deoxynucleotide solution mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Deoxynucleotide Solution Mix
    Description:

    Catalog Number:
    N0447L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs deoxynucleotide solution mix
    Chemical structures of N 3-CMdT, O 4 -CMdT and <t>dT.</t> Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,

    https://www.bioz.com/result/deoxynucleotide solution mix/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide solution mix - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo"

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo

    Journal:

    doi: 10.1038/nprot.2015.094

    Chemical structures of N 3-CMdT, O 4 -CMdT and dT. Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,
    Figure Legend Snippet: Chemical structures of N 3-CMdT, O 4 -CMdT and dT. Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,

    Techniques Used: Inhibition, Mutagenesis, Derivative Assay

    Related Articles

    Clone Assay:

    Article Title: Genome Engineering Using Targeted Oligonucleotide Libraries and Functional Selection
    Article Snippet: Paragraph title: 2.3. Isolation of antibiotic resistant clones and MAMA-PCR screening ... Deoxynucleotide solution (dATP, dCTP, dGTP, and dTTP all at 2 mM) (New England Biolabs, Beverly, MA).

    Centrifugation:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Amplification:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: The amplification product (10 ng) was then logarithmically amplified for 14 cycles and the amplified DNA was purified and concentrated to 200 to 250 ng/mL using a QIAquick PCR purification kit (Qiagen). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs). .. The reactions (100 μL) were terminated with 10 μL of 0.5 M EDTA, pH 8.0, precipitated with 11.5 μL of 5 M NaCl and an equal volume of isopropanol, and resuspended in water.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8, and resuspended in 100 μl ddH2 O. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused. .. The dsDNA content of 1 μl PCR reaction was measured by Qubit® dsDNA HS Assay Kit ( , Invitrogen).

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: In the second round of amplification, primers Ap1 ( 5’- TCTTGATAGGGATCCGCTAGGATA-3’ ) and Ap2 ( 5’-ACCGTGGTTCTGGACTATCTGGATC-3’ ), were used to amplify a 497 bp fragment which identifies the EBV type-1 EBNA2 gene product, whereas primers Bp1 ( 5’-CATGGTAGCCTTAGGACATA-3’ ) and Bp2 ( 5’-AGACTTAGTTGATGCCCTAG-3’ ) amplified a 150 bp fragment that characterizes EBV type-2 EBNA2 gene product. .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: DNA recovered was eluted in sterile nuclease-free dH2 O and frozen at −20°C. .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]). .. The 27F primer sequence was 5′-AGAGTTTGATCMTGGCTCAG-3′, with a melting temperature ( Tm ) of 53.2°C, and the 1492R sequence was 5′-CGGTTACCTTGTTACGACTT-3′, with a Tm of 52.3°C.

    Whole Genome Amplification:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Isolated DNA fragments (target) and sonication-sheared Arabidopsis genomic DNA (reference) samples were subjected to whole-genome amplification using the GenomePlex WGA1 kit (Sigma-Aldrich) as described , omitting the initial random fragmentation step. .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Positive Control:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. PCR amplified products were separated on 2% agarose and visualized using UV gel documentation system (Bio-Rad, US).

    Synthesized:

    Article Title: NOVEL CHARACTERIZATION OF bEnd.3 CELLS THAT EXPRESS LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR-1
    Article Snippet: Superscript VILO™ cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) was used to generate the first strand cDNA. .. Taq DNApolymerase and deoxynucleotides were purchased from New England Biolab (Ipswich, MA, USA) and the primers were synthesized by Integrated DNA Technologies Inc. (Coralville, IA, USA). .. The details of the primer sequences used in this study are summarized in ( , , ).

    Article Title: Branched rolling circle amplification method for measuring serum circulating micro RNA levels for early breast cancer detection, et al. Branched rolling circle amplification method for measuring serum circulating microRNA levels for early breast cancer detection
    Article Snippet: 2.1 The phi29 DNA polymerase, adenosine 5′‐triphosphate solution (ATP), and deoxynucleotide solution mixture (dNTPs) were purchased from New England Biolabs (NEB, Beijing, China). .. 2.1 The phi29 DNA polymerase, adenosine 5′‐triphosphate solution (ATP), and deoxynucleotide solution mixture (dNTPs) were purchased from New England Biolabs (NEB, Beijing, China).

    Lambda DNA Preparation:

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    SYBR Green Assay:

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs). .. Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs).

    Microarray:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Paragraph title: Microarray Hybridization ... Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Incubation:

    Article Title: A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers
    Article Snippet: Afterwards, 1.25 µl of enzyme mix (Life Sciences NEC-1-24) was added to each reaction and the resulting 5.0 µl NASBA reactions were incubated for 30–180 min at 41 °C. .. Final concentrations of buffer components in each NASBA reaction: 13.2 mM MgCl2 (VWR 97062-848), 75 mM KCl (VWR BDH7296-0), 10 mM DTT (Sigma GE17-1318-01), 40 mM Tris-HCl pH 8.5 (VWR RLMB-005), 15% DMSO, 2 mM each ATP, UTP, and CTP, 1.5 mM GTP, 0.5 mM ITP, 1 mM each dNTP (New England Biolabs, N0447L), 0.25 µM each primer.

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: The amplification product (10 ng) was then logarithmically amplified for 14 cycles and the amplified DNA was purified and concentrated to 200 to 250 ng/mL using a QIAquick PCR purification kit (Qiagen). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs). .. The reactions (100 μL) were terminated with 10 μL of 0.5 M EDTA, pH 8.0, precipitated with 11.5 μL of 5 M NaCl and an equal volume of isopropanol, and resuspended in water.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Beads were washed three times with 500 μl M-280 high salt wash and twice with 500 μl M-280 low salt wash. Beads were then resuspended with Trizol LS and RNA was isolated. .. Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Reverse transcribed samples were volume up to 26 μl with H2 O and 2 μl was set aside and serial-diluted to test PCR conditions as described in ( ).

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O. .. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    Article Title: Activity and Transcriptional Regulation of Bacterial Protein-Like Glycerol-3-Phosphate Dehydrogenase of the Haloarchaea in Haloferax volcanii
    Article Snippet: After several rinses with deionized water, the gel was incubated (45 min) in 10× saline sodium citrate (SSC) (where 20× SSC is 3 M NaCl plus 0.3 M sodium citrate [pH 7.0]). .. PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Modification:

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: DNA methylome libraries were prepared using a modified snmC-seq protocol adapted for bulk DNA samples ( ). .. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    RNA Binding Assay:

    Article Title: RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization
    Article Snippet: Specifically, all surfaces and pipettes should be cleaned daily using RNase removal solutions and separate stocks of all buffers should be kept solely for RNA work. .. The following protocols will require the following reagents 20X EvaGreen (Biotium; 31000) 2X Phusion hot start polymerase master mix (New England Biolabs; M0536S) Tris-EDTA (TE) pH 8 buffer (Ambion; AM9849) DNA binding buffer (Zymo Research; D4004-1-L) DNA wash buffer (Zymo Research; C1016-50) Oligo binding buffer (Zymo Research; D4060-1-40) 100-μg capacity silicon columns (Spin-V; Zymo Research; D4003-2-48) RNA binding buffer (Optional; Zymo Research; R1013-2-100) RNA prep buffer (Optional; Zymo Research; R1060-2-100) RNA wash buffer (Optional; Zymo Research; R1003-3-24) Quick HiScribe T7 polymerase kit (New England Biolabs; E2050S) RNasin plus (Promega; N2611) Maxima H- reverse transcriptase (ThermoScientific; EP0751) 10 mM mix of dNTPs (New England Biolabs; N0447S) 0.5 M EDTA (Ambion; AM9261) 1 N NaOH (VWR; JT5635-2) Nuclease-free water (Ambion; AM9932) 100% Ethanol (KOPTEC; VWR; 89125-186) D/RNAaseFree (VWR; 47751-044) 1.5 mL LoBind tubes (Eppendorf; 022431021) PCR tubes The following protocols will require the following equipment Table top centrifuge qPCR machine or thermocycler 37 °C incubator or water bath 50 °C water bath 95 °C water bath Vacuum manifold (optional) Gel electrophoresis equipment for poly-acrylamide gels (optional) Vacuum concentrator (optional) .. The first step in this protocol is to use PCR to amplify template molecules for the in vitro transcription.

    Derivative Assay:

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: To further confirm the purity of the stocks from which lyophilized cells were derived, 16S rRNA gene sequences were recovered and analyzed from DNA extracted from these experimental stocks. .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]).

    Hybridization:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Paragraph title: Microarray Hybridization ... Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Article Title: Activity and Transcriptional Regulation of Bacterial Protein-Like Glycerol-3-Phosphate Dehydrogenase of the Haloarchaea in Haloferax volcanii
    Article Snippet: PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM. .. PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM.

    Sequencing:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Paragraph title: Preparation of sequencing libraries ... The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Libraries were purified using a MinElute PCR Purification Kit (QIAGEN 28004), verified to be free of radiation, and size-selected for 140–400 bp using a BluePippin 2% Agarose Gel Cassette (Sage Science BDF2010).

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: Paragraph title: Methylome sequencing ... The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: Paragraph title: (iii) DNA extraction, PCR amplification, and sequencing of 16S rRNA genes. ... PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Ligation:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Transferring:

    Article Title: Branched rolling circle amplification method for measuring serum circulating micro RNA levels for early breast cancer detection, et al. Branched rolling circle amplification method for measuring serum circulating microRNA levels for early breast cancer detection
    Article Snippet: 2.1 The phi29 DNA polymerase, adenosine 5′‐triphosphate solution (ATP), and deoxynucleotide solution mixture (dNTPs) were purchased from New England Biolabs (NEB, Beijing, China). .. The oligonucleotides used in this study were synthesized by Invitrogen Biotechnology Co., Ltd (Shanghai, China).

    Northern Blot:

    Article Title: Activity and Transcriptional Regulation of Bacterial Protein-Like Glycerol-3-Phosphate Dehydrogenase of the Haloarchaea in Haloferax volcanii
    Article Snippet: Paragraph title: Northern blot analysis. ... PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM.

    Generated:

    Article Title: Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications
    Article Snippet: CRITICAL Part vectors are not required if parts will be generated by PCR or synthesis. .. Distilled, deionized, sterile H2 O (ddH2 O) Magnesium chloride (MgCl2 , anhydrous; Sigma-Aldrich, cat. no. M8266-100G) DL-Dithiothreitol (DTT; Sigma-Aldrich, cat. no. D0632-10G) dNTP mix (10 mM each; New England Biolabs, cat. no. N0447S) Poly(ethylene glycol) (PEG, avg. mol. wt.

    other:

    Article Title: Dissecting the Contribution of Release Factor Interactions to Amber Stop Codon Reassignment Efficiencies of the Methanocaldococcus jannaschii Orthogonal Pair
    Article Snippet: ATP was purchased from Fisher (BP413-25) (Waltham, MA, USA) and dNTPs were purchased form New England Biolabs (N0447S) (Ipswich, MA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: An aliquot of the cDNA was used for reverse transcription-PCR (RT-PCR) with primers specific for PTPRO (PTPROt-F: GGGGATGCTTCACCTGCTTA and PTPRO-R: ACCATTGTTGAGACGGCTATGAACG) or the internal control 18S rRNA (18S-F: TCAAGAACGAAAGTCGGAGG and 18S-R: GGACATCTAAGGGCATCACA). .. Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs).

    Sonication:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Isolated DNA fragments (target) and sonication-sheared Arabidopsis genomic DNA (reference) samples were subjected to whole-genome amplification using the GenomePlex WGA1 kit (Sigma-Aldrich) as described , omitting the initial random fragmentation step. .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Binding Assay:

    Article Title: RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization
    Article Snippet: Specifically, all surfaces and pipettes should be cleaned daily using RNase removal solutions and separate stocks of all buffers should be kept solely for RNA work. .. The following protocols will require the following reagents 20X EvaGreen (Biotium; 31000) 2X Phusion hot start polymerase master mix (New England Biolabs; M0536S) Tris-EDTA (TE) pH 8 buffer (Ambion; AM9849) DNA binding buffer (Zymo Research; D4004-1-L) DNA wash buffer (Zymo Research; C1016-50) Oligo binding buffer (Zymo Research; D4060-1-40) 100-μg capacity silicon columns (Spin-V; Zymo Research; D4003-2-48) RNA binding buffer (Optional; Zymo Research; R1013-2-100) RNA prep buffer (Optional; Zymo Research; R1060-2-100) RNA wash buffer (Optional; Zymo Research; R1003-3-24) Quick HiScribe T7 polymerase kit (New England Biolabs; E2050S) RNasin plus (Promega; N2611) Maxima H- reverse transcriptase (ThermoScientific; EP0751) 10 mM mix of dNTPs (New England Biolabs; N0447S) 0.5 M EDTA (Ambion; AM9261) 1 N NaOH (VWR; JT5635-2) Nuclease-free water (Ambion; AM9932) 100% Ethanol (KOPTEC; VWR; 89125-186) D/RNAaseFree (VWR; 47751-044) 1.5 mL LoBind tubes (Eppendorf; 022431021) PCR tubes The following protocols will require the following equipment Table top centrifuge qPCR machine or thermocycler 37 °C incubator or water bath 50 °C water bath 95 °C water bath Vacuum manifold (optional) Gel electrophoresis equipment for poly-acrylamide gels (optional) Vacuum concentrator (optional) .. The first step in this protocol is to use PCR to amplify template molecules for the in vitro transcription.

    ChIP-sequencing:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    DNA Extraction:

    Article Title: Comprehensive High-Throughput RNA Sequencing Analysis Reveals Contamination of Multiple Nasopharyngeal Carcinoma Cell Lines with HeLa Cell Genomes
    Article Snippet: Paragraph title: Genomic DNA isolation and genotyping of the HeLa-specific L1 retrotransposon marker. ... To detect the L1 retotransposon marker, 500 ng of the genomic DNA was used in a 50-μl reaction volume that included 1× standard Taq reaction buffer (NEB catalog no. B9014), 500 nM each primer (VM164A, VM164B, and RB164K2), 400 μM deoxynucleotide solution mix (NEB catalog no. N0447), and 2.5 U of Taq DNA polymerase (NEB catalog no. M0273).

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: Paragraph title: (iii) DNA extraction, PCR amplification, and sequencing of 16S rRNA genes. ... PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]).

    Nucleic Acid Electrophoresis:

    Article Title: RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization
    Article Snippet: Specifically, all surfaces and pipettes should be cleaned daily using RNase removal solutions and separate stocks of all buffers should be kept solely for RNA work. .. The following protocols will require the following reagents 20X EvaGreen (Biotium; 31000) 2X Phusion hot start polymerase master mix (New England Biolabs; M0536S) Tris-EDTA (TE) pH 8 buffer (Ambion; AM9849) DNA binding buffer (Zymo Research; D4004-1-L) DNA wash buffer (Zymo Research; C1016-50) Oligo binding buffer (Zymo Research; D4060-1-40) 100-μg capacity silicon columns (Spin-V; Zymo Research; D4003-2-48) RNA binding buffer (Optional; Zymo Research; R1013-2-100) RNA prep buffer (Optional; Zymo Research; R1060-2-100) RNA wash buffer (Optional; Zymo Research; R1003-3-24) Quick HiScribe T7 polymerase kit (New England Biolabs; E2050S) RNasin plus (Promega; N2611) Maxima H- reverse transcriptase (ThermoScientific; EP0751) 10 mM mix of dNTPs (New England Biolabs; N0447S) 0.5 M EDTA (Ambion; AM9261) 1 N NaOH (VWR; JT5635-2) Nuclease-free water (Ambion; AM9932) 100% Ethanol (KOPTEC; VWR; 89125-186) D/RNAaseFree (VWR; 47751-044) 1.5 mL LoBind tubes (Eppendorf; 022431021) PCR tubes The following protocols will require the following equipment Table top centrifuge qPCR machine or thermocycler 37 °C incubator or water bath 50 °C water bath 95 °C water bath Vacuum manifold (optional) Gel electrophoresis equipment for poly-acrylamide gels (optional) Vacuum concentrator (optional) .. The first step in this protocol is to use PCR to amplify template molecules for the in vitro transcription.

    IA:

    Article Title: NOVEL CHARACTERIZATION OF bEnd.3 CELLS THAT EXPRESS LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR-1
    Article Snippet: Superscript VILO™ cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) was used to generate the first strand cDNA. .. Taq DNApolymerase and deoxynucleotides were purchased from New England Biolab (Ipswich, MA, USA) and the primers were synthesized by Integrated DNA Technologies Inc. (Coralville, IA, USA). .. The details of the primer sequences used in this study are summarized in ( , , ).

    Methylation:

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    Isolation:

    Article Title: NOVEL CHARACTERIZATION OF bEnd.3 CELLS THAT EXPRESS LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR-1
    Article Snippet: Paragraph title: RNA Isolation and PCR ... Taq DNApolymerase and deoxynucleotides were purchased from New England Biolab (Ipswich, MA, USA) and the primers were synthesized by Integrated DNA Technologies Inc. (Coralville, IA, USA).

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Isolated DNA fragments (target) and sonication-sheared Arabidopsis genomic DNA (reference) samples were subjected to whole-genome amplification using the GenomePlex WGA1 kit (Sigma-Aldrich) as described , omitting the initial random fragmentation step. .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: Paragraph title: RNA isolation and reverse transcription-PCR ... Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs).

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Beads were washed three times with 500 μl M-280 high salt wash and twice with 500 μl M-280 low salt wash. Beads were then resuspended with Trizol LS and RNA was isolated. .. Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C.

    Article Title: Genome Engineering Using Targeted Oligonucleotide Libraries and Functional Selection
    Article Snippet: Paragraph title: 2.3. Isolation of antibiotic resistant clones and MAMA-PCR screening ... Deoxynucleotide solution (dATP, dCTP, dGTP, and dTTP all at 2 mM) (New England Biolabs, Beverly, MA).

    Article Title: Fluid reabsorption in proximal convoluted tubules of mice with gene deletions of claudin-2 and/or aquaporin1
    Article Snippet: Kidney cortex was homogenized, and RNA was isolated using the Qiagen RNeasy mini kit (no. 74104) with the DNase treatment using the Qiagen RNase-free DNase 1 kit (no. 79254). .. A mixture of 0.1 M DTT, 5× first-strand buffer, and superscript II reverse transcriptase (Invitrogen 18064–014), 10 mM NTP (NEB no. N0447S), and Protector RNase Inhibitor (Roche no. 03335402001) was added to the sample and brought to 42° for 45 min, 70° for 10 min, and then stored at 4°.

    Article Title: Comprehensive High-Throughput RNA Sequencing Analysis Reveals Contamination of Multiple Nasopharyngeal Carcinoma Cell Lines with HeLa Cell Genomes
    Article Snippet: Genomic DNA was isolated from freshly thawed NPC and HeLa cell lines using the DNeasy Blood & Tissue kit (Qiagen catalog no. 69504) by following the manufacturer's protocol. .. To detect the L1 retotransposon marker, 500 ng of the genomic DNA was used in a 50-μl reaction volume that included 1× standard Taq reaction buffer (NEB catalog no. B9014), 500 nM each primer (VM164A, VM164B, and RB164K2), 400 μM deoxynucleotide solution mix (NEB catalog no. N0447), and 2.5 U of Taq DNA polymerase (NEB catalog no. M0273).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Genomic DNA was isolated from 10–20 mL of YPD-grown cells using Qiagen Genomic-tip 100/G columns as described by the manufacturer. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Labeling:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: The amplification product (10 ng) was then logarithmically amplified for 14 cycles and the amplified DNA was purified and concentrated to 200 to 250 ng/mL using a QIAquick PCR purification kit (Qiagen). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs). .. The reactions (100 μL) were terminated with 10 μL of 0.5 M EDTA, pH 8.0, precipitated with 11.5 μL of 5 M NaCl and an equal volume of isopropanol, and resuspended in water.

    Article Title: Activity and Transcriptional Regulation of Bacterial Protein-Like Glycerol-3-Phosphate Dehydrogenase of the Haloarchaea in Haloferax volcanii
    Article Snippet: RNA molecular mass standards labeled with 2′ dUTP coupled by an 11-atom spacer to digoxigenin (DIG-11-dUTP) (0.3- to 6.9-kb RNA ladder; Roche Molecular Biochemicals, Indianapolis, IN) were included. .. PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM.

    Purification:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: The amplification product (10 ng) was then logarithmically amplified for 14 cycles and the amplified DNA was purified and concentrated to 200 to 250 ng/mL using a QIAquick PCR purification kit (Qiagen). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Final PCR reactions were 50 μl and contained the remaining sample, 0.05 U/μl Phusion High-Fidelity DNA Polymerase (NEB M0530L), 1X HF buffer, 1 M betaine (Sigma B0300), 2.5 μM dNTP mix, 0.25 μM RP1 DNA primer and 0.25 μM barcoded index primer (either RPI-6 [CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA] or RPI-12 [CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA]).

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O.

    Article Title: Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications
    Article Snippet: Distilled, deionized, sterile H2 O (ddH2 O) Magnesium chloride (MgCl2 , anhydrous; Sigma-Aldrich, cat. no. M8266-100G) DL-Dithiothreitol (DTT; Sigma-Aldrich, cat. no. D0632-10G) dNTP mix (10 mM each; New England Biolabs, cat. no. N0447S) Poly(ethylene glycol) (PEG, avg. mol. wt. .. Distilled, deionized, sterile H2 O (ddH2 O) Magnesium chloride (MgCl2 , anhydrous; Sigma-Aldrich, cat. no. M8266-100G) DL-Dithiothreitol (DTT; Sigma-Aldrich, cat. no. D0632-10G) dNTP mix (10 mM each; New England Biolabs, cat. no. N0447S) Poly(ethylene glycol) (PEG, avg. mol. wt.

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]). .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Polymerase Chain Reaction:

    Article Title: NOVEL CHARACTERIZATION OF bEnd.3 CELLS THAT EXPRESS LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR-1
    Article Snippet: Paragraph title: RNA Isolation and PCR ... Taq DNApolymerase and deoxynucleotides were purchased from New England Biolab (Ipswich, MA, USA) and the primers were synthesized by Integrated DNA Technologies Inc. (Coralville, IA, USA).

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: The amplification product (10 ng) was then logarithmically amplified for 14 cycles and the amplified DNA was purified and concentrated to 200 to 250 ng/mL using a QIAquick PCR purification kit (Qiagen). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8, and resuspended in 100 μl ddH2 O. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused. .. The dsDNA content of 1 μl PCR reaction was measured by Qubit® dsDNA HS Assay Kit ( , Invitrogen).

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: The qualitative PCR (cell lines) was done by using cDNA equivalent to 150 ng (for 18S rRNA) and 300 ng (for PTPRO) of RNA. .. Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs).

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: PCR reaction of 50 μl was prepared in 0.2 ml microcentrifuge tube using HotStarTaq DNA Polymerase kit (Catalog # 203203, Qiagen, Germany). .. Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. For the first round of PCR using E2p1 and E2p2 primers, amplification conditions were as follows: after an initial heat activation step of 15 min at 95°C, 40 cycles of amplification were performed: denaturation for 5 min. at 95°C, annealing for 1 min. at 58°C, and extension for 1 min. at 72°C, followed by a final extension step of 10 min. at 72°C.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Reverse transcribed samples were volume up to 26 μl with H2 O and 2 μl was set aside and serial-diluted to test PCR conditions as described in ( ).

    Article Title: Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications
    Article Snippet: For PCR only the appropriate template DNA template solution is required. .. Distilled, deionized, sterile H2 O (ddH2 O) Magnesium chloride (MgCl2 , anhydrous; Sigma-Aldrich, cat. no. M8266-100G) DL-Dithiothreitol (DTT; Sigma-Aldrich, cat. no. D0632-10G) dNTP mix (10 mM each; New England Biolabs, cat. no. N0447S) Poly(ethylene glycol) (PEG, avg. mol. wt.

    Article Title: Genome Engineering Using Targeted Oligonucleotide Libraries and Functional Selection
    Article Snippet: Polymerase chain reaction (PCR) buffer (10×): 100 mM KCl, 60 mM (NH4 )SO4 , 20 mM MgSO4 , 200 mM Tris-HCl (pH 8.9), 1% Triton X-100. .. Deoxynucleotide solution (dATP, dCTP, dGTP, and dTTP all at 2 mM) (New England Biolabs, Beverly, MA).

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: DNA recovered was eluted in sterile nuclease-free dH2 O and frozen at −20°C. .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]). .. The 27F primer sequence was 5′-AGAGTTTGATCMTGGCTCAG-3′, with a melting temperature ( Tm ) of 53.2°C, and the 1492R sequence was 5′-CGGTTACCTTGTTACGACTT-3′, with a Tm of 52.3°C.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization
    Article Snippet: Specifically, all surfaces and pipettes should be cleaned daily using RNase removal solutions and separate stocks of all buffers should be kept solely for RNA work. .. The following protocols will require the following reagents 20X EvaGreen (Biotium; 31000) 2X Phusion hot start polymerase master mix (New England Biolabs; M0536S) Tris-EDTA (TE) pH 8 buffer (Ambion; AM9849) DNA binding buffer (Zymo Research; D4004-1-L) DNA wash buffer (Zymo Research; C1016-50) Oligo binding buffer (Zymo Research; D4060-1-40) 100-μg capacity silicon columns (Spin-V; Zymo Research; D4003-2-48) RNA binding buffer (Optional; Zymo Research; R1013-2-100) RNA prep buffer (Optional; Zymo Research; R1060-2-100) RNA wash buffer (Optional; Zymo Research; R1003-3-24) Quick HiScribe T7 polymerase kit (New England Biolabs; E2050S) RNasin plus (Promega; N2611) Maxima H- reverse transcriptase (ThermoScientific; EP0751) 10 mM mix of dNTPs (New England Biolabs; N0447S) 0.5 M EDTA (Ambion; AM9261) 1 N NaOH (VWR; JT5635-2) Nuclease-free water (Ambion; AM9932) 100% Ethanol (KOPTEC; VWR; 89125-186) D/RNAaseFree (VWR; 47751-044) 1.5 mL LoBind tubes (Eppendorf; 022431021) PCR tubes The following protocols will require the following equipment Table top centrifuge qPCR machine or thermocycler 37 °C incubator or water bath 50 °C water bath 95 °C water bath Vacuum manifold (optional) Gel electrophoresis equipment for poly-acrylamide gels (optional) Vacuum concentrator (optional) .. The first step in this protocol is to use PCR to amplify template molecules for the in vitro transcription.

    Nested PCR:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Paragraph title: EBV genotyping by nested PCR of the EBNA-2 gene ... Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA).

    Software:

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs). .. The cycling conditions were as follows: denaturation at 94°C, annealing at 54.5°C (for PTPRO) or 65°C (for 18S rRNA) and extension at 72°C with a total of 32 cycles (for PTPRO) and 25 cycles (for 18S rRNA).

    Real-time Polymerase Chain Reaction:

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs). .. The PCR products were separated on 1.5% agarose stained with ethidium bromide and imaged under UV light using Kodak Digital Science 1D software.

    Article Title: RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization
    Article Snippet: Specifically, all surfaces and pipettes should be cleaned daily using RNase removal solutions and separate stocks of all buffers should be kept solely for RNA work. .. The following protocols will require the following reagents 20X EvaGreen (Biotium; 31000) 2X Phusion hot start polymerase master mix (New England Biolabs; M0536S) Tris-EDTA (TE) pH 8 buffer (Ambion; AM9849) DNA binding buffer (Zymo Research; D4004-1-L) DNA wash buffer (Zymo Research; C1016-50) Oligo binding buffer (Zymo Research; D4060-1-40) 100-μg capacity silicon columns (Spin-V; Zymo Research; D4003-2-48) RNA binding buffer (Optional; Zymo Research; R1013-2-100) RNA prep buffer (Optional; Zymo Research; R1060-2-100) RNA wash buffer (Optional; Zymo Research; R1003-3-24) Quick HiScribe T7 polymerase kit (New England Biolabs; E2050S) RNasin plus (Promega; N2611) Maxima H- reverse transcriptase (ThermoScientific; EP0751) 10 mM mix of dNTPs (New England Biolabs; N0447S) 0.5 M EDTA (Ambion; AM9261) 1 N NaOH (VWR; JT5635-2) Nuclease-free water (Ambion; AM9932) 100% Ethanol (KOPTEC; VWR; 89125-186) D/RNAaseFree (VWR; 47751-044) 1.5 mL LoBind tubes (Eppendorf; 022431021) PCR tubes The following protocols will require the following equipment Table top centrifuge qPCR machine or thermocycler 37 °C incubator or water bath 50 °C water bath 95 °C water bath Vacuum manifold (optional) Gel electrophoresis equipment for poly-acrylamide gels (optional) Vacuum concentrator (optional) .. The first step in this protocol is to use PCR to amplify template molecules for the in vitro transcription.

    Negative Control:

    Article Title: Prevalence and molecular profiling of Epstein Barr virus (EBV) among healthy blood donors from different nationalities in Qatar
    Article Snippet: Reaction mix contained 0.25 μl of HotStarTaq DNA Polymerase, 10 μl of 5x Q-Solution, 5 μl of 10x PCR buffer which already contained 15mM MgCl2 , and 1 μl of 10mM dNTP's (Catalog # N0447S, New England Biolabs, USA). .. PCR amplified products were separated on 2% agarose and visualized using UV gel documentation system (Bio-Rad, US).

    Selection:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Agarose Gel Electrophoresis:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused. .. In rare cases of lower DNA concentrations, two additional amplification cycles were added and DNA concentration controlled again by Qubit until resulting DNA concentration was > 3 ng/μl.

    Article Title: Oxidative stress rapidly stabilizes promoter-proximal paused Pol II across the human genome
    Article Snippet: Pellets were resuspended in 10 μl 2X RT primer mix (5 μM RP1 DNA primer [AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA] and 1 mM dNTP mix [NEB N0447L]), incubated at 65°C for 5 min, snap-cooled on ice, and incubated in a thermal cycler with 10 μl 2X SSIV reverse transcriptase mix (20 U/μl SuperScript IV [Invitrogen 18090050], 2X SSIV buffer, 10 mM DTT, and 2 U/μl SUPERase-In) for 15 min at 45°C, 40 min at 50°C, 10 min at 55°C, and 15 min at 70°C. .. Final PCR reactions were 50 μl and contained the remaining sample, 0.05 U/μl Phusion High-Fidelity DNA Polymerase (NEB M0530L), 1X HF buffer, 1 M betaine (Sigma B0300), 2.5 μM dNTP mix, 0.25 μM RP1 DNA primer and 0.25 μM barcoded index primer (either RPI-6 [CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA] or RPI-12 [CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA]).

    Electrophoresis:

    Article Title: Activity and Transcriptional Regulation of Bacterial Protein-Like Glycerol-3-Phosphate Dehydrogenase of the Haloarchaea in Haloferax volcanii
    Article Snippet: Total RNA (10 μg per lane) was denatured and fractionated by electrophoresis (4 h, 50 V) using formaldehyde-0.8% (wt/vol) agarose gels in 1× morpholinepropanesulfonic acid (MOPS) buffer (20 mM MOPS [pH 7.0], 5 mM sodium acetate, 1 mM EDTA) according to standard procedures ( ). .. PCRs for the generation of the probes were performed with the primers listed in Table S2 in the supplemental material and Taq DNA polymerase according to the supplier's recommendations with the following modifications: 3% (vol/vol) DMSO was included, and the 1× DIG deoxyribonucleoside triphosphate mixture (catalog no. 1277065; Roche) was supplemented with a solution of mixed deoxynucleotides (New England Biolabs) to 0.1 mM.

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]). .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]).

    Spectrophotometry:

    Article Title: Comprehensive High-Throughput RNA Sequencing Analysis Reveals Contamination of Multiple Nasopharyngeal Carcinoma Cell Lines with HeLa Cell Genomes
    Article Snippet: DNA samples were quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). .. To detect the L1 retotransposon marker, 500 ng of the genomic DNA was used in a 50-μl reaction volume that included 1× standard Taq reaction buffer (NEB catalog no. B9014), 500 nM each primer (VM164A, VM164B, and RB164K2), 400 μM deoxynucleotide solution mix (NEB catalog no. N0447), and 2.5 U of Taq DNA polymerase (NEB catalog no. M0273).

    Produced:

    Article Title: In Vivo Mapping of Arabidopsis Scaffold/Matrix Attachment Regions Reveals Link to Nucleosome-Disfavoring Poly(dA:dT) Tracts
    Article Snippet: Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs). .. Amplified target and reference samples (1.5 μg) were each labeled with Cy5 and Cy3 fluorescent dye–labeled 9-mer (TriLink Biotechnologies) and incubated 3 h (37°C) with 100 units (exo-) Klenow fragment (New England Biolabs) and deoxynucleotide triphosphate mix (10 mM each in Milli-Q water, pH 5.0; New England Biolabs).

    Concentration Assay:

    Article Title: Visualizing recombination intermediates with single-stranded DNA curtains
    Article Snippet: Replication is initiated by the addition of Φ 29 DNA polymerase in the presence of deoxynucleotide (dNTP, N0447L NEB), resulting in the production of a long ssDNA molecule comprised of repeating units of M13mp18. .. Replication is initiated by the addition of Φ 29 DNA polymerase in the presence of deoxynucleotide (dNTP, N0447L NEB), resulting in the production of a long ssDNA molecule comprised of repeating units of M13mp18.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: NEBNext Adaptor (0.05 μM final concentration, E7335L and E750L, NEB) was ligated to A-tailed DNA with T4-Ligase (12 U, M0202L, NEB) in 30 μl 1x T4 Ligase reaction Buffer (B0202S, NEB) shaking at 16 °C overnight, then cleaved by addition of USER™ Enzyme (3 U, M5505L, NEB) for 15 min at 37 °C. .. The blunted, A-tailed, Adaptor ligated, bead bound nucleosomal DNA was eluted from beads and amplified by PCR in one step (NEBNext Index 1-16, 18-23, 25 or 27 Primer for Illumina (0.5 μM, E7335L and E750L, NEB) and NEBNext Universal PCR Primer for Illumina (0.5 μM, E7335L and E750L, NEB), Phusion® High-Fidelity DNA Polymerase (1 U, M0530L, NEB), and Deoxynucleotide (dNTP) Solution Mix (2.5 mM, N0047S, NEB) in a final volume of 50 μl Phusion® HF Buffer (1x M0530L, NEB) with the following protocol: 72 °C for 20 min (reverse crosslinking), 95 °C for 5 min (addition of 0.5 μl polymerase, hot start), 12 cycles (95°C for 15 s, 65 °C for 30 s, 72 °C for 30 s) and paused.

    Article Title: Global and Targeted Lipid Analysis of Gemmata obscuriglobus Reveals the Presence of Lipopolysaccharide, a Signature of the Classical Gram-Negative Outer Membrane
    Article Snippet: DNA recovered was eluted in sterile nuclease-free dH2 O and frozen at −20°C. .. PCR amplification of the 16S rRNA gene was completed in a 50-μl reaction mixture, utilizing 1.25 U of Taq DNA polymerase (catalog no. M0273S; NEB), 200 μM deoxynucleoside triphosphate (dNTP) solution mixture (catalog no. N0447S; NEB), 9.4, 10.4, and 10.8 ng of G. obscuriglobus DNA template, and a 0.2 μM concentration of the 27F and 1492R 16S rRNA primers (Integrated DNA Technologies [IDT]). .. The 27F primer sequence was 5′-AGAGTTTGATCMTGGCTCAG-3′, with a melting temperature ( Tm ) of 53.2°C, and the 1492R sequence was 5′-CGGTTACCTTGTTACGACTT-3′, with a Tm of 52.3°C.

    Liquid Chromatography with Mass Spectroscopy:

    Article Title: Association of Oseltamivir Activation with Gender and Carboxylesterase 1 Genetic Polymorphisms
    Article Snippet: Ritalinic acid, LC–MS grade methanol, acetonitrile and formic acid were all purchased from Sigma–Aldrich (St. Louis, MO, USA). .. Taq DNA polymerase with standard Taq buffer and deoxynucleotide (dNTP) solution mix were obtained from New England Biolabs (Ipswich, MA, USA).

    Marker:

    Article Title: Comprehensive High-Throughput RNA Sequencing Analysis Reveals Contamination of Multiple Nasopharyngeal Carcinoma Cell Lines with HeLa Cell Genomes
    Article Snippet: DNA samples were quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). .. To detect the L1 retotransposon marker, 500 ng of the genomic DNA was used in a 50-μl reaction volume that included 1× standard Taq reaction buffer (NEB catalog no. B9014), 500 nM each primer (VM164A, VM164B, and RB164K2), 400 μM deoxynucleotide solution mix (NEB catalog no. N0447), and 2.5 U of Taq DNA polymerase (NEB catalog no. M0273). .. Amplification was carried out on a Mastercycler ep (Eppendorf, Hamburg, Germany), using the following conditions: 96°C for 30 s, followed by 30 cycles of 96°C for 30 s, 54°C for 30 s, and 72°C for 1 min, and then 1 cycle of 72°C for 5 min. Thirty microliters of PCR product was run on a 1% agarose gel and visualized by ethidium bromide staining on a Bio-Rad gel documentation system.

    Staining:

    Article Title: Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia
    Article Snippet: Each 25 μL reaction mix consisted of 1× ThermoPol buffer (New England Biolabs), 0.2 mmol/L of deoxynucleo-tide triphosphate, 10 pmol of each primer, and 1 unit of Taq DNA polymerase (New England Biolabs). .. The cycling conditions were as follows: denaturation at 94°C, annealing at 54.5°C (for PTPRO) or 65°C (for 18S rRNA) and extension at 72°C with a total of 32 cycles (for PTPRO) and 25 cycles (for 18S rRNA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs deoxynucleotide solution mix
    Chemical structures of N 3-CMdT, O 4 -CMdT and <t>dT.</t> Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,
    Deoxynucleotide Solution Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide solution mix/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide solution mix - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Chemical structures of N 3-CMdT, O 4 -CMdT and dT. Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,

    Journal:

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo

    doi: 10.1038/nprot.2015.094

    Figure Lengend Snippet: Chemical structures of N 3-CMdT, O 4 -CMdT and dT. Adapted from You et al , Transcriptional inhibition and mutagenesis induced by N -nitroso compound–derived carboxymethylated thymidine adducts in DNA. Nucleic Acids Res . (2015) 43 , 1012–1018,

    Article Snippet: Phusion high-fidelity (HF) DNA polymerase, supplied with 5× Phusion HF or GC buffer (New England BioLabs, cat. no. M0530L) Deoxynucleoside triphosphate (dNTP) solution mix (New England BioLabs, cat. no. N0447S) E.Z.N.A.

    Techniques: Inhibition, Mutagenesis, Derivative Assay