy
    Article Snippet: .. For experiments involving the use of DNase I, 2000 U of DNase I (Invitrogen, Carlsbad, CA) or PBS control were injected intravenously in concurrent with cisplatin and E7 peptide administration on days 5, 8 and 11 after tumor challenge. .. For experiments in the CT26 model, CT26 tumor cells (2 × 105 per animal) were inoculated subcutaneously into BALB/c mice (10 per group).

    Binding Assay:

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: .. The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3. .. After incubation at 37°C for 7 min, 1 mM EDTA was added, and the mixture was heated to 70°C for 15 min.

    Radioactivity:

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: The radioactivity of tritium incorporated into RNA was measured by scintillation counting. .. To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    Methylation:

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: Paragraph title: In vitro methylation ... To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    XTT Assay:

    Article Title: Inhibition of Aspergillus fumigatus and Its Biofilm by Pseudomonas aeruginosa Is Dependent on the Source, Phenotype and Growth Conditions of the Bacterium
    Article Snippet: Effect of DNase I and Proteinase K on Pa supernatant activity To determine whether Pa or phage DNA or a Pa protein(s) were involved in the inhibition of Af , we studied the effect of pretreatment of Pa culture filtrates with DNase I (Life Technologies, Grand Island, NY) or Proteinase K (Sigma) and measured the filtrate inhibitory activity on Af biofilm formation ( ). .. Pa biofilm culture filtrates were prepared as described using a CF non-mucoid Pa isolate, Af biofilm metabolic activity was measured using the XTT assay.

    Isolation:

    Article Title: Identification of Candidate Genes Associated with Leaf Senescence in Cultivated Sunflower (Helianthus annuus L.)
    Article Snippet: Paragraph title: RNA isolation and quality controls ... Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina).

    Article Title: Exploring gene networks in two sunflower lines with contrasting leaf senescence phenotype using a system biology approach
    Article Snippet: Paragraph title: RNA isolation, quantification, and quality controls ... Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina).

    Article Title: Complete, gene-specific siRNA libraries: Production and expression in mammalian cells
    Article Snippet: PCR-amplified cDNA encoding DsRed was subjected to partial digestion with DNase I in a buffer containing 1 mM MnCl2 , 50 mM Tris-HCl (pH 7.5), 0.5 μg/μL BSA, and 0.1–0.3 U/μg DNase I (Ambion) at 20°C for 1–10 min to generate small, blunt-ended DNA fragments (Fig. 2A ). .. Aliquots were collected at various time points and quenched with an equal volume of loading buffer (95% formamide, 10 mM EDTA, 0.1% SDS) and DNA fragments corresponding to 20–30 bp were isolated by native 15% polyacrylamide gel.

    Article Title: Are Small Nucleolar RNAs “CRISPRable”? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells
    Article Snippet: .. Real-Time RT-PCR Prior to RT-PCR, total RNA was isolated from the cells and treated with DNase I (Thermo Fisher Scientific). .. Quantitative RT-PCR was performed using BioMaster RT-PCR SYBR Blue reaction mix (BIOLABMIX Ltd., Novosibirsk, Russia) on a LightCycler 96 (Roche, Switzerland) with the following primers: U74: 5’-CTGCCTCTGATGAAGCCTGTG-3’ (U74-f) and 5’-CCACCATCAGAGCGGTTG-3’ (U74-r) or 5’-GAGCGG​TTGGCATTCATC-3’ (U74-all-r); U75: 5’-GTCGTATCCAGT​GCAGGGTCCGAGGTATTCGCACTGGATACGACAG​CCTC-3’ (U75-SL-sl-r), 5’-GTATACAGCCTGTGATG​CTTT-3’ (U75-SL-f), 5’-GTGCAGGGTCCGAGGT-3’ (U75-SL-r), and 5’-FAM-TGGATACGACAGCCTCAG-BHQ1-3’ (U75-SL-probe); U77: 5’-AGATACTATGATGGTTGC-3’ (U77-f) or 5’-ATGATGGTTGCATAGTTCAG-3’ (U77-all-f) and 5’-GA​TACATCAGACAGATAG-3’ (U77-r); U80: 5’-ACAATGATGA​TAACATAG-3’ (U80-f) and 5’-GATAGGAGCGAAAGACT-3’ (U80-all-r) or 5’-CATCAGATAGGAGCGAA-3’ (U80-r); Gas5: 5’-GAGGTAGGAGTCGACTCCTGTGA-3’ (exon 1 forward), 5’-GTGGAGTCCAACTTGCCTGGAC-3’ (exon 6 forward), 5’-CTGCATTTCTTCAATCATGAAT-3’ (exon 9 reverse); U1: 5’-CAGGGGAGATACCATGATCACGAAG-3’ and 5’-CGC​AGTCCCCCACTACCACAAAT-3’ U6: 5’-TCGCTTCGGCAG​CACATATACTAAAAT-3’ and 5’-GAATTTGCGTGTCATCCT​TGCG-3’ U8: 5’- AATCAGACAGGAGCAATCA-3’ and 5’-ATC​GTCAGGTGGGATAATCCT-3’ HPRT: 5’-CATCAAAGCACTG​AATAGAAAT-3’ and 5’-TATCTTCCACAATCAAGACATT-3’ B2M: 5’-CGCTCCGTGGCCTTAGCTGT-3’ _and 5’-AAAGA​CAAGTCTGAATGCTC-3’ 18S rRNA: 5’-GATGGTAGTC​GCCGTGCC-3’ and 5’-GCCTGCTGCCTTCCTTGG-3’ U47: TaqMan MicroRNA Assay #001223 (Thermo Fisher Scientific).

    Labeling:

    Article Title: Induction of the celC operon of Clostridium thermocellum by laminaribiose
    Article Snippet: PCR was used to amplify the 200-bp celC promoter region, using primer 3 labeled with fluorescein and primer 4 ( ). .. The reaction mixture contained 400 ng of the amplified DNA fragment, binding buffer (10 mM Tris/50 mM KCl/1 mM DTT), 300 ng of dI-dC, 1 unit of DNase I (Invitrogen), and with or without 60 ng of rGlyR3.

    Article Title: Poly(ADP-ribose)-dependent chromatin unfolding facilitates the association of DNA-binding proteins with DNA at sites of damage
    Article Snippet: U2OS cells were cultured as described above and labeled with 50 μM 5-bromo-2′-deoxyuridine (BrdU; Sigma) for 24 h followed by 1 h treatment with 10 μM Olaparib (Selleckchem) or were left untreated prior to UV irradiation. .. Cells were fixed with 3% PFA at different time points post-irradiation, washed with 0.5% Triton X-100 in PBS for 10 min and then treated with 0.005 U/μl DNase I (Thermo Fisher Scientific) for 5 min.

    Mouse Assay:

    Article Title: TLR9 acts as a sensor for tumor-released DNA to modulate anti-tumor immunity after chemotherapy
    Article Snippet: On days 5, 8, and 11 after tumor challenge, mice were administered with 5 mg/kg of cisplatin or doxorubicin intraperitoneally, with or without concurrent intratumoral injection of 20 μg of E7 peptide (aa43–62). .. For experiments involving the use of DNase I, 2000 U of DNase I (Invitrogen, Carlsbad, CA) or PBS control were injected intravenously in concurrent with cisplatin and E7 peptide administration on days 5, 8 and 11 after tumor challenge.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Are Small Nucleolar RNAs “CRISPRable”? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells
    Article Snippet: .. Real-Time RT-PCR Prior to RT-PCR, total RNA was isolated from the cells and treated with DNase I (Thermo Fisher Scientific). .. Quantitative RT-PCR was performed using BioMaster RT-PCR SYBR Blue reaction mix (BIOLABMIX Ltd., Novosibirsk, Russia) on a LightCycler 96 (Roche, Switzerland) with the following primers: U74: 5’-CTGCCTCTGATGAAGCCTGTG-3’ (U74-f) and 5’-CCACCATCAGAGCGGTTG-3’ (U74-r) or 5’-GAGCGG​TTGGCATTCATC-3’ (U74-all-r); U75: 5’-GTCGTATCCAGT​GCAGGGTCCGAGGTATTCGCACTGGATACGACAG​CCTC-3’ (U75-SL-sl-r), 5’-GTATACAGCCTGTGATG​CTTT-3’ (U75-SL-f), 5’-GTGCAGGGTCCGAGGT-3’ (U75-SL-r), and 5’-FAM-TGGATACGACAGCCTCAG-BHQ1-3’ (U75-SL-probe); U77: 5’-AGATACTATGATGGTTGC-3’ (U77-f) or 5’-ATGATGGTTGCATAGTTCAG-3’ (U77-all-f) and 5’-GA​TACATCAGACAGATAG-3’ (U77-r); U80: 5’-ACAATGATGA​TAACATAG-3’ (U80-f) and 5’-GATAGGAGCGAAAGACT-3’ (U80-all-r) or 5’-CATCAGATAGGAGCGAA-3’ (U80-r); Gas5: 5’-GAGGTAGGAGTCGACTCCTGTGA-3’ (exon 1 forward), 5’-GTGGAGTCCAACTTGCCTGGAC-3’ (exon 6 forward), 5’-CTGCATTTCTTCAATCATGAAT-3’ (exon 9 reverse); U1: 5’-CAGGGGAGATACCATGATCACGAAG-3’ and 5’-CGC​AGTCCCCCACTACCACAAAT-3’ U6: 5’-TCGCTTCGGCAG​CACATATACTAAAAT-3’ and 5’-GAATTTGCGTGTCATCCT​TGCG-3’ U8: 5’- AATCAGACAGGAGCAATCA-3’ and 5’-ATC​GTCAGGTGGGATAATCCT-3’ HPRT: 5’-CATCAAAGCACTG​AATAGAAAT-3’ and 5’-TATCTTCCACAATCAAGACATT-3’ B2M: 5’-CGCTCCGTGGCCTTAGCTGT-3’ _and 5’-AAAGA​CAAGTCTGAATGCTC-3’ 18S rRNA: 5’-GATGGTAGTC​GCCGTGCC-3’ and 5’-GCCTGCTGCCTTCCTTGG-3’ U47: TaqMan MicroRNA Assay #001223 (Thermo Fisher Scientific).

    Construct:

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories). .. FuGENE6 was purchased from Roche Diagnostics.

    Titration:

    Article Title: Systemic Errors In Quantitative PCR Titration of Self-Complementary AAV Vectors and Improved Alternative Methods
    Article Snippet: Paragraph title: scAAV titration by endonuclease digestion qPCR ... For pretreatment with DNase I, 5 μl of scAAV was mixed with 40 U of DNase I (Invitrogen, Carlsbad, CA) in 40 μl of 1×restriction buffer 3 (New England BioLabs) and incubated for 30 min at 37°C; the sample was then supplemented with 10 μl of proteinase K cocktail (0.5% SDS and proteinase K [20 U/ml; Sigma-Aldrich] in nuclease-free water), incubated for 30 min at 56°C and for 20 min at 96°C, and then cooled to room temperature at a thermal gradient of 3°C/min.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: At different time post-inoculation, mycoplasma titers were determined by CFU titration following one freeze-thaw cycle. .. Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C.

    Plasmid Preparation:

    Article Title: Systemic Errors In Quantitative PCR Titration of Self-Complementary AAV Vectors and Improved Alternative Methods
    Article Snippet: For pretreatment with DNase I, 5 μl of scAAV was mixed with 40 U of DNase I (Invitrogen, Carlsbad, CA) in 40 μl of 1×restriction buffer 3 (New England BioLabs) and incubated for 30 min at 37°C; the sample was then supplemented with 10 μl of proteinase K cocktail (0.5% SDS and proteinase K [20 U/ml; Sigma-Aldrich] in nuclease-free water), incubated for 30 min at 56°C and for 20 min at 96°C, and then cooled to room temperature at a thermal gradient of 3°C/min. .. The linearity of this assay was confirmed for input scAAV vector preparations with titers in the range of 5×1010 to 1×1013 genome copies (GC)/ml.

    Article Title: Systematic Comparison and Validation of Quantitative Real-Time PCR Methods for the Quantitation of Adeno-Associated Viral Products
    Article Snippet: .. Method A used a treatment protocol incorporating incubation with DNase I and proteinase K, that is, 5 μl of vector was treated with 50 units of DNase I (Life Technologies/Thermo Fisher Scientific) at 37°C for 1 hr to remove residual plasmid DNA in vector samples. .. After the inactivation of DNase I at 65°C for 10 min, proteinase K (0.4 unit) was then added and incubated at 50°C for 1 hr to release vector DNA from AAV capsids before being inactivated at 95°C for 20 min.

    Article Title: Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9
    Article Snippet: The CD32A cDNA was recloned into pECFP-N1 (BD Biosciences — Clontech) vector and is expressed as a fusion protein containing a fluorescent C-terminal ECFP tag. .. Immobilized DNase I was constructed by coupling 100 mg of DNase I (Invitrogen Corp.) to 20 ml of Affigel-10 (Bio-Rad Laboratories).

    Real-time Polymerase Chain Reaction:

    Article Title: Systemic Errors In Quantitative PCR Titration of Self-Complementary AAV Vectors and Improved Alternative Methods
    Article Snippet: Paragraph title: scAAV titration by endonuclease digestion qPCR ... For pretreatment with DNase I, 5 μl of scAAV was mixed with 40 U of DNase I (Invitrogen, Carlsbad, CA) in 40 μl of 1×restriction buffer 3 (New England BioLabs) and incubated for 30 min at 37°C; the sample was then supplemented with 10 μl of proteinase K cocktail (0.5% SDS and proteinase K [20 U/ml; Sigma-Aldrich] in nuclease-free water), incubated for 30 min at 56°C and for 20 min at 96°C, and then cooled to room temperature at a thermal gradient of 3°C/min.

    Article Title: Linking Measures of Colony and Individual Honey Bee Health to Survival among Apiaries Exposed to Varying Agricultural Land Use
    Article Snippet: Contaminating DNA was removed using DNAse I in an 11 μL reaction containing 8 μL (1.5 μg) total RNA, 10 U DNAse I (Invitrogen) in appropriate buffer, 20 U RNAseout (Invitrogen), poly dT12-18 , and 2 mM dNTP. .. Quantitative PCR was performed in a 20 μl reaction mixture consisting of 1X SsoAdvanced™ SYBR® Green supermix (Bio-Rad), 0.2 μM of each primer, and 1μl (~100 ng) of cDNA template (see for primer sequences).

    Agarose Gel Electrophoresis:

    Article Title: Identification of Candidate Genes Associated with Leaf Senescence in Cultivated Sunflower (Helianthus annuus L.)
    Article Snippet: Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina). .. Purity and integrity of total RNA was determined by 260/280 nm ratio and the integrity was checked by electrophoresis in 1.5% agarose gel.

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR products were visualized under UV light after migration on an agarose gel stained using GelRed (Biotium, Hayward, CA, USA).

    In Vitro:

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: Paragraph title: In vitro methylation ... To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    Electrophoresis:

    Article Title: Identification of Candidate Genes Associated with Leaf Senescence in Cultivated Sunflower (Helianthus annuus L.)
    Article Snippet: Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina). .. Purity and integrity of total RNA was determined by 260/280 nm ratio and the integrity was checked by electrophoresis in 1.5% agarose gel.

    Ethanol Precipitation:

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: Hybridized probes were treated with a mixture of 0.15 μg RNase A, 0.01 unit RNase T2, and 1.5 units RNase T1 at 37°C for 1 h. The reaction was extracted twice with phenol/chloroform with further ethanol precipitation. .. To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C.

    Spectrophotometry:

    Article Title: Identification of Candidate Genes Associated with Leaf Senescence in Cultivated Sunflower (Helianthus annuus L.)
    Article Snippet: Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina). .. RNA concentration was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA).

    Irradiation:

    Article Title: Poly(ADP-ribose)-dependent chromatin unfolding facilitates the association of DNA-binding proteins with DNA at sites of damage
    Article Snippet: Paragraph title: Micropore irradiation assay ... Cells were fixed with 3% PFA at different time points post-irradiation, washed with 0.5% Triton X-100 in PBS for 10 min and then treated with 0.005 U/μl DNase I (Thermo Fisher Scientific) for 5 min.

    Concentration Assay:

    Article Title: Identification of Candidate Genes Associated with Leaf Senescence in Cultivated Sunflower (Helianthus annuus L.)
    Article Snippet: Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina). .. RNA concentration was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA).

    Article Title: Exploring gene networks in two sunflower lines with contrasting leaf senescence phenotype using a system biology approach
    Article Snippet: Genomic DNA was eliminated after treatment with DNase I for 20 min at room temperature using DNase I (Invitrogen, Argentina). .. The RNA concentration was measured using a Qubit fluorometer (Invitrogen, Argentina).

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: .. Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. To confirm the removal of contaminant DNA, polymerase chain reaction (PCR) targeting the 16S rRNA gene was performed using the universal primer pair 341f (5′-CCTACGGGNGGCWGCAG-3′) and 785r (5′-GACTACHVGGGTATCTAAKCC-3′) ( ).

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: To test the influence of extracellular nucleic acids on M. bovis cytotoxicity, mycoplasmas and EBL cells were co-cultivated in DMEM-based medium supplemented with increasing concentration of calf thymus DNA (UltraPure™ Calf Thymus DNA Solution, Invitrogen) and/or yeast tRNA (Invitrogen). .. Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C.

    Migration:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR products were visualized under UV light after migration on an agarose gel stained using GelRed (Biotium, Hayward, CA, USA).

    Staining:

    Article Title: Benchmarking protocols for the metagenomic analysis of stream biofilm viromes
    Article Snippet: Purification To eliminate contaminating eukaryotic, prokaryotic and extracellular nucleic acids, DNase I at a final concentration of 2.5 U/µL (Life Technologies, Darmstadt, Germany) and Tris buffer (100 mM Tris pH 7.5, five mM CaCl2 and 25 mM MgCl2 ) were added to the clarified supernatant and incubated at 37 °C (2 h). .. PCR products were visualized under UV light after migration on an agarose gel stained using GelRed (Biotium, Hayward, CA, USA).

    Article Title: The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA
    Article Snippet: To get rid of DNA oligonucleotide, the precipitate was diluted in 50 μL of the buffer for DNase I and treated with 5 units of DNase I (Fermentas) for 30 min at 37°C. .. Visualization of the bands was made by ethidium bromide staining.

    Article Title: Extracellular DNA: A Nutritional Trigger of Mycoplasma bovis Cytotoxicity
    Article Snippet: Cell monolayers were washed with Dulbecco’s phosphate-buffered saline (DPBS, Gibco) and stained for 60 min with 0.1% crystal violet solution in 10% ethanol. .. Calf thymus DNA treatment with Proteinase K (Qiagen), DNase I (Invitrogen), and RNase A (Invitrogen) was performed by 1 h incubation in DMEM medium and 15 min heating at 96°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher dnase i
    Dnase I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2866 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Thermo Fisher
    Average 90 stars, based on 2866 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher dnase i buffer
    Dnase I Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i buffer/product/Thermo Fisher
    Average 90 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    dnase i buffer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results