ddei restriction endonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    New England Biolabs ddei restriction endonuclease
    Ddei Restriction Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ddei restriction endonuclease/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ddei restriction endonuclease - by Bioz Stars, 2020-04
    90/100 stars

    Related Products / Commonly Used Together

    adh2
    hpaii
    p1 gene
    primers adh1

    Images

    Related Articles

    Amplification:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: There was also an initial hot start at 94°C for 3 min and a final extension at 72°C for 7 min. A secondary 826- to 864-bp PCR product (depending on the isolate) was then amplified from 2 μl of the primary PCR mixture by using primers 5′-GGAAGGGTTGTATTTATTAGATAAAG-3′ and 5′-AAGGAGTAAGGAACAACCTCCA-3′. .. Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: Equal volumes of the reverse-transcribed product from sciatic nerves of transgenic and wild-type animals were amplified in the presence of α[32 P]dATP, using a single primer pair recognizing P0 exon 2 (5′-GTCCAGTGAATGGGTCTCAG-3′) and exon 4 (5′-GCTCCCAACACCACCCCATA-3′) that flanks a DdeI site present in the P0sub transgenes only. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Amplicon size was verified on 1% agarose gel. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: The PCR products obtained by amplification of the 16S rRNA gene of H. felis , B. bacilliformis , M. genitalium , and E. suis with fHf1 and rHf2 were differentiated by RFLP. .. Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products.

    Autoradiography:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Electrophoresis:

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Incubation:

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: .. For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: The mix was incubated for 40 minutes at 37°C then 1 microliter of proteinase K was added to the mix and incubated for 15 minutes. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Activity Assay:

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: RNP in Vitro Activity ... PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Gel Purification:

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Sequencing:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: Sequencing histograms were compared using 4Peaks software. .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products. .. Dde I recognizes the sequence 5′-C▾ TNAG-3′ and cleaves at the position indicated by the arrowhead ( ).

    Activation Assay:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: PCR conditions were: initial enzyme activation at 95°C for 15 min; followed by cycles consisting of 94°C for 30 s, 63°C for 60 s, and 72°C for 60 s; and a final extension step at 72°C for 10 min, in a standard PCR reaction mix containing HotStarTaq DNA polymerase (QIAGEN). .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    RFLP Assay:

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: .. RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Generated:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Nucleic Acid Electrophoresis:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Mutagenesis:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: .. The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA). .. The DNA was digested for 1–3 h at 37 °C with one unit of DdeI enzyme per microgram of DNA per manufacturer's protocol and run on a 1% agarose gel.

    Isolation:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: 2.1 DNA mutation analysis After consent using a UCLA IRB approved protocol, a lymphoblastoid cell line was made from blood isolated from the proband and his mother as previously described . .. The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: PCR was performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo-Scientific, Waltham, MA) on isolated gDNA, with amplification parameters optimized for an amplicon size of 345bp with forward primer 5’- TCCTAAGCCAGTGCCAGAAGAG -3’ and reverse Primer 5’- CTATTGGTCTCCTTAAACCT -3' . .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Purification:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) and analyzed on a 2% TBE agarose gel.

    Polymerase Chain Reaction:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: .. Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.). .. The restriction fragments were separated by electrophoresis on agarose gels (4% NuSieve agarose [3:1] [FMC Bioproducts, Rockland, Maine] at 60 V for 2 h. Gels were photographed and fragment sizes were determined with interpolation by using the BioImage system whole-band software analysis (Millipore Corp., Ann Arbor, Mich.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen). ..

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: .. For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: To avoid the formation of heteroduplexes between the PCR products containing the additional DdeI site and those lacking this site, only cycles in the logarithmic range were chosen. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) and analyzed on a 2% TBE agarose gel.

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: .. RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Article Title: Delivery of GalNAc-Conjugated Splice-Switching ASOs to Non-hepatic Cells through Ectopic Expression of Asialoglycoprotein Receptor
    Article Snippet: .. [α-32P]-dCTP radiolabeled PCR products were digested with DdeI (NEB, Ipswich, MA, USA) for 2 h at 37°C and separated on a 5% native polyacrylamide gel (Bio-Rad, Hercules, CA, USA), analyzed on a Typhoon 9410 phosphorimager (GE Healthcare), and quantified using Multi Gauge v2.3 (Fujifilm, Tokyo, Japan). ..

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: .. Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products. .. Dde I recognizes the sequence 5′-C▾ TNAG-3′ and cleaves at the position indicated by the arrowhead ( ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Gel Extraction:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Software:

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.). .. The restriction fragments were separated by electrophoresis on agarose gels (4% NuSieve agarose [3:1] [FMC Bioproducts, Rockland, Maine] at 60 V for 2 h. Gels were photographed and fragment sizes were determined with interpolation by using the BioImage system whole-band software analysis (Millipore Corp., Ann Arbor, Mich.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: Sequencing histograms were compared using 4Peaks software. .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Agarose Gel Electrophoresis:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA). .. The DNA was digested for 1–3 h at 37 °C with one unit of DdeI enzyme per microgram of DNA per manufacturer's protocol and run on a 1% agarose gel.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Amplicon size was verified on 1% agarose gel. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    In Vitro:

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: RNP in Vitro Activity ... PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Transgenic Assay:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: Equal volumes of the reverse-transcribed product from sciatic nerves of transgenic and wild-type animals were amplified in the presence of α[32 P]dATP, using a single primer pair recognizing P0 exon 2 (5′-GTCCAGTGAATGGGTCTCAG-3′) and exon 4 (5′-GCTCCCAACACCACCCCATA-3′) that flanks a DdeI site present in the P0sub transgenes only. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Concentration Assay:

    Article Title: Delivery of GalNAc-Conjugated Splice-Switching ASOs to Non-hepatic Cells through Ectopic Expression of Asialoglycoprotein Receptor
    Article Snippet: PCR was performed with AmpliTaq polymerase (Thermo Fisher, Foster City, CA, USA) using human SMN-specific exon 6 Fwd 5′-ATAATTCCCCCACCACCTCCC-3′ and exon 8 Rev 5′-TTGCCACATACGCCTCACATAC-3′ primers at a final concentration of 250 nM. .. [α-32P]-dCTP radiolabeled PCR products were digested with DdeI (NEB, Ipswich, MA, USA) for 2 h at 37°C and separated on a 5% native polyacrylamide gel (Bio-Rad, Hercules, CA, USA), analyzed on a Typhoon 9410 phosphorimager (GE Healthcare), and quantified using Multi Gauge v2.3 (Fujifilm, Tokyo, Japan).

    Marker:

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Sizes of fragments were estimated using a standard molecular size marker (100-bp ladder; New England Biolabs).

    Staining:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs restriction endonucleases ddei
    The banding patterns for all 47 pneumococcal strains following digestion of the <t>PCR</t> product with <t>DdeI</t> are shown along with the dendrogram constructed according to the percent similarity between patterns using Bionumerics software. The group numbers were
    Restriction Endonucleases Ddei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonucleases ddei/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    restriction endonucleases ddei - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    The banding patterns for all 47 pneumococcal strains following digestion of the PCR product with DdeI are shown along with the dendrogram constructed according to the percent similarity between patterns using Bionumerics software. The group numbers were

    Journal: Journal of Clinical Microbiology

    Article Title: Use of the Agilent 2100 Bioanalyzer for Rapid and Reproducible Molecular Typing of Streptococcus pneumoniae ▿

    doi: 10.1128/JCM.02169-06

    Figure Lengend Snippet: The banding patterns for all 47 pneumococcal strains following digestion of the PCR product with DdeI are shown along with the dendrogram constructed according to the percent similarity between patterns using Bionumerics software. The group numbers were

    Article Snippet: Four hundred nanograms of each PCR product was digested separately with the restriction endonucleases DdeI, MseI, AluI, AfiIII, HaeIII, ApoI, TspRI, and TfiI (New England Biolabs, Ipswich, MA), according the manufacturer's instructions, in a total reaction mixture volume of 20 μl.

    Techniques: Polymerase Chain Reaction, Construct, Software

    PCR products of three pneumococcal strains were digested with DdeI in three separate experiments performed on different days, and the DNA fragments were analyzed using the Agilent 2100 bioanalyzer. a, b, and c show the simulated gels for experiments 1,

    Journal: Journal of Clinical Microbiology

    Article Title: Use of the Agilent 2100 Bioanalyzer for Rapid and Reproducible Molecular Typing of Streptococcus pneumoniae ▿

    doi: 10.1128/JCM.02169-06

    Figure Lengend Snippet: PCR products of three pneumococcal strains were digested with DdeI in three separate experiments performed on different days, and the DNA fragments were analyzed using the Agilent 2100 bioanalyzer. a, b, and c show the simulated gels for experiments 1,

    Article Snippet: Four hundred nanograms of each PCR product was digested separately with the restriction endonucleases DdeI, MseI, AluI, AfiIII, HaeIII, ApoI, TspRI, and TfiI (New England Biolabs, Ipswich, MA), according the manufacturer's instructions, in a total reaction mixture volume of 20 μl.

    Techniques: Polymerase Chain Reaction