deoxynucleoside triphosphate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Thermo Fisher deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/Thermo Fisher
    Average 98 stars, based on 122 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-02
    98/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: Paragraph title: DNA amplification and cloning of the groES gene. ... Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template.

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Paragraph title: PCR amplification, Cloning, and Sequencing ... Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid.

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: Paragraph title: PCR amplification and cloning of partial groEL gene. ... The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer.

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer. .. PCR products obtained from 100 randomly selected clones by using M13 forward and reverse primers were digested with HAE3 and MSP1 (as recommended by the manufacturer), and this analysis resulted in 15 separate restriction fragment length polymorphism groups.

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. .. The PCR products were cloned into pT7Blue (Novagen, Madison, Wis.) and sequenced with chain terminators ( ).

    Centrifugation:

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Cellular RNA was isolated following guanidinium thiocyanate lysis and CsCl centrifugation. cDNA was prepared with avian myeloblastosis virus reverse transcriptase (10 U; Promega Corp.) in 1× avian myeloblastosis virus buffer containing 1 mM deoxynucleoside triphosphate, 30 U of RNasin, and 10 pmol of degenerate oligonucleotide YMDDB in a total volume of 30 μl. .. Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Amplification:

    Article Title: Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis
    Article Snippet: The 5′ UTR of the HCV RNA genome was amplified by using a OneStep reverse transcription (RT)-PCR kit (Qiagen), as stated in the Qiagen protocol. .. The RT-PCR mixture contained the OneStep 1× enzyme, OneStep 1× buffer, 0.32 mmol of each deoxynucleoside triphosphate (dATP, dCTP, and dGTP) per liter, 0.64 mmol of dUTP (GeneAmp; Applied Biosystems, Foster City, Calif.) per liter, 1 mmol of MgCl2 per liter, 0.5 μmol of each primer (CTGCGGAACCGGTGAGTACACC and ATCCAAGAAAGGACCC) per liter, 0.01 U of uracil-DNA glycosylase (Roche Molecular) per μl, and 0.3 U of RNase inhibitor (Roche Molecular) per μl.

    Article Title: Quantification of Clostridium botulinum Toxin Gene Expression by Competitive Reverse Transcription-PCR
    Article Snippet: .. A 5-μl portion of the resulting cDNA was amplified by PCR by using a 100-μl mixture which contained 100 pmol of S1 forward primer per μl, 100 pmol of S1 reverse primer per μl, each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , and 2.5 U of Taq DNA polymerase (Gibco BRL). .. Each PCR cycle consisted of denaturation for 1 min at 94°C, annealing for 30 s at 40°C, and extension for 30 s at 72°C; 31 such cycles were followed by a final extension cycle consisting of 72°C for 10 min.

    Article Title: Detection of Toxoplasma gondii Oocysts in Water Sample Concentrates by Real-Time PCR ▿
    Article Snippet: Each 100 μl of PCR solution contained 2.0 μl of DNA, 500 nM primers, 0.2 mM deoxynucleoside triphosphate (Applied Biosystems), 3.0 mM MgCl, 1× GeneAmp 10× PCR buffer (Applied Biosystems), and 2.5 U of Taq DNA polymerase (Promega). .. PCR amplification consisted of denaturation at 94°C for 4 min; 35 cycles of 94°C for 45 s, 52°C (B1-Burg primers), 55°C (529 primers), or 61°C (B1-Costa primers) for 45 s, and 72°C for 1 min; and an extension of 72°C for 10 min. PCR products were visualized by 1.5% agarose gel electrophoresis.

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: Since PEANT1 and PEANT2 produced amplification products at 56°C but not at 72°C, it was thus possible to separate the activity of the internal and the external primer pairs by modifying the annealing temperature. .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: Paragraph title: DNA amplification and cloning of the groES gene. ... Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template.

    Article Title: Morbillivirus Infection of the Mouse Central Nervous System Induces Region-Specific Upregulation of MMPs and TIMPs Correlated to Inflammatory Cytokine Expression
    Article Snippet: In pilot experiments, the efficacy of each amplification stage was checked to ensure exponential amplification, and the number of cycles, MgCl2 concentration, and annealing temperature for each set of primers were optimized as described in Table . .. The PCR mixture (final volume, 50 μl) consisted of PCR buffer (final concentration of 20 mM Tris-HCl [pH 8.4], 50 mM KCl; Gibco BRL, Life Technologies), 1.5 to 3 mM MgCl2 , a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.4 μM concentration of each specific 3′ and 5′ primer (Table ), and 2 U of Taq DNA polymerase (Gibco BRL, Life Technologies).

    Article Title: Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1
    Article Snippet: .. PCR amplification was performed in the presence of 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 µM of each primer, and 0.025 U/µl Platinum Taq High Fidelity polymerase in a 20-µl reaction (Invitrogen). .. First round PCR primers included sense primer SIVsm/macEnvF1 5′-CCTCCCCCTCCAGGACTAGC-3′ (nt 6127–6146 in SIVmac239) and antisense primer SIVsm/macEnvR1 5′-TGTAATAAATCCCTTCCAGTCCCCCC-3′ (nt 9454–9479 in SIVmac239), which generated an ∼3.3-kb amplicon.

    Article Title: Q Fever in the Greek Island of Crete: Detection, Isolation, and Molecular Identification of Eight Strains of Coxiella burnetii from Clinical Samples
    Article Snippet: Paragraph title: DNA amplification. ... The PCR mixture contained 1 μM of each primer, 200 μM of each deoxynucleoside triphosphate, 2.0 mM MgCl2 , and 0.5 U of Taq polymerase (GIBCO BRL Life Technologies, Gaithersburg, Md.).

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl. .. The first amplification of the nested PCR was carried out with primers P1 and P2, and the second step used primers P3 and P4.

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Paragraph title: PCR amplification, Cloning, and Sequencing ... Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid.

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: Paragraph title: PCR amplification and cloning of partial groEL gene. ... The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: .. PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen). .. For the first round of PCR, sense primer HIV-A GagF1 5′- GTG GCA AAG AAG GAC ACC TAG-3′ and antisense primer HIV-A VifR1 5′-GTC GAC ACC CAA TTC TGA AAT G-3′ were used.

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: The eltAB gene encoding LT from these 52 strains was PCR amplified with primers pLT-F (5′-ATCCTCGCTAGCATGTTTTAT-3′) and pLT-R (5′-CCCCTCCGGCCGAGCTTAGTT-3′) ( ). .. PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: Bacterial 16S rDNA was amplified from the extracted genomic DNA by using the following universal bacterial 16S rDNA primers ( , ): forward primer 5′AGAGTTTGATCMTGGCTCAG3′ and reverse primer 5′AAGGAGGTGATCCANCCRCA3′. .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer.

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: The cDNA templates (3 μl) were amplified with one of the degenerate oligonucleotide primer pools (50 pmol), PQGWA, PQGMA, or PQGFA, with the degenerate primer pool YMDDB (50 pmol). .. Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Synthesized:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Primers P1, P2, P3, and P4 were synthesized by Shanghai Sangon Company according to the published sxh56 gene sequence (GenBank accession number ) , as follows: P1 (56F, positions 8 to 37), 5′-AAA TTA TGT TAA TTG CTA GTG CAA TGT CTG-3′; P2 (56R, positions 1522 to 1548), 5′-CTA GAA GTT ATA GCG TAC ACC TGC ACT TGC-3′; P3 (56F, positions 67 to 88), 5′ CGC GGATCC ATA GAA TTG GGG GAT GAA GGA G; and P4 (56R, positions 1532 to 1548), 5′ CCC AAGCTT CTA GAA GTT ATA GCG TAC AC 3′. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Electrophoresis:

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL). .. This first round of PCR was followed in the same thermocycler by a second denaturation step of 94°C for 4 min and 40 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 45 s. The PCR products were visualized after electrophoresis on 1.5% agarose gels.

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA). .. The amplified PCR products were separated on 1% agarose gels (FMC Bioproducts, Rockland, MA) by electrophoresis and purified using a QIAquick gel extraction kit according to the manufacturer's instructions (Qiagen, Valencia, CA).

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. .. Following electrophoresis on a 2.5% agarose gel, PCR products were visualized by UV irradiation in the presence of ethidium bromide.

    Incubation:

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: Approximately 80 mites were surface sterilized ( ) and homogenized in 600 μl of sterile cell lysis buffer (50 mM Tris [pH 8.0], 10 mM EDTA, 2% sodium dodecyl sulfate), 60 μg of proteinase K was added, and the homogenate was incubated overnight at 55°C. .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer.

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: The samples were incubated for 1 h at 42°C under mineral oil. .. Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Activity Assay:

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: Since PEANT1 and PEANT2 produced amplification products at 56°C but not at 72°C, it was thus possible to separate the activity of the internal and the external primer pairs by modifying the annealing temperature. .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Transformation Assay:

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid. .. PCR amplicons (1,200 bp) were cleaned in a 2% agarose E-gel and E-gel CloneWell Safe-Imager real-time transilluminator (Invitrogen, Carlsbad, CA), then cloned in Invitrogen pCR2.1-TOPO vector, and transformed into One Shot TOP10 competent cells following Invitrogen protocols for blue-white screening.

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer. .. PCR products of the expected sizes were purified from 2% NuSieve GTG low-melting-point agarose gels (BioWhittaker Molecular Applications, Rockland, Maine) with a QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany), cloned into pGEM-T Easy vector (Promega, Madison, Wis.), and transformed into competent JM109 Escherichia coli cells (Promega).

    Derivative Assay:

    Article Title: Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1
    Article Snippet: At this dilution, most wells contain amplicons derived from a single cDNA molecule. .. PCR amplification was performed in the presence of 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 µM of each primer, and 0.025 U/µl Platinum Taq High Fidelity polymerase in a 20-µl reaction (Invitrogen).

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: At this dilution, most wells contain amplicons derived from a single DNA molecule. .. PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen).

    Countercurrent Chromatography:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Primers P1, P2, P3, and P4 were synthesized by Shanghai Sangon Company according to the published sxh56 gene sequence (GenBank accession number ) , as follows: P1 (56F, positions 8 to 37), 5′-AAA TTA TGT TAA TTG CTA GTG CAA TGT CTG-3′; P2 (56R, positions 1522 to 1548), 5′-CTA GAA GTT ATA GCG TAC ACC TGC ACT TGC-3′; P3 (56F, positions 67 to 88), 5′ CGC GGATCC ATA GAA TTG GGG GAT GAA GGA G; and P4 (56R, positions 1532 to 1548), 5′ CCC AAGCTT CTA GAA GTT ATA GCG TAC AC 3′. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen). .. PCR was performed with the following parameters: 1 cycle of 94°C for 2 min, 35 cycles of a denaturing step of 94°C for 15 s, an annealing step of 55°C for 30 s, and an extension step of 68°C for 4 min, followed by a final extension of 68°C for 10 min. For the second round of PCR, we used 1 μl of first-round PCR product along with sense primer HIV-A GagF2 5′- GGC TGT TGG AAA TGT GGA AAGG-3′ and antisense primer HIV-A VifR2 5′- ATG GCT TCC AAT CCC ATA TGA TG-3′.

    Sequencing:

    Article Title: Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis
    Article Snippet: The RT-PCR mixture contained the OneStep 1× enzyme, OneStep 1× buffer, 0.32 mmol of each deoxynucleoside triphosphate (dATP, dCTP, and dGTP) per liter, 0.64 mmol of dUTP (GeneAmp; Applied Biosystems, Foster City, Calif.) per liter, 1 mmol of MgCl2 per liter, 0.5 μmol of each primer (CTGCGGAACCGGTGAGTACACC and ATCCAAGAAAGGACCC) per liter, 0.01 U of uracil-DNA glycosylase (Roche Molecular) per μl, and 0.3 U of RNase inhibitor (Roche Molecular) per μl. .. The genotyping amplicon was identified by using an in-house sequence analysis program based on consensus in the primer site sequence between genotypes, internal sequence divergence between genotypes, and internal sequence conservation within genotypes.

    Article Title: Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1
    Article Snippet: This was confirmed in every positive well by direct sequencing of the amplicon and inspection of the sequence for mixed bases (double peaks), which would be indicative of priming from more than one original template or the introduction of PCR error in early cycles. .. PCR amplification was performed in the presence of 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 µM of each primer, and 0.025 U/µl Platinum Taq High Fidelity polymerase in a 20-µl reaction (Invitrogen).

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The coding sequence was amplified by nested PCR from DNA isolated from O. tsutsugamushi strain Shanxi. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Paragraph title: PCR amplification, Cloning, and Sequencing ... Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: Paragraph title: Viral DNA isolation, single genome sequencing and sequence analysis ... PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen).

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: Fifty-two porcine ETEC strains that express LT alone or LT together with other toxins (LT+ /STb+ , LT+ /STb+ /STa+ , LT+ /STb+ /EAST1+ , and LT+ /STa+ /STb+ /EAST1+ ) and K88ac or F18 fimbria were selected for the sequencing of the LT gene. .. PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Paragraph title: Isolation and sequencing of PoEV cDNA. ... Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Infection:

    Article Title: Q Fever in the Greek Island of Crete: Detection, Isolation, and Molecular Identification of Eight Strains of Coxiella burnetii from Clinical Samples
    Article Snippet: Primers QpH11 and QpH12 detect plasmids present during acute Q fever, whereas primers QpRS01 and QpRS02 detect plasmids present in chronic infection due to C. burnetii ( ). .. The PCR mixture contained 1 μM of each primer, 200 μM of each deoxynucleoside triphosphate, 2.0 mM MgCl2 , and 0.5 U of Taq polymerase (GIBCO BRL Life Technologies, Gaithersburg, Md.).

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: A portion of the porcine endogenous retrovirus (PoEV) reverse transcriptase coding region was isolated from cDNA made from infected cells with degenerate oligonucleotide primers (Table ), based on highly conserved regions among reverse transcriptase genes. .. Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Generated:

    Article Title: Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis
    Article Snippet: The RT-PCR mixture contained the OneStep 1× enzyme, OneStep 1× buffer, 0.32 mmol of each deoxynucleoside triphosphate (dATP, dCTP, and dGTP) per liter, 0.64 mmol of dUTP (GeneAmp; Applied Biosystems, Foster City, Calif.) per liter, 1 mmol of MgCl2 per liter, 0.5 μmol of each primer (CTGCGGAACCGGTGAGTACACC and ATCCAAGAAAGGACCC) per liter, 0.01 U of uracil-DNA glycosylase (Roche Molecular) per μl, and 0.3 U of RNase inhibitor (Roche Molecular) per μl. .. The primers generated a 56-bp genotyping amplicon (from positions −139 to −194 of the HCV 5′ UTR; GenBank accession ).

    Article Title: Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1
    Article Snippet: PCR amplification was performed in the presence of 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 µM of each primer, and 0.025 U/µl Platinum Taq High Fidelity polymerase in a 20-µl reaction (Invitrogen). .. First round PCR primers included sense primer SIVsm/macEnvF1 5′-CCTCCCCCTCCAGGACTAGC-3′ (nt 6127–6146 in SIVmac239) and antisense primer SIVsm/macEnvR1 5′-TGTAATAAATCCCTTCCAGTCCCCCC-3′ (nt 9454–9479 in SIVmac239), which generated an ∼3.3-kb amplicon.

    DNA Sequencing:

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: After restriction fragment length polymorphism analysis and DNA sequencing of 51 human ETEC strains, Lasaro et al. reported that the human LT gene had seven polymorphic restriction fragment length polymorphism types and 30 nucleotide polymorphic sites and recognized 16 different hLT types ( ). .. PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA).

    Polymerase Chain Reaction:

    Article Title: Quantification of Clostridium botulinum Toxin Gene Expression by Competitive Reverse Transcription-PCR
    Article Snippet: .. A 5-μl portion of the resulting cDNA was amplified by PCR by using a 100-μl mixture which contained 100 pmol of S1 forward primer per μl, 100 pmol of S1 reverse primer per μl, each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , and 2.5 U of Taq DNA polymerase (Gibco BRL). .. Each PCR cycle consisted of denaturation for 1 min at 94°C, annealing for 30 s at 40°C, and extension for 30 s at 72°C; 31 such cycles were followed by a final extension cycle consisting of 72°C for 10 min.

    Article Title: Detection of Toxoplasma gondii Oocysts in Water Sample Concentrates by Real-Time PCR ▿
    Article Snippet: .. Each 100 μl of PCR solution contained 2.0 μl of DNA, 500 nM primers, 0.2 mM deoxynucleoside triphosphate (Applied Biosystems), 3.0 mM MgCl, 1× GeneAmp 10× PCR buffer (Applied Biosystems), and 2.5 U of Taq DNA polymerase (Promega). .. PCR amplification consisted of denaturation at 94°C for 4 min; 35 cycles of 94°C for 45 s, 52°C (B1-Burg primers), 55°C (529 primers), or 61°C (B1-Costa primers) for 45 s, and 72°C for 1 min; and an extension of 72°C for 10 min. PCR products were visualized by 1.5% agarose gel electrophoresis.

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: Paragraph title: PCR design and comparison of amplifications. ... PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: .. Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template. .. Each PCR cycling profile consisted of an initial denaturation step of 3 min at 95°C, followed by amplification for 30 cycles as follows: denaturation for 30 s at 95°C, annealing for 30 s at 51°C, and extension for 1 min at 72°C.

    Article Title: Morbillivirus Infection of the Mouse Central Nervous System Induces Region-Specific Upregulation of MMPs and TIMPs Correlated to Inflammatory Cytokine Expression
    Article Snippet: .. The PCR mixture (final volume, 50 μl) consisted of PCR buffer (final concentration of 20 mM Tris-HCl [pH 8.4], 50 mM KCl; Gibco BRL, Life Technologies), 1.5 to 3 mM MgCl2 , a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.4 μM concentration of each specific 3′ and 5′ primer (Table ), and 2 U of Taq DNA polymerase (Gibco BRL, Life Technologies). .. Samples were subjected to PCR (prior hot start to minimize mispriming) using the conditions of 22 to 35 cycles of 95°C for 45 s, 55 to 62°C for 45 s, and 72°C for 60 s, with a final elongation step of 72°C for 9 min.

    Article Title: Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1
    Article Snippet: .. PCR amplification was performed in the presence of 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 µM of each primer, and 0.025 U/µl Platinum Taq High Fidelity polymerase in a 20-µl reaction (Invitrogen). .. First round PCR primers included sense primer SIVsm/macEnvF1 5′-CCTCCCCCTCCAGGACTAGC-3′ (nt 6127–6146 in SIVmac239) and antisense primer SIVsm/macEnvR1 5′-TGTAATAAATCCCTTCCAGTCCCCCC-3′ (nt 9454–9479 in SIVmac239), which generated an ∼3.3-kb amplicon.

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Paragraph title: Nucleic acid extraction and PCR amplification. ... The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: .. Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid. .. Screening PCR cycling conditions included a 3 min 96°C hot start, followed by 40 cycles at 94°C for 1 min denaturation, 61°C for 1 min annealing, and 72°C for 1 min elongation, with a final elongation step at 72°C for 3 min. PCR positive samples were amplified de novo in a 50 µl PCR reaction volume and 30 PCR cycles to minimize PCR bias .

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: .. The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer. .. The PCR thermal cycling conditions were as described earlier ( ).

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: .. PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen). .. For the first round of PCR, sense primer HIV-A GagF1 5′- GTG GCA AAG AAG GAC ACC TAG-3′ and antisense primer HIV-A VifR1 5′-GTC GAC ACC CAA TTC TGA AAT G-3′ were used.

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: The eltAB gene encoding LT from these 52 strains was PCR amplified with primers pLT-F (5′-ATCCTCGCTAGCATGTTTTAT-3′) and pLT-R (5′-CCCCTCCGGCCGAGCTTAGTT-3′) ( ). .. PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer. ..

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. .. Following electrophoresis on a 2.5% agarose gel, PCR products were visualized by UV irradiation in the presence of ethidium bromide.

    Cellular Antioxidant Activity Assay:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Primers P1, P2, P3, and P4 were synthesized by Shanghai Sangon Company according to the published sxh56 gene sequence (GenBank accession number ) , as follows: P1 (56F, positions 8 to 37), 5′-AAA TTA TGT TAA TTG CTA GTG CAA TGT CTG-3′; P2 (56R, positions 1522 to 1548), 5′-CTA GAA GTT ATA GCG TAC ACC TGC ACT TGC-3′; P3 (56F, positions 67 to 88), 5′ CGC GGATCC ATA GAA TTG GGG GAT GAA GGA G; and P4 (56R, positions 1532 to 1548), 5′ CCC AAGCTT CTA GAA GTT ATA GCG TAC AC 3′. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen). .. For the first round of PCR, sense primer HIV-A GagF1 5′- GTG GCA AAG AAG GAC ACC TAG-3′ and antisense primer HIV-A VifR1 5′-GTC GAC ACC CAA TTC TGA AAT G-3′ were used.

    Molecular Weight:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl. .. The products of the nested PCR were analyzed on a 1% agarose gel, and the size of the sxh56 gene was determined with the λ DNA/EcoT14I standard molecular weight marker (Sino-America Biotech Company, Luoyang, China).

    Staining:

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template. .. The resulting amplicons were separated on a 1.5% agarose gel, and this was followed by ethidium bromide staining.

    DNA Extraction:

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: PCR amplification, Cloning, and Sequencing Each genomic DNA extraction was first screened for TM7 via PCR amplification of the 16S rDNA gene (∼1,200 bp) with the broad-range forward primer BAC-8F and the TM7-1177R ( , Supporting online information) with 100× diluted DNA. .. Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: Paragraph title: Viral DNA isolation, single genome sequencing and sequence analysis ... PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen).

    In Vivo:

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: A mixture of male and female P. ovis mites (Cornish strain, medium virulence) at all stages of development was obtained from an in vivo sheep culture at the Veterinary Laboratories Agency, Weybridge, United Kingdom. .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer.

    Isolation:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The coding sequence was amplified by nested PCR from DNA isolated from O. tsutsugamushi strain Shanxi. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Article Title: Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation
    Article Snippet: Viral DNA isolation, single genome sequencing and sequence analysis Genomic DNA was isolated from the sorted GFP+ cell pools using QIAamp DNA blood kit (Qiagen). .. PCR amplification was performed in a 20-μl reaction containing 1× High Fidelity Platinum PCR buffer, 2 mM MgSO4 , 0.2 mM of each deoxynucleoside triphosphate, 0.2 μM of each primer, and 0.025 U/μl Platinum Taq High Fidelity polymerase (Invitrogen).

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: Those porcine ETEC strains were isolated from pigs with postweaning diarrhea at different farms in South Dakota, Iowa, Minnesota, Nebraska, and North Dakota. .. PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: Paragraph title: Isolation of bacterial 16S rDNA. ... A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer.

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Paragraph title: Isolation and sequencing of PoEV cDNA. ... Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Purification:

    Article Title: Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis
    Article Snippet: A sample volume of 2 μl of purified HCV RNA (approximately 100 to 1,000 IU of virions were extracted per reaction mixture) was added to a final RT-PCR mixture volume of 50 μl. .. The RT-PCR mixture contained the OneStep 1× enzyme, OneStep 1× buffer, 0.32 mmol of each deoxynucleoside triphosphate (dATP, dCTP, and dGTP) per liter, 0.64 mmol of dUTP (GeneAmp; Applied Biosystems, Foster City, Calif.) per liter, 1 mmol of MgCl2 per liter, 0.5 μmol of each primer (CTGCGGAACCGGTGAGTACACC and ATCCAAGAAAGGACCC) per liter, 0.01 U of uracil-DNA glycosylase (Roche Molecular) per μl, and 0.3 U of RNase inhibitor (Roche Molecular) per μl.

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template. .. PCR fragments were purified with a PCR purification spin kit (Genomed, Löhne, Germany) and were subsequently sequenced.

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid. .. Plasmids were purified from 303 clones with QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA) and sequenced with M13F primer by Sequetech, Mountain View, CA.

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA). .. The amplified PCR products were separated on 1% agarose gels (FMC Bioproducts, Rockland, MA) by electrophoresis and purified using a QIAquick gel extraction kit according to the manufacturer's instructions (Qiagen, Valencia, CA).

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer. .. The amplified 1,500-bp product was purified from the gel slice by using a Sephaglass band prep kit (Pharmacia Biotech) and was ligated into PGEMT (Stratagene).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis
    Article Snippet: .. The RT-PCR mixture contained the OneStep 1× enzyme, OneStep 1× buffer, 0.32 mmol of each deoxynucleoside triphosphate (dATP, dCTP, and dGTP) per liter, 0.64 mmol of dUTP (GeneAmp; Applied Biosystems, Foster City, Calif.) per liter, 1 mmol of MgCl2 per liter, 0.5 μmol of each primer (CTGCGGAACCGGTGAGTACACC and ATCCAAGAAAGGACCC) per liter, 0.01 U of uracil-DNA glycosylase (Roche Molecular) per μl, and 0.3 U of RNase inhibitor (Roche Molecular) per μl. .. The primers generated a 56-bp genotyping amplicon (from positions −139 to −194 of the HCV 5′ UTR; GenBank accession ).

    Article Title: Quantification of Clostridium botulinum Toxin Gene Expression by Competitive Reverse Transcription-PCR
    Article Snippet: Paragraph title: Competitive RT-PCR. ... A 5-μl portion of the resulting cDNA was amplified by PCR by using a 100-μl mixture which contained 100 pmol of S1 forward primer per μl, 100 pmol of S1 reverse primer per μl, each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , and 2.5 U of Taq DNA polymerase (Gibco BRL).

    Article Title: Morbillivirus Infection of the Mouse Central Nervous System Induces Region-Specific Upregulation of MMPs and TIMPs Correlated to Inflammatory Cytokine Expression
    Article Snippet: Paragraph title: Semiquantitative assay of CDV NP, MMP, and TIMP mRNAs using RT-PCR. ... The PCR mixture (final volume, 50 μl) consisted of PCR buffer (final concentration of 20 mM Tris-HCl [pH 8.4], 50 mM KCl; Gibco BRL, Life Technologies), 1.5 to 3 mM MgCl2 , a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.4 μM concentration of each specific 3′ and 5′ primer (Table ), and 2 U of Taq DNA polymerase (Gibco BRL, Life Technologies).

    Lysis:

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: Approximately 80 mites were surface sterilized ( ) and homogenized in 600 μl of sterile cell lysis buffer (50 mM Tris [pH 8.0], 10 mM EDTA, 2% sodium dodecyl sulfate), 60 μg of proteinase K was added, and the homogenate was incubated overnight at 55°C. .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer.

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Cellular RNA was isolated following guanidinium thiocyanate lysis and CsCl centrifugation. cDNA was prepared with avian myeloblastosis virus reverse transcriptase (10 U; Promega Corp.) in 1× avian myeloblastosis virus buffer containing 1 mM deoxynucleoside triphosphate, 30 U of RNasin, and 10 pmol of degenerate oligonucleotide YMDDB in a total volume of 30 μl. .. Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min.

    Nested PCR:

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: The criteria we used for selecting the external and internal primer pairs were (i) the external primer pair should amplify a fragment large enough to permit the design of an appropriate internal couple, (ii) annealing temperatures of the primer pairs should allow for the separation of both PCRs only by this parameter, and (iii) high sensitivity of the primers, to increase as much as possible the detection threshold of the nested PCR in one tube. .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Article Title: Q Fever in the Greek Island of Crete: Detection, Isolation, and Molecular Identification of Eight Strains of Coxiella burnetii from Clinical Samples
    Article Snippet: The PCR mixture contained 1 μM of each primer, 200 μM of each deoxynucleoside triphosphate, 2.0 mM MgCl2 , and 0.5 U of Taq polymerase (GIBCO BRL Life Technologies, Gaithersburg, Md.). .. For the direct PCR detection of C. burnetii in the buffy coat, a nested PCR assay was performed with primers Hfrag1 and Hfrag2 in the first PCR and primers HF1 and HF2 in the nested PCR.

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The coding sequence was amplified by nested PCR from DNA isolated from O. tsutsugamushi strain Shanxi. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Activated Clotting Time Assay:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Primers P1, P2, P3, and P4 were synthesized by Shanghai Sangon Company according to the published sxh56 gene sequence (GenBank accession number ) , as follows: P1 (56F, positions 8 to 37), 5′-AAA TTA TGT TAA TTG CTA GTG CAA TGT CTG-3′; P2 (56R, positions 1522 to 1548), 5′-CTA GAA GTT ATA GCG TAC ACC TGC ACT TGC-3′; P3 (56F, positions 67 to 88), 5′ CGC GGATCC ATA GAA TTG GGG GAT GAA GGA G; and P4 (56R, positions 1532 to 1548), 5′ CCC AAGCTT CTA GAA GTT ATA GCG TAC AC 3′. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    Plasmid Preparation:

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: We then designed as internal pair the primers PEANT1 (5′-TATCCCTAAAAACCTCAGTGC-3′) and PEANT2 (5′-GCAACCTTGTGCCCTTTA-3′), which lie within 844 bases of the fragment from the 29-kb plasmid pEA amplified by the external pair ( ). .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid. .. PCR amplicons (1,200 bp) were cleaned in a 2% agarose E-gel and E-gel CloneWell Safe-Imager real-time transilluminator (Invitrogen, Carlsbad, CA), then cloned in Invitrogen pCR2.1-TOPO vector, and transformed into One Shot TOP10 competent cells following Invitrogen protocols for blue-white screening.

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer. .. PCR products of the expected sizes were purified from 2% NuSieve GTG low-melting-point agarose gels (BioWhittaker Molecular Applications, Rockland, Maine) with a QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany), cloned into pGEM-T Easy vector (Promega, Madison, Wis.), and transformed into competent JM109 Escherichia coli cells (Promega).

    Irradiation:

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. .. Following electrophoresis on a 2.5% agarose gel, PCR products were visualized by UV irradiation in the presence of ethidium bromide.

    Negative Control:

    Article Title: Morbillivirus Infection of the Mouse Central Nervous System Induces Region-Specific Upregulation of MMPs and TIMPs Correlated to Inflammatory Cytokine Expression
    Article Snippet: In the negative control, the RNA was omitted. .. The PCR mixture (final volume, 50 μl) consisted of PCR buffer (final concentration of 20 mM Tris-HCl [pH 8.4], 50 mM KCl; Gibco BRL, Life Technologies), 1.5 to 3 mM MgCl2 , a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.4 μM concentration of each specific 3′ and 5′ primer (Table ), and 2 U of Taq DNA polymerase (Gibco BRL, Life Technologies).

    Agarose Gel Electrophoresis:

    Article Title: Quantification of Clostridium botulinum Toxin Gene Expression by Competitive Reverse Transcription-PCR
    Article Snippet: A 5-μl portion of the resulting cDNA was amplified by PCR by using a 100-μl mixture which contained 100 pmol of S1 forward primer per μl, 100 pmol of S1 reverse primer per μl, each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , and 2.5 U of Taq DNA polymerase (Gibco BRL). .. The competitive products were analyzed on a 1.5% Metaphore agarose gel (Flowgen).

    Article Title: Detection of Toxoplasma gondii Oocysts in Water Sample Concentrates by Real-Time PCR ▿
    Article Snippet: Each 100 μl of PCR solution contained 2.0 μl of DNA, 500 nM primers, 0.2 mM deoxynucleoside triphosphate (Applied Biosystems), 3.0 mM MgCl, 1× GeneAmp 10× PCR buffer (Applied Biosystems), and 2.5 U of Taq DNA polymerase (Promega). .. PCR amplification consisted of denaturation at 94°C for 4 min; 35 cycles of 94°C for 45 s, 52°C (B1-Burg primers), 55°C (529 primers), or 61°C (B1-Costa primers) for 45 s, and 72°C for 1 min; and an extension of 72°C for 10 min. PCR products were visualized by 1.5% agarose gel electrophoresis.

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template. .. The resulting amplicons were separated on a 1.5% agarose gel, and this was followed by ethidium bromide staining.

    Article Title: Q Fever in the Greek Island of Crete: Detection, Isolation, and Molecular Identification of Eight Strains of Coxiella burnetii from Clinical Samples
    Article Snippet: The PCR mixture contained 1 μM of each primer, 200 μM of each deoxynucleoside triphosphate, 2.0 mM MgCl2 , and 0.5 U of Taq polymerase (GIBCO BRL Life Technologies, Gaithersburg, Md.). .. The PCR products were separated on a 2% agarose gel and visualized by UV illumination.

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl. .. The products of the nested PCR were analyzed on a 1% agarose gel, and the size of the sxh56 gene was determined with the λ DNA/EcoT14I standard molecular weight marker (Sino-America Biotech Company, Luoyang, China).

    Article Title: Type C Retrovirus Released from Porcine Primary Peripheral Blood Mononuclear Cells Infects Human Cells
    Article Snippet: Hot-start amplifications were performed in 50 μl of 0.067 M Tris buffer (pH 8.8) containing 4 mM MgCl2 , 16 mM (NH4 )2 SO4 , 10 mM 2-mercaptoethanol, 0.1 mg of bovine serum albumin per ml , 100 μM each deoxynucleoside triphosphate, and Taq polymerase (1 U; Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. .. Following electrophoresis on a 2.5% agarose gel, PCR products were visualized by UV irradiation in the presence of ethidium bromide.

    Produced:

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: Since PEANT1 and PEANT2 produced amplification products at 56°C but not at 72°C, it was thus possible to separate the activity of the internal and the external primer pairs by modifying the annealing temperature. .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL).

    Concentration Assay:

    Article Title: Quantification of Clostridium botulinum Toxin Gene Expression by Competitive Reverse Transcription-PCR
    Article Snippet: .. A 5-μl portion of the resulting cDNA was amplified by PCR by using a 100-μl mixture which contained 100 pmol of S1 forward primer per μl, 100 pmol of S1 reverse primer per μl, each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , and 2.5 U of Taq DNA polymerase (Gibco BRL). .. Each PCR cycle consisted of denaturation for 1 min at 94°C, annealing for 30 s at 40°C, and extension for 30 s at 72°C; 31 such cycles were followed by a final extension cycle consisting of 72°C for 10 min.

    Article Title: Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material
    Article Snippet: .. PCRs were performed in a final volume of 50 μl with the following reagents: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2 , 3% (vol/vol) formamide, a 200 μM concentration of each deoxynucleoside triphosphate, 0.03 pmol each of external primers AJ75 and AJ76 , 10 pmol each of internal primers PEANT1 and PEANT2, and 3 U of Taq polymerase (Gibco BRL). ..

    Article Title: Characterization of the groEL and groES Loci in Bifidobacterium breve UCC 2003: Genetic, Transcriptional, and Phylogenetic Analyses
    Article Snippet: .. Each PCR mixture (50 μl) contained a reaction cocktail consisting of 20 mM Tri-HCl, 50 mM KCl, each deoxynucleoside triphosphate at a concentration of 200 μM, 50 pmol of each primer, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Gibco BRL, Paisley, United Kingdom), and 25 ng of DNA template. .. Each PCR cycling profile consisted of an initial denaturation step of 3 min at 95°C, followed by amplification for 30 cycles as follows: denaturation for 30 s at 95°C, annealing for 30 s at 51°C, and extension for 1 min at 72°C.

    Article Title: Morbillivirus Infection of the Mouse Central Nervous System Induces Region-Specific Upregulation of MMPs and TIMPs Correlated to Inflammatory Cytokine Expression
    Article Snippet: .. The PCR mixture (final volume, 50 μl) consisted of PCR buffer (final concentration of 20 mM Tris-HCl [pH 8.4], 50 mM KCl; Gibco BRL, Life Technologies), 1.5 to 3 mM MgCl2 , a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.4 μM concentration of each specific 3′ and 5′ primer (Table ), and 2 U of Taq DNA polymerase (Gibco BRL, Life Technologies). .. Samples were subjected to PCR (prior hot start to minimize mispriming) using the conditions of 22 to 35 cycles of 95°C for 45 s, 55 to 62°C for 45 s, and 72°C for 60 s, with a final elongation step of 72°C for 9 min.

    Article Title: Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA
    Article Snippet: .. A PCR was performed with a 50-μl reaction mixture containing 1 μl (10 ng) of DNA extract as the template, each primer at a concentration of 0.5 μM, 1.5 mM MgCl2 , and each deoxynucleoside triphosphate at a concentration of 50 μM, as well as 1 U of Gibco Taq polymerase and buffer used as recommended by the manufacturer. ..

    CTG Assay:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: Primers P1, P2, P3, and P4 were synthesized by Shanghai Sangon Company according to the published sxh56 gene sequence (GenBank accession number ) , as follows: P1 (56F, positions 8 to 37), 5′-AAA TTA TGT TAA TTG CTA GTG CAA TGT CTG-3′; P2 (56R, positions 1522 to 1548), 5′-CTA GAA GTT ATA GCG TAC ACC TGC ACT TGC-3′; P3 (56F, positions 67 to 88), 5′ CGC GGATCC ATA GAA TTG GGG GAT GAA GGA G; and P4 (56R, positions 1532 to 1548), 5′ CCC AAGCTT CTA GAA GTT ATA GCG TAC AC 3′. .. The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl.

    BAC Assay:

    Article Title: In Search of an Uncultured Human-Associated TM7 Bacterium in the Environment
    Article Snippet: PCR amplification, Cloning, and Sequencing Each genomic DNA extraction was first screened for TM7 via PCR amplification of the 16S rDNA gene (∼1,200 bp) with the broad-range forward primer BAC-8F and the TM7-1177R ( , Supporting online information) with 100× diluted DNA. .. Each PCR reaction consisted of 1× PCR Buffer B (Fisher Scientific, Waltham, Massachusetts), 1.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.2 pmol of each forward and reverse primer, 1.25×10−2 units of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, California), and 3 to 30 ng of nucleic acid.

    Marker:

    Article Title: Recombinant 56-Kilodalton Major Outer Membrane Protein Antigen of Orientia tsutsugamushi Shanxi and Its Antigenicity
    Article Snippet: The 56-kDa gene was amplified in a mixture of 200 μM (each) deoxynucleoside triphosphate, 0.3 μM (each) primer, and 0.6 U of Taq polymerase (Gibco) in10 mM Tris-HCl buffer (pH 8.3) supplemented with 2.0 mM MgCl2 and 50 mM KCl. .. The products of the nested PCR were analyzed on a 1% agarose gel, and the size of the sxh56 gene was determined with the λ DNA/EcoT14I standard molecular weight marker (Sino-America Biotech Company, Luoyang, China).

    Gel Extraction:

    Article Title: Phylogenetic Analysis and PCR-Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
    Article Snippet: The 50-μl PCR mixture contained 200 ng of genomic DNA (or 5 μl of cell lysate), 100 μM each deoxynucleoside triphosphate, 2.5 U of Taq DNA polymerase (MBI Fermentas, Hanover, Md.), 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% Nonidet P-40, 1.5 mM MgCl2 , and 2 μM each primer. .. PCR products of the expected sizes were purified from 2% NuSieve GTG low-melting-point agarose gels (BioWhittaker Molecular Applications, Rockland, Maine) with a QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany), cloned into pGEM-T Easy vector (Promega, Madison, Wis.), and transformed into competent JM109 Escherichia coli cells (Promega).

    Article Title: Little Heterogeneity among Genes Encoding Heat-Labile and Heat-Stable Toxins of Enterotoxigenic Escherichia coli Strains Isolated from Diarrheal Pigs
    Article Snippet: PCRs were performed in an MJ PT-100 thermocycler (Bio-Rad, Hercules, CA) in a reaction of 50 μl containing 1× Taq DNA polymerase buffer (with Mg2+ ), 0.2 mM deoxynucleoside triphosphate, 0.5 μM each forward and reverse primers, 100 ng of total genomic DNA, and 1 unit Taq DNA polymerase (Applied Biosystems, Foster City, CA). .. The amplified PCR products were separated on 1% agarose gels (FMC Bioproducts, Rockland, MA) by electrophoresis and purified using a QIAquick gel extraction kit according to the manufacturer's instructions (Qiagen, Valencia, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Thermo Fisher gene exp samhd1 hs00210019 m1
    Proposed model for p21-mediated HIV-1 restriction in MDDCs. The expression of p21 is induced during MDDC maturation (step 1). The increase in p21 expression leads to the downregulation of several enzymes (RNR2, TYMS, and TK1) involved in dNTP biosynthesis (step 2), which would decrease the dNTP pool size (step 3), impairing HIV-1 reverse transcription (step 4). In parallel, p21 induction could increase the active isoform of <t>SAMHD1</t> (step 5), which would further block viral replication through the degradation of dNTPs (step 6) or exonuclease activity (step 7). Low levels of dNTP synthesis as a consequence of p21 induction might further facilitate the exonuclease activity of SAMHD1 (step 8). Although not explored here, induction of p21 might also directly block reverse transcriptase activity and impair HIV transcription, as has been shown in CD4 + ).
    Gene Exp Samhd1 Hs00210019 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp samhd1 hs00210019 m1/product/Thermo Fisher
    Average 87 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    gene exp samhd1 hs00210019 m1 - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    98
    Thermo Fisher deoxynucleotide triphosphate
    Proposed model for p21-mediated HIV-1 restriction in MDDCs. The expression of p21 is induced during MDDC maturation (step 1). The increase in p21 expression leads to the downregulation of several enzymes (RNR2, TYMS, and TK1) involved in dNTP biosynthesis (step 2), which would decrease the dNTP pool size (step 3), impairing HIV-1 reverse transcription (step 4). In parallel, p21 induction could increase the active isoform of <t>SAMHD1</t> (step 5), which would further block viral replication through the degradation of dNTPs (step 6) or exonuclease activity (step 7). Low levels of dNTP synthesis as a consequence of p21 induction might further facilitate the exonuclease activity of SAMHD1 (step 8). Although not explored here, induction of p21 might also directly block reverse transcriptase activity and impair HIV transcription, as has been shown in CD4 + ).
    Deoxynucleotide Triphosphate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 256 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate/product/Thermo Fisher
    Average 98 stars, based on 256 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    Image Search Results


    Proposed model for p21-mediated HIV-1 restriction in MDDCs. The expression of p21 is induced during MDDC maturation (step 1). The increase in p21 expression leads to the downregulation of several enzymes (RNR2, TYMS, and TK1) involved in dNTP biosynthesis (step 2), which would decrease the dNTP pool size (step 3), impairing HIV-1 reverse transcription (step 4). In parallel, p21 induction could increase the active isoform of SAMHD1 (step 5), which would further block viral replication through the degradation of dNTPs (step 6) or exonuclease activity (step 7). Low levels of dNTP synthesis as a consequence of p21 induction might further facilitate the exonuclease activity of SAMHD1 (step 8). Although not explored here, induction of p21 might also directly block reverse transcriptase activity and impair HIV transcription, as has been shown in CD4 + ).

    Journal: Journal of Virology

    Article Title: p21 Restricts HIV-1 in Monocyte-Derived Dendritic Cells through the Reduction of Deoxynucleoside Triphosphate Biosynthesis and Regulation of SAMHD1 Antiviral Activity

    doi: 10.1128/JVI.01324-17

    Figure Lengend Snippet: Proposed model for p21-mediated HIV-1 restriction in MDDCs. The expression of p21 is induced during MDDC maturation (step 1). The increase in p21 expression leads to the downregulation of several enzymes (RNR2, TYMS, and TK1) involved in dNTP biosynthesis (step 2), which would decrease the dNTP pool size (step 3), impairing HIV-1 reverse transcription (step 4). In parallel, p21 induction could increase the active isoform of SAMHD1 (step 5), which would further block viral replication through the degradation of dNTPs (step 6) or exonuclease activity (step 7). Low levels of dNTP synthesis as a consequence of p21 induction might further facilitate the exonuclease activity of SAMHD1 (step 8). Although not explored here, induction of p21 might also directly block reverse transcriptase activity and impair HIV transcription, as has been shown in CD4 + ).

    Article Snippet: PCR amplification of cDNAs was carried out as previously described ( ) on a 7500 real-time PCR system using the TaqMan gene expression premade mix (Applied Biosystems) to amplify the following genes: RRM2 (Hs00357247_g1), TYMS (Hs00426586_m1), SAMHD1 (Hs00210019_m1), CTPS1 (Hs01041858_m1), TK1 (Hs01062125_m1), CDKN1A (Hs00355782_m1), and GAPDH (Hs02758991_g1).

    Techniques: Expressing, Blocking Assay, Activity Assay

    p21 expression modulates SAMHD1 phosphorylation levels in MDDCs. (A to C) Relative copies of SAMHD1 mRNA (A), total SAMHD1 protein levels (B), and pSAMHD1 protein levels (C) in immature and mature MDDC after transfection with siRNA p21 or siRNA NT. The data are expressed relative to the number of mRNA copies or protein levels in immature MDDCs transfected with nontargeting siRNA. The symbols represent independent experiments ( n = 9 donors for mRNA and n = 4 donors for proteins). (D) Changes in luciferase activity after infection with HIV-1 NL4.3ΔenvLuc VSV-G in immature and mature MDDCs cultured in the presence of virus-like particles with or without the SIV VPX protein. The results are shown as the fold change relative to the luciferase activity in immature MDDCs cultured with VLPs not carrying VPX. The symbols represent independent experiments ( n = 9). The median and IQR values are shown. P values of ANOVA are shown. Significant differences ( P

    Journal: Journal of Virology

    Article Title: p21 Restricts HIV-1 in Monocyte-Derived Dendritic Cells through the Reduction of Deoxynucleoside Triphosphate Biosynthesis and Regulation of SAMHD1 Antiviral Activity

    doi: 10.1128/JVI.01324-17

    Figure Lengend Snippet: p21 expression modulates SAMHD1 phosphorylation levels in MDDCs. (A to C) Relative copies of SAMHD1 mRNA (A), total SAMHD1 protein levels (B), and pSAMHD1 protein levels (C) in immature and mature MDDC after transfection with siRNA p21 or siRNA NT. The data are expressed relative to the number of mRNA copies or protein levels in immature MDDCs transfected with nontargeting siRNA. The symbols represent independent experiments ( n = 9 donors for mRNA and n = 4 donors for proteins). (D) Changes in luciferase activity after infection with HIV-1 NL4.3ΔenvLuc VSV-G in immature and mature MDDCs cultured in the presence of virus-like particles with or without the SIV VPX protein. The results are shown as the fold change relative to the luciferase activity in immature MDDCs cultured with VLPs not carrying VPX. The symbols represent independent experiments ( n = 9). The median and IQR values are shown. P values of ANOVA are shown. Significant differences ( P

    Article Snippet: PCR amplification of cDNAs was carried out as previously described ( ) on a 7500 real-time PCR system using the TaqMan gene expression premade mix (Applied Biosystems) to amplify the following genes: RRM2 (Hs00357247_g1), TYMS (Hs00426586_m1), SAMHD1 (Hs00210019_m1), CTPS1 (Hs01041858_m1), TK1 (Hs01062125_m1), CDKN1A (Hs00355782_m1), and GAPDH (Hs02758991_g1).

    Techniques: Expressing, Transfection, Luciferase, Activity Assay, Infection, Cell Culture

    Phosphorylation state of SAMHD1. Monocytes (Monocyte), M-CSF-differentiated macrophages (Macrophage (M-CSF)), and GM-CSF-differentiated macrophages (Macrophage (GM-CSF)) were treated with GH123-Nhe/VSV-G for 2 h and incubated at 37°C for 4 h (4 h) or 24 h (24 h), or mock-treated (−). Cells were lyzed and subjected for SDS-PAGE containing Phos-tag to separate phosphorylated proteins from nonphosphorylated ones. SAMHD1 proteins were detected by anti-SAMHD1 antibody. Upper bands shown by a vertical bar and a lower band shown by an arrow represent phosphorylated and nonphosphorylated SAMHD1, respectively. Ratios of phosphorylated SAMHD1 levels to total SAMHD1 levels (ratio) are shown in vertical numbers.

    Journal: PLoS ONE

    Article Title: Moderate Restriction of Macrophage-Tropic Human Immunodeficiency Virus Type 1 by SAMHD1 in Monocyte-Derived Macrophages

    doi: 10.1371/journal.pone.0090969

    Figure Lengend Snippet: Phosphorylation state of SAMHD1. Monocytes (Monocyte), M-CSF-differentiated macrophages (Macrophage (M-CSF)), and GM-CSF-differentiated macrophages (Macrophage (GM-CSF)) were treated with GH123-Nhe/VSV-G for 2 h and incubated at 37°C for 4 h (4 h) or 24 h (24 h), or mock-treated (−). Cells were lyzed and subjected for SDS-PAGE containing Phos-tag to separate phosphorylated proteins from nonphosphorylated ones. SAMHD1 proteins were detected by anti-SAMHD1 antibody. Upper bands shown by a vertical bar and a lower band shown by an arrow represent phosphorylated and nonphosphorylated SAMHD1, respectively. Ratios of phosphorylated SAMHD1 levels to total SAMHD1 levels (ratio) are shown in vertical numbers.

    Article Snippet: For real time PCR, each 20-µL reaction mixture consisted of 5 µL of cDNA, 10 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Carlsbad, CA) and 1 µL of TaqMan Gene Ex Assays (Assay ID: Hs00210019_m1).

    Techniques: Incubation, SDS Page

    Quantification of SAMHD1 mRNA expression. Monocytes were differentiated into macrophages for 6 days in the presence of GM-CSF or M-CSF. Macrophages or monocytes were treated with or without VSV-G-pseudotyped and Env-defective HIV-2 particles (GH123/VSV-G), and harvested. SAMHD1 mRNA expression levels were detected by real-time RT-PCR and normalized against GAPDH. Data are shown as mean ± SD.

    Journal: PLoS ONE

    Article Title: Moderate Restriction of Macrophage-Tropic Human Immunodeficiency Virus Type 1 by SAMHD1 in Monocyte-Derived Macrophages

    doi: 10.1371/journal.pone.0090969

    Figure Lengend Snippet: Quantification of SAMHD1 mRNA expression. Monocytes were differentiated into macrophages for 6 days in the presence of GM-CSF or M-CSF. Macrophages or monocytes were treated with or without VSV-G-pseudotyped and Env-defective HIV-2 particles (GH123/VSV-G), and harvested. SAMHD1 mRNA expression levels were detected by real-time RT-PCR and normalized against GAPDH. Data are shown as mean ± SD.

    Article Snippet: For real time PCR, each 20-µL reaction mixture consisted of 5 µL of cDNA, 10 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Carlsbad, CA) and 1 µL of TaqMan Gene Ex Assays (Assay ID: Hs00210019_m1).

    Techniques: Expressing, Quantitative RT-PCR

    Effects of SAMHD1 siRNA on HIV-1 infection. Monocytes (Monocyte) or macrophages (Macrophage) were treated with SAMHD1- (siSAMHD1) or GFP- (siGFP) targeting siRNAs. Three days after transfection, cells were harvested or infected with NL43-Luci/VSV-G virus. SAMHD1 mRNA expression levels in harvested cells were detected by real-time RT-PCR and normalized against GAPDH. Data are shown as mean ± SD. Luciferase activity in infected cells was measured 4 days after infection. Data are plotted as the mean ± SD of triplicate samples; presented data are representative of two independent experiments using two donors. A: Results of samples obtained from a donor 1. B: Results of samples obtained from a donor 2.

    Journal: PLoS ONE

    Article Title: Moderate Restriction of Macrophage-Tropic Human Immunodeficiency Virus Type 1 by SAMHD1 in Monocyte-Derived Macrophages

    doi: 10.1371/journal.pone.0090969

    Figure Lengend Snippet: Effects of SAMHD1 siRNA on HIV-1 infection. Monocytes (Monocyte) or macrophages (Macrophage) were treated with SAMHD1- (siSAMHD1) or GFP- (siGFP) targeting siRNAs. Three days after transfection, cells were harvested or infected with NL43-Luci/VSV-G virus. SAMHD1 mRNA expression levels in harvested cells were detected by real-time RT-PCR and normalized against GAPDH. Data are shown as mean ± SD. Luciferase activity in infected cells was measured 4 days after infection. Data are plotted as the mean ± SD of triplicate samples; presented data are representative of two independent experiments using two donors. A: Results of samples obtained from a donor 1. B: Results of samples obtained from a donor 2.

    Article Snippet: For real time PCR, each 20-µL reaction mixture consisted of 5 µL of cDNA, 10 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Carlsbad, CA) and 1 µL of TaqMan Gene Ex Assays (Assay ID: Hs00210019_m1).

    Techniques: Infection, Transfection, Expressing, Quantitative RT-PCR, Luciferase, Activity Assay

    Western blot analysis of SAMHD1 in undifferentiated monocytes and macrophages. Monocytes were differentiated into macrophages for 6 days in the presence of GM-CSF or M-CSF. Macrophages or monocytes were treated with or without VSV-G-pseudotyped and Env-defective HIV-2 particles (GH123/VSV-G), and harvested. Whole-cell extracts were separated on SDS-PAGE and analyzed by western blot using the indicated antibodies. Presented data are representative of two independent experiments.

    Journal: PLoS ONE

    Article Title: Moderate Restriction of Macrophage-Tropic Human Immunodeficiency Virus Type 1 by SAMHD1 in Monocyte-Derived Macrophages

    doi: 10.1371/journal.pone.0090969

    Figure Lengend Snippet: Western blot analysis of SAMHD1 in undifferentiated monocytes and macrophages. Monocytes were differentiated into macrophages for 6 days in the presence of GM-CSF or M-CSF. Macrophages or monocytes were treated with or without VSV-G-pseudotyped and Env-defective HIV-2 particles (GH123/VSV-G), and harvested. Whole-cell extracts were separated on SDS-PAGE and analyzed by western blot using the indicated antibodies. Presented data are representative of two independent experiments.

    Article Snippet: For real time PCR, each 20-µL reaction mixture consisted of 5 µL of cDNA, 10 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Carlsbad, CA) and 1 µL of TaqMan Gene Ex Assays (Assay ID: Hs00210019_m1).

    Techniques: Western Blot, SDS Page

    Relationship of SAMHD1 transcription, Type I interferon response, and disease severity. There was a significant positive correlation of SAMHD1 transcript and level of MX1, an indicator of the Type I interferon response ( A ). Comparing Mx1 ( B ) and SAMHD1 ( C ) transcript with disease severity as assigned by pathology (none, mild, moderate, or severe), the association of Mx1 with disease appeared stronger than the association of SAMHD1 and disease. Transcript abundance was normalized to the average of beta actin and GAPDH; hence, the smaller the “dCq” value, the greater the abundance.

    Journal: Scientific Reports

    Article Title: SAMHD1 transcript upregulation during SIV infection of the central nervous system does not associate with reduced viral load

    doi: 10.1038/srep22629

    Figure Lengend Snippet: Relationship of SAMHD1 transcription, Type I interferon response, and disease severity. There was a significant positive correlation of SAMHD1 transcript and level of MX1, an indicator of the Type I interferon response ( A ). Comparing Mx1 ( B ) and SAMHD1 ( C ) transcript with disease severity as assigned by pathology (none, mild, moderate, or severe), the association of Mx1 with disease appeared stronger than the association of SAMHD1 and disease. Transcript abundance was normalized to the average of beta actin and GAPDH; hence, the smaller the “dCq” value, the greater the abundance.

    Article Snippet: Pre-designed TaqMan Assays (Applied Biosystems/Life Technologies) were used to quantitate SAMHD1, Mx1, GAPDH, and ACTB from human (Hs00210019_m1, Hs00895608_m1, Hs02758991_g1, and Hs99999903_m1, respectively) and macaque (Rh02869978_m1, Rh02842279_m1, Rh02621745_g1, and Rh03043379_gH, respectively).

    Techniques:

    Brain SAMHD1 transcript load during SIV infection. SAMHD1 transcript increased in thalamus during SIV infection, with peak expression corresponding with acute and late-stage infection. SAMHD1 mRNA was quantitated by qPCR, with normalization to the average of beta actin and GAPDH. **p

    Journal: Scientific Reports

    Article Title: SAMHD1 transcript upregulation during SIV infection of the central nervous system does not associate with reduced viral load

    doi: 10.1038/srep22629

    Figure Lengend Snippet: Brain SAMHD1 transcript load during SIV infection. SAMHD1 transcript increased in thalamus during SIV infection, with peak expression corresponding with acute and late-stage infection. SAMHD1 mRNA was quantitated by qPCR, with normalization to the average of beta actin and GAPDH. **p

    Article Snippet: Pre-designed TaqMan Assays (Applied Biosystems/Life Technologies) were used to quantitate SAMHD1, Mx1, GAPDH, and ACTB from human (Hs00210019_m1, Hs00895608_m1, Hs02758991_g1, and Hs99999903_m1, respectively) and macaque (Rh02869978_m1, Rh02842279_m1, Rh02621745_g1, and Rh03043379_gH, respectively).

    Techniques: Infection, Expressing, Real-time Polymerase Chain Reaction

    Viral load and SAMHD1. Tissue viral load as determined by standard curve-normalized qPCR did not correlate with SAMHD1 transcript (normalized to the average of beta actin and GAPDH).

    Journal: Scientific Reports

    Article Title: SAMHD1 transcript upregulation during SIV infection of the central nervous system does not associate with reduced viral load

    doi: 10.1038/srep22629

    Figure Lengend Snippet: Viral load and SAMHD1. Tissue viral load as determined by standard curve-normalized qPCR did not correlate with SAMHD1 transcript (normalized to the average of beta actin and GAPDH).

    Article Snippet: Pre-designed TaqMan Assays (Applied Biosystems/Life Technologies) were used to quantitate SAMHD1, Mx1, GAPDH, and ACTB from human (Hs00210019_m1, Hs00895608_m1, Hs02758991_g1, and Hs99999903_m1, respectively) and macaque (Rh02869978_m1, Rh02842279_m1, Rh02621745_g1, and Rh03043379_gH, respectively).

    Techniques: Real-time Polymerase Chain Reaction

    SAMHD1 and IFNB1 in primary macrophages. M×1 of primary human monocyte-derived macrophages responded rapidly and strongly to 100 U/mL treatment with recombinant IFNB1, but not to TNFalpha (20 ng/mL, ( A )). SAMHD1 also responded to IFNB1, but the increase was detectable and significant only by 12 hours post-treatment ( B ). HIV-1 (BaL) infection of primary monocyte-derived macrophages yielded an apparent increase of SAMHD1 levels by 7 and 10 days post-infection, but this increase was not statistically significant (NS) ( C ). ***p

    Journal: Scientific Reports

    Article Title: SAMHD1 transcript upregulation during SIV infection of the central nervous system does not associate with reduced viral load

    doi: 10.1038/srep22629

    Figure Lengend Snippet: SAMHD1 and IFNB1 in primary macrophages. M×1 of primary human monocyte-derived macrophages responded rapidly and strongly to 100 U/mL treatment with recombinant IFNB1, but not to TNFalpha (20 ng/mL, ( A )). SAMHD1 also responded to IFNB1, but the increase was detectable and significant only by 12 hours post-treatment ( B ). HIV-1 (BaL) infection of primary monocyte-derived macrophages yielded an apparent increase of SAMHD1 levels by 7 and 10 days post-infection, but this increase was not statistically significant (NS) ( C ). ***p

    Article Snippet: Pre-designed TaqMan Assays (Applied Biosystems/Life Technologies) were used to quantitate SAMHD1, Mx1, GAPDH, and ACTB from human (Hs00210019_m1, Hs00895608_m1, Hs02758991_g1, and Hs99999903_m1, respectively) and macaque (Rh02869978_m1, Rh02842279_m1, Rh02621745_g1, and Rh03043379_gH, respectively).

    Techniques: Derivative Assay, Recombinant, Infection

    Primary astrocyte SAMHD1 responds to SIV infection and IFNB1. Quantitative PCR results, normalized to the average of beta actin and GAPDH, indicated that SIV infection (SIV 17E-Fr) and IFNB1 treatment of primary rhesus astrocytes resulted in significant upregulation of SAMHD1 by 48 hours post infection and at all subsequent time points examined. SIV infection alone stimulated apparently significant upregulation at two and 14 days post infection. ***p

    Journal: Scientific Reports

    Article Title: SAMHD1 transcript upregulation during SIV infection of the central nervous system does not associate with reduced viral load

    doi: 10.1038/srep22629

    Figure Lengend Snippet: Primary astrocyte SAMHD1 responds to SIV infection and IFNB1. Quantitative PCR results, normalized to the average of beta actin and GAPDH, indicated that SIV infection (SIV 17E-Fr) and IFNB1 treatment of primary rhesus astrocytes resulted in significant upregulation of SAMHD1 by 48 hours post infection and at all subsequent time points examined. SIV infection alone stimulated apparently significant upregulation at two and 14 days post infection. ***p

    Article Snippet: Pre-designed TaqMan Assays (Applied Biosystems/Life Technologies) were used to quantitate SAMHD1, Mx1, GAPDH, and ACTB from human (Hs00210019_m1, Hs00895608_m1, Hs02758991_g1, and Hs99999903_m1, respectively) and macaque (Rh02869978_m1, Rh02842279_m1, Rh02621745_g1, and Rh03043379_gH, respectively).

    Techniques: Infection, Real-time Polymerase Chain Reaction