dde i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    DdeI
    Description:
    DdeI 5 000 units
    Catalog Number:
    r0175l
    Price:
    282
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs dde i
    DdeI
    DdeI 5 000 units
    https://www.bioz.com/result/dde i/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dde i - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs"

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.114.011445

    Tev-mTALEN activity in HEK293T cells on an episomal target. (A) Schematic of the vectors used for co-transfection experiments. For the expression vector, the Tev-mTALEN gene is separated from the mCherry translation reporter by a T2A peptide. (B) Example of Tev-mTALEN expression vector transfection efficiency and expression in HEK293T cells, with bright field image on the left and the epifluorescent image (1-sec exposure) of the same field of view on the right. (C) Schematic of the TP15 target, with a Dde I restriction site and sizes of Dde I digestion products indicated. (D) Agarose gel of a representative assay in which the target region was amplified by PCR from total DNA isolated 48 hr after transfection, and products were digested with Dde I (+) or incubated in buffer without Dde I (−); product resistant to cleavage by Dde I, which would result from mutagenic repair after cleavage by the mTALEN, is labeled with an asterisk (*). (E) Examples of mutations in the target resulting from co-transfection with N169-T120 or D184-V152 Tev-mTALENs. The Dde I-resistant product from (C) was cloned and several clones were sequenced. Dashes indicate the length of deletions observed in individual clones relative to the wild-type sequence.
    Figure Legend Snippet: Tev-mTALEN activity in HEK293T cells on an episomal target. (A) Schematic of the vectors used for co-transfection experiments. For the expression vector, the Tev-mTALEN gene is separated from the mCherry translation reporter by a T2A peptide. (B) Example of Tev-mTALEN expression vector transfection efficiency and expression in HEK293T cells, with bright field image on the left and the epifluorescent image (1-sec exposure) of the same field of view on the right. (C) Schematic of the TP15 target, with a Dde I restriction site and sizes of Dde I digestion products indicated. (D) Agarose gel of a representative assay in which the target region was amplified by PCR from total DNA isolated 48 hr after transfection, and products were digested with Dde I (+) or incubated in buffer without Dde I (−); product resistant to cleavage by Dde I, which would result from mutagenic repair after cleavage by the mTALEN, is labeled with an asterisk (*). (E) Examples of mutations in the target resulting from co-transfection with N169-T120 or D184-V152 Tev-mTALENs. The Dde I-resistant product from (C) was cloned and several clones were sequenced. Dashes indicate the length of deletions observed in individual clones relative to the wild-type sequence.

    Techniques Used: Activity Assay, Cotransfection, Expressing, Plasmid Preparation, Transfection, Size-exclusion Chromatography, Agarose Gel Electrophoresis, Amplification, Polymerase Chain Reaction, Isolation, Incubation, Labeling, Clone Assay, Sequencing

    2) Product Images from "Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment"

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment

    Journal: Journal of Clinical Microbiology

    doi:

    PCR-RFLP of B. quintana and B. henselae from clinical specimens. Lane 1, 50-bp ladder, lanes 2 to 4, B. quintana H93-176; lanes 5 to 7, B. henselae B92-007003; lane 8, blank; lanes 9 to 11, B. quintana B93-007356; lane 12, 50-bp ladder. PCR products were left uncut (lanes 2, 5, and 9) or were cut with Dde I (lanes 3, 6, and 10) or Mse I (lanes 4, 7, and 11).
    Figure Legend Snippet: PCR-RFLP of B. quintana and B. henselae from clinical specimens. Lane 1, 50-bp ladder, lanes 2 to 4, B. quintana H93-176; lanes 5 to 7, B. henselae B92-007003; lane 8, blank; lanes 9 to 11, B. quintana B93-007356; lane 12, 50-bp ladder. PCR products were left uncut (lanes 2, 5, and 9) or were cut with Dde I (lanes 3, 6, and 10) or Mse I (lanes 4, 7, and 11).

    Techniques Used: Polymerase Chain Reaction

    3) Product Images from "Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form"

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-8-18

    PCR-RFLP of pal and detection of its gene product, PAL, from clonally diverse A. actinomycetemcomitans strains. Panel A: Agarose gel electrophoresis of the PCR products shows amplicons with the expected size of pal (425 bp) for each strain. Panels B and C: Agarose gel electrophoresis of the purified PCR amplicons digested with Dde I and Bsp MI, separately. Panel D: immunoblot analysis of the A. actinomycetemcomitans whole cell protein preparations using anti-AaPAL peptide antiserum shows the expected 17-kDa signal for each strain. Lanes 1 through 12 strain identification (serotype; genotype): ATCC 29523 (a; 1), SA5002 (a; 1), ATCC 43718 (b; 2), SA5003 (b; 8), ATCC 33384 (c; 3), SA5005 (c; 3), SA5001 (d; 5), SA5007 (d; 22), SA5008 (e; 6), SA5011 (e; 20), CU1000R (f; nd*), SA5022 (f; 19) and standards (S). *nd: not determined.
    Figure Legend Snippet: PCR-RFLP of pal and detection of its gene product, PAL, from clonally diverse A. actinomycetemcomitans strains. Panel A: Agarose gel electrophoresis of the PCR products shows amplicons with the expected size of pal (425 bp) for each strain. Panels B and C: Agarose gel electrophoresis of the purified PCR amplicons digested with Dde I and Bsp MI, separately. Panel D: immunoblot analysis of the A. actinomycetemcomitans whole cell protein preparations using anti-AaPAL peptide antiserum shows the expected 17-kDa signal for each strain. Lanes 1 through 12 strain identification (serotype; genotype): ATCC 29523 (a; 1), SA5002 (a; 1), ATCC 43718 (b; 2), SA5003 (b; 8), ATCC 33384 (c; 3), SA5005 (c; 3), SA5001 (d; 5), SA5007 (d; 22), SA5008 (e; 6), SA5011 (e; 20), CU1000R (f; nd*), SA5022 (f; 19) and standards (S). *nd: not determined.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Purification

    4) Product Images from "Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis"

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis

    Journal: Journal of Clinical Microbiology

    doi:

    Restriction profiles obtained after Dde I and Mnl I digestion of the 16S rRNA gene amplified with the universal primer set fHf1 and rHf1. Lanes: 1 to 4, Dde I digests of H. felis , B. bacilliformis , M. genitalium , and E. suis , respectively; 5 to 8, Mnl I digests of H. felis , B. bacilliformis , M. genitalium , and E. suis , respectively; M 1 and M 2 , molecular size markers (base pair values are indicated in the left and right margins).
    Figure Legend Snippet: Restriction profiles obtained after Dde I and Mnl I digestion of the 16S rRNA gene amplified with the universal primer set fHf1 and rHf1. Lanes: 1 to 4, Dde I digests of H. felis , B. bacilliformis , M. genitalium , and E. suis , respectively; 5 to 8, Mnl I digests of H. felis , B. bacilliformis , M. genitalium , and E. suis , respectively; M 1 and M 2 , molecular size markers (base pair values are indicated in the left and right margins).

    Techniques Used: Amplification

    5) Product Images from "Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater"

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.67.3.1097-1101.2001

    Genotyping of Cryptosporidium oocysts in water with a SSU rRNA-based PCR-RFLP technique. (A) Differentiation of Cryptosporidium spp. and C. parvum genotypes by digestion of the secondary PCR products with Ssp I (upper panel) and Vsp I (lower panel). Lane 1, C. parvum human genotype (sample 574); lane 2, C. parvum bovine genotype (sample 5F); lanes 3 and 4, C. parvum human and bovine genotypes (samples 1F and 2F); lane 5, C. andersoni (sample 104); lane 6, C. muris (sample 194); lane 7, C. parvum bovine genotype and C. andersoni (sample 163). (B) Differentiation of C. andersoni from C. muris by digestion of the secondary PCR products with Dde I. Lanes 1 through 4 and 6 through 8, C. andersoni (samples 104, 99, 98, 641, 192, 224, and 225); lane 5, C. muris (sample 194).
    Figure Legend Snippet: Genotyping of Cryptosporidium oocysts in water with a SSU rRNA-based PCR-RFLP technique. (A) Differentiation of Cryptosporidium spp. and C. parvum genotypes by digestion of the secondary PCR products with Ssp I (upper panel) and Vsp I (lower panel). Lane 1, C. parvum human genotype (sample 574); lane 2, C. parvum bovine genotype (sample 5F); lanes 3 and 4, C. parvum human and bovine genotypes (samples 1F and 2F); lane 5, C. andersoni (sample 104); lane 6, C. muris (sample 194); lane 7, C. parvum bovine genotype and C. andersoni (sample 163). (B) Differentiation of C. andersoni from C. muris by digestion of the secondary PCR products with Dde I. Lanes 1 through 4 and 6 through 8, C. andersoni (samples 104, 99, 98, 641, 192, 224, and 225); lane 5, C. muris (sample 194).

    Techniques Used: Polymerase Chain Reaction

    Related Articles

    Amplification:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: There was also an initial hot start at 94°C for 3 min and a final extension at 72°C for 7 min. A secondary 826- to 864-bp PCR product (depending on the isolate) was then amplified from 2 μl of the primary PCR mixture by using primers 5′-GGAAGGGTTGTATTTATTAGATAAAG-3′ and 5′-AAGGAGTAAGGAACAACCTCCA-3′. .. Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: PSF contacts exon 7 of SMN2 pre-mRNA to promote exon 7 inclusion
    Article Snippet: RT-PCR amplification of PSF and the control GAPDH was conducted with PSF.F, PSF.R, GAPDH.F and GAPDH.R as primers. .. PCR products were digested with DdeI (NEB) and loaded onto 5% native polyacrylamide gels for detection.

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: Equal volumes of the reverse-transcribed product from sciatic nerves of transgenic and wild-type animals were amplified in the presence of α[32 P]dATP, using a single primer pair recognizing P0 exon 2 (5′-GTCCAGTGAATGGGTCTCAG-3′) and exon 4 (5′-GCTCCCAACACCACCCCATA-3′) that flanks a DdeI site present in the P0sub transgenes only. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Amplicon size was verified on 1% agarose gel. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: The PCR products obtained by amplification of the 16S rRNA gene of H. felis , B. bacilliformis , M. genitalium , and E. suis with fHf1 and rHf2 were differentiated by RFLP. .. Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products.

    Autoradiography:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Electrophoresis:

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Incubation:

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: .. For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: The mix was incubated for 40 minutes at 37°C then 1 microliter of proteinase K was added to the mix and incubated for 15 minutes. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Activity Assay:

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: RNP in Vitro Activity ... PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Expressing:

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: In the study laboratory, line SC233 displays classic human ESC morphology in typical culture conditions and has a high level of expression for pluripotency markers (e.g., alkaline phosphatase, SSEA3, SSEA4, TRA-1–60, TRA-1–81 and OCT4 (ES Cell Marker Kit; Chemicon). .. The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA.

    Gel Purification:

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Sequencing:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: Sequencing histograms were compared using 4Peaks software. .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products. .. Dde I recognizes the sequence 5′-C▾ TNAG-3′ and cleaves at the position indicated by the arrowhead ( ).

    Activation Assay:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: PCR conditions were: initial enzyme activation at 95°C for 15 min; followed by cycles consisting of 94°C for 30 s, 63°C for 60 s, and 72°C for 60 s; and a final extension step at 72°C for 10 min, in a standard PCR reaction mix containing HotStarTaq DNA polymerase (QIAGEN). .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Cell Culture:

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: Line SC233, as well as control H1 (WA01) and H9 (WA09) lines obtained from WiCell, were cultured in standard conditions. .. The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA.

    RFLP Assay:

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: .. RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Generated:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    DNA Sequencing:

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA. .. The SCD AT transversion point mutation was further confirmed by direct DNA sequencing of the PCR-amplified beta-globin locus.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: PSF contacts exon 7 of SMN2 pre-mRNA to promote exon 7 inclusion
    Article Snippet: Paragraph title: 2.3. RT-PCR ... PCR products were digested with DdeI (NEB) and loaded onto 5% native polyacrylamide gels for detection.

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Nucleic Acid Electrophoresis:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Mutagenesis:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: PSF contacts exon 7 of SMN2 pre-mRNA to promote exon 7 inclusion
    Article Snippet: The PCR primers for SMN2-ΔE7-1, SMN2-ΔE7-2, SMN2-ΔE7-3 and SMN2-E7-UUA mutant minigenes are SMN.F and pcDNA.R. .. PCR products were digested with DdeI (NEB) and loaded onto 5% native polyacrylamide gels for detection.

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: .. The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA. .. The SCD AT transversion point mutation was further confirmed by direct DNA sequencing of the PCR-amplified beta-globin locus.

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: .. The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA). .. The DNA was digested for 1–3 h at 37 °C with one unit of DdeI enzyme per microgram of DNA per manufacturer's protocol and run on a 1% agarose gel.

    Isolation:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: For mutation detection in the pUB-Cas9-@GL1 lines, plant genomic DNA was isolated and the targeted region in the GL1 gene was amplified with the primers FH189/FH190 (Supplementary Table ) using the proofreading Phusion© polymerase (NewEngland Biolabs). .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA. .. Genomic DNA from SC233 and control H1 human ESC was isolated using DNeasy reagents (Qiagen).

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: 2.1 DNA mutation analysis After consent using a UCLA IRB approved protocol, a lymphoblastoid cell line was made from blood isolated from the proband and his mother as previously described . .. The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: PCR was performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo-Scientific, Waltham, MA) on isolated gDNA, with amplification parameters optimized for an amplicon size of 345bp with forward primer 5’- TCCTAAGCCAGTGCCAGAAGAG -3’ and reverse Primer 5’- CTATTGGTCTCCTTAAACCT -3' . .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Purification:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) and analyzed on a 2% TBE agarose gel.

    Polymerase Chain Reaction:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: .. Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.). .. The restriction fragments were separated by electrophoresis on agarose gels (4% NuSieve agarose [3:1] [FMC Bioproducts, Rockland, Maine] at 60 V for 2 h. Gels were photographed and fragment sizes were determined with interpolation by using the BioImage system whole-band software analysis (Millipore Corp., Ann Arbor, Mich.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen). ..

    Article Title: PSF contacts exon 7 of SMN2 pre-mRNA to promote exon 7 inclusion
    Article Snippet: .. PCR products were digested with DdeI (NEB) and loaded onto 5% native polyacrylamide gels for detection. .. Transient transfection of cells was performed with polyethyleneimide (PEI) reagent.

    Article Title: Use of the Agilent 2100 Bioanalyzer for Rapid and Reproducible Molecular Typing of Streptococcus pneumoniae ▿
    Article Snippet: .. Four hundred nanograms of each PCR product was digested separately with the restriction endonucleases DdeI, MseI, AluI, AfiIII, HaeIII, ApoI, TspRI, and TfiI (New England Biolabs, Ipswich, MA), according the manufacturer's instructions, in a total reaction mixture volume of 20 μl. .. Following digestion with DdeI, MseI, or AluI, the samples were heated to 65°C for 20 min, following digestion with the other enzymes to 80°C for 20 min, and then cooled on ice for 10 min to disrupt aggregates of DNA ( ) before 1 μl of the digestion product was analyzed using the Agilent 2100 bioanalyzer according to the manufacturer's protocol.

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: .. For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: .. After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: .. The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA. .. The SCD AT transversion point mutation was further confirmed by direct DNA sequencing of the PCR-amplified beta-globin locus.

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: To avoid the formation of heteroduplexes between the PCR products containing the additional DdeI site and those lacking this site, only cycles in the logarithmic range were chosen. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) and analyzed on a 2% TBE agarose gel.

    Article Title: A PCR-RFLP assay to detect and type cytolethal distending toxin (cdt) genes in Campylobacterhyointestinalis
    Article Snippet: .. RFLP assay PCR products (2 to 5 µl ; 100 to 200 ng ) were digested with either 4 U of EcoT14-I or 2 U of EcoT14-I and 2 U of DdeI (New England Biolabs Inc., Ipswich, MA, U.S.A.) under 1 ×H buffer or 1 ×K buffer (Takara Bio Inc.) in a final volume of 10 µl at 37°C overnight. .. Then, the digested PCR products were analyzed by 3% PrimeGel™ Agarose LE gel electrophoresis as described above.

    Article Title: Delivery of GalNAc-Conjugated Splice-Switching ASOs to Non-hepatic Cells through Ectopic Expression of Asialoglycoprotein Receptor
    Article Snippet: .. [α-32P]-dCTP radiolabeled PCR products were digested with DdeI (NEB, Ipswich, MA, USA) for 2 h at 37°C and separated on a 5% native polyacrylamide gel (Bio-Rad, Hercules, CA, USA), analyzed on a Typhoon 9410 phosphorimager (GE Healthcare), and quantified using Multi Gauge v2.3 (Fujifilm, Tokyo, Japan). ..

    Article Title: Development and Evaluation of a PCR-Based Assay for Detection of Haemobartonella felis in Cats and Differentiation of H. felis from Related Bacteria by Restriction Fragment Length Polymorphism Analysis
    Article Snippet: .. Two restriction enzymes, Dde I and Mnl I (New England Biolabs, Beverly, Mass.), were used according to the manufacturer’s recommendations to digest the PCR products. .. Dde I recognizes the sequence 5′-C▾ TNAG-3′ and cleaves at the position indicated by the arrowhead ( ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Gel Extraction:

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form
    Article Snippet: .. PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis. ..

    Software:

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.). .. The restriction fragments were separated by electrophoresis on agarose gels (4% NuSieve agarose [3:1] [FMC Bioproducts, Rockland, Maine] at 60 V for 2 h. Gels were photographed and fragment sizes were determined with interpolation by using the BioImage system whole-band software analysis (Millipore Corp., Ann Arbor, Mich.).

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: Sequencing histograms were compared using 4Peaks software. .. The PCR product was then either digested with DdeI (NewEngland Biolabs) for detection of restriction digest length polymorphisms or Sanger sequenced (Macrogen).

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography. .. Intensity of the bands was quantified by densitometry of phosphorimager signals (Fujix BAS 2000; Fuji) using TINA 2.09 software (Raytest), and the ratio between the transgene-specific 228-bp fragment and the endogene-specific 245-bp fragment was calculated.

    Agarose Gel Electrophoresis:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Article Title: Gestational diabetes associated with a novel mutation (378–379insTT) in the glycerol kinase gene
    Article Snippet: The insTT mutation was confirmed by restriction fragment polymorphism with the DdeI restriction enzyme (New England Biolabs, Ipswich, MA). .. The DNA was digested for 1–3 h at 37 °C with one unit of DdeI enzyme per microgram of DNA per manufacturer's protocol and run on a 1% agarose gel.

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Amplicon size was verified on 1% agarose gel. .. PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    In Vitro:

    Article Title: Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: RNP in Vitro Activity ... PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with DdeI restriction enzyme (NEB, Ipswich, MA) following the manufacturer’s protocol or RNP following the method described above.

    Transgenic Assay:

    Article Title: Pathology of a mouse mutation in peripheral myelin protein P0 is characteristic of a severe and early onset form of human Charcot-Marie-Tooth type 1B disorder
    Article Snippet: Equal volumes of the reverse-transcribed product from sciatic nerves of transgenic and wild-type animals were amplified in the presence of α[32 P]dATP, using a single primer pair recognizing P0 exon 2 (5′-GTCCAGTGAATGGGTCTCAG-3′) and exon 4 (5′-GCTCCCAACACCACCCCATA-3′) that flanks a DdeI site present in the P0sub transgenes only. .. 4 μl of the purified RT-PCR products was digested with DdeI (New England Biolabs) at 37°C for 90 min. DNA fragments were resolved by PAGE and visualized both by phosphorimaging and by autoradiography.

    Concentration Assay:

    Article Title: Delivery of GalNAc-Conjugated Splice-Switching ASOs to Non-hepatic Cells through Ectopic Expression of Asialoglycoprotein Receptor
    Article Snippet: PCR was performed with AmpliTaq polymerase (Thermo Fisher, Foster City, CA, USA) using human SMN-specific exon 6 Fwd 5′-ATAATTCCCCCACCACCTCCC-3′ and exon 8 Rev 5′-TTGCCACATACGCCTCACATAC-3′ primers at a final concentration of 250 nM. .. [α-32P]-dCTP radiolabeled PCR products were digested with DdeI (NEB, Ipswich, MA, USA) for 2 h at 37°C and separated on a 5% native polyacrylamide gel (Bio-Rad, Hercules, CA, USA), analyzed on a Typhoon 9410 phosphorimager (GE Healthcare), and quantified using Multi Gauge v2.3 (Fujifilm, Tokyo, Japan).

    Marker:

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Sizes of fragments were estimated using a standard molecular size marker (100-bp ladder; New England Biolabs).

    Article Title: Erythropoietic differentiation of a human embryonic stem cell line harbouring the sickle cell anaemia mutation
    Article Snippet: In the study laboratory, line SC233 displays classic human ESC morphology in typical culture conditions and has a high level of expression for pluripotency markers (e.g., alkaline phosphatase, SSEA3, SSEA4, TRA-1–60, TRA-1–81 and OCT4 (ES Cell Marker Kit; Chemicon). .. The SCD beta-6 mutation in line SC233 was detected by DdeI (New England Biolabs) restriction digest of PCR-amplified genomic DNA.

    Staining:

    Article Title: Molecular Characterization of Cryptosporidium Oocysts in Samples of Raw Surface Water and Wastewater
    Article Snippet: Because C. andersoni and C. muris had identical Ssp I and Vsp I restriction patterns, they were differentiated by digesting secondary PCR products with 20 U of Dde I (New England BioLabs) at 37°C for 1 h under conditions recommended by the supplier. .. Digested products were fractionated on a 2.0% agarose gel and visualized by ethidium bromide staining.

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment
    Article Snippet: The amplified products were detected by electrophoresis on a 1% agarose gel (14 by 14 cm) in 1× Tris-borate-EDTA buffer at 100 V for 60 min. Gels were stained with ethidium bromide and photographed. .. For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Article Title: Yeast Community Structures and Dynamics in Healthy and Botrytis-Affected Grape Must Fermentations ▿
    Article Snippet: For restriction reactions of the 5.8S ITS region, approximately 500 ng of PCR product was incubated for 1 h at 37°C with 10 U of HinfI, HaeIII, HhaI, DraI (Takara, Japan), or DdeI (New England Biolabs) restriction endonuclease. .. Restriction fragments were separated by gel electrophoresis on a 3% (wt/vol) agarose gel, detected by ethidium bromide staining, and photographed.

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs
    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°. .. Digests were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide before analysis on an AlphaImager3400 (Alpha Innotech).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs dde i
    Tev-mTALEN activity in HEK293T cells on an episomal target. (A) Schematic of the vectors used for co-transfection experiments. For the expression vector, the Tev-mTALEN gene is separated from the mCherry translation reporter by a T2A peptide. (B) Example of Tev-mTALEN expression vector transfection efficiency and expression in HEK293T cells, with bright field image on the left and the epifluorescent image (1-sec exposure) of the same field of view on the right. (C) Schematic of the TP15 target, with a <t>Dde</t> I restriction site and sizes of Dde I digestion products indicated. (D) Agarose gel of a representative assay in which the target region was amplified by <t>PCR</t> from total DNA isolated 48 hr after transfection, and products were digested with Dde I (+) or incubated in buffer without Dde I (−); product resistant to cleavage by Dde I, which would result from mutagenic repair after cleavage by the mTALEN, is labeled with an asterisk (*). (E) Examples of mutations in the target resulting from co-transfection with N169-T120 or D184-V152 Tev-mTALENs. The Dde I-resistant product from (C) was cloned and several clones were sequenced. Dashes indicate the length of deletions observed in individual clones relative to the wild-type sequence.
    Dde I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dde i/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dde i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    89
    New England Biolabs restriction enzyme dde i
    Genetic and structural analysis of the m.15533A > G mutation. (A) Electropherogram showing the nucleotide change in patient's muscle DNA, indicated by arrowheads. (B) PCR-RFLP analysis of the MT-CYB mutation. Uncut (wild-type) DNA consists of a 150 bp PCR product. The mutated sequence contains one <t>Dde</t> I restriction site that results in two products of 90 and 60 bp after digestion. The control sequence contains one Mse I restriction site that results in the same two products after digestion. C, wild-type control; F, proband's fibroblasts DNA; M, proband's muscle DNA; Cy, control cybrid; 1, 2 and 3 refer to three independent mutant cybrid clones. (C) Alignment of cytochrome b amino acid sequences from selected species. Asparagine at amino acid position 263 is indicated with an arrow. (D) Partial 3D-images of the cytochrome b protein. The left panel shows the interaction site between the asparagine 263 (indicated in red) of cytochrome b and the aspartate 2 of the cytochrome c1 subunit (coloured in green). This is the closest negatively charged side-chain of cytochrome c1, which is facing the same aqueous pocket at a distance of 11.25 Armstrongs. Asparagine at position 260 of cytochrome b is indicated in blue. The central panel shows the 3D-structure of the asparagine 263 (in blue) in controls. The right panel shows the predicted structural effect of the N263D substitution (in red) in the patient. The images were obtained using the Chimera software [20] .
    Restriction Enzyme Dde I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme dde i/product/New England Biolabs
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme dde i - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results


    Tev-mTALEN activity in HEK293T cells on an episomal target. (A) Schematic of the vectors used for co-transfection experiments. For the expression vector, the Tev-mTALEN gene is separated from the mCherry translation reporter by a T2A peptide. (B) Example of Tev-mTALEN expression vector transfection efficiency and expression in HEK293T cells, with bright field image on the left and the epifluorescent image (1-sec exposure) of the same field of view on the right. (C) Schematic of the TP15 target, with a Dde I restriction site and sizes of Dde I digestion products indicated. (D) Agarose gel of a representative assay in which the target region was amplified by PCR from total DNA isolated 48 hr after transfection, and products were digested with Dde I (+) or incubated in buffer without Dde I (−); product resistant to cleavage by Dde I, which would result from mutagenic repair after cleavage by the mTALEN, is labeled with an asterisk (*). (E) Examples of mutations in the target resulting from co-transfection with N169-T120 or D184-V152 Tev-mTALENs. The Dde I-resistant product from (C) was cloned and several clones were sequenced. Dashes indicate the length of deletions observed in individual clones relative to the wild-type sequence.

    Journal: G3: Genes|Genomes|Genetics

    Article Title: The I-TevI Nuclease and Linker Domains Contribute to the Specificity of Monomeric TALENs

    doi: 10.1534/g3.114.011445

    Figure Lengend Snippet: Tev-mTALEN activity in HEK293T cells on an episomal target. (A) Schematic of the vectors used for co-transfection experiments. For the expression vector, the Tev-mTALEN gene is separated from the mCherry translation reporter by a T2A peptide. (B) Example of Tev-mTALEN expression vector transfection efficiency and expression in HEK293T cells, with bright field image on the left and the epifluorescent image (1-sec exposure) of the same field of view on the right. (C) Schematic of the TP15 target, with a Dde I restriction site and sizes of Dde I digestion products indicated. (D) Agarose gel of a representative assay in which the target region was amplified by PCR from total DNA isolated 48 hr after transfection, and products were digested with Dde I (+) or incubated in buffer without Dde I (−); product resistant to cleavage by Dde I, which would result from mutagenic repair after cleavage by the mTALEN, is labeled with an asterisk (*). (E) Examples of mutations in the target resulting from co-transfection with N169-T120 or D184-V152 Tev-mTALENs. The Dde I-resistant product from (C) was cloned and several clones were sequenced. Dashes indicate the length of deletions observed in individual clones relative to the wild-type sequence.

    Article Snippet: After gel purification, 250 ng of each PCR product was incubated with 2 U of Dde I (N.E.B.) in 1× NEBuffer 2 for 1 hr at 37°.

    Techniques: Activity Assay, Cotransfection, Expressing, Plasmid Preparation, Transfection, Size-exclusion Chromatography, Agarose Gel Electrophoresis, Amplification, Polymerase Chain Reaction, Isolation, Incubation, Labeling, Clone Assay, Sequencing

    PCR-RFLP of B. quintana and B. henselae from clinical specimens. Lane 1, 50-bp ladder, lanes 2 to 4, B. quintana H93-176; lanes 5 to 7, B. henselae B92-007003; lane 8, blank; lanes 9 to 11, B. quintana B93-007356; lane 12, 50-bp ladder. PCR products were left uncut (lanes 2, 5, and 9) or were cut with Dde I (lanes 3, 6, and 10) or Mse I (lanes 4, 7, and 11).

    Journal: Journal of Clinical Microbiology

    Article Title: Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment

    doi:

    Figure Lengend Snippet: PCR-RFLP of B. quintana and B. henselae from clinical specimens. Lane 1, 50-bp ladder, lanes 2 to 4, B. quintana H93-176; lanes 5 to 7, B. henselae B92-007003; lane 8, blank; lanes 9 to 11, B. quintana B93-007356; lane 12, 50-bp ladder. PCR products were left uncut (lanes 2, 5, and 9) or were cut with Dde I (lanes 3, 6, and 10) or Mse I (lanes 4, 7, and 11).

    Article Snippet: For digestion of PCR-amplified DNA from cultures and clinical specimens, 10 to 15 μl of PCR-amplified DNA was restricted with 10 U of Dde I and Mse I in a total volume of 15 to 20 μl, respectively, according to the manufacturer's specifications (New England Biolabs, Inc., Beverly, Mass.).

    Techniques: Polymerase Chain Reaction

    PCR-RFLP of pal and detection of its gene product, PAL, from clonally diverse A. actinomycetemcomitans strains. Panel A: Agarose gel electrophoresis of the PCR products shows amplicons with the expected size of pal (425 bp) for each strain. Panels B and C: Agarose gel electrophoresis of the purified PCR amplicons digested with Dde I and Bsp MI, separately. Panel D: immunoblot analysis of the A. actinomycetemcomitans whole cell protein preparations using anti-AaPAL peptide antiserum shows the expected 17-kDa signal for each strain. Lanes 1 through 12 strain identification (serotype; genotype): ATCC 29523 (a; 1), SA5002 (a; 1), ATCC 43718 (b; 2), SA5003 (b; 8), ATCC 33384 (c; 3), SA5005 (c; 3), SA5001 (d; 5), SA5007 (d; 22), SA5008 (e; 6), SA5011 (e; 20), CU1000R (f; nd*), SA5022 (f; 19) and standards (S). *nd: not determined.

    Journal: BMC Microbiology

    Article Title: Vesicle-independent extracellular release of a proinflammatory outer membrane lipoprotein in free-soluble form

    doi: 10.1186/1471-2180-8-18

    Figure Lengend Snippet: PCR-RFLP of pal and detection of its gene product, PAL, from clonally diverse A. actinomycetemcomitans strains. Panel A: Agarose gel electrophoresis of the PCR products shows amplicons with the expected size of pal (425 bp) for each strain. Panels B and C: Agarose gel electrophoresis of the purified PCR amplicons digested with Dde I and Bsp MI, separately. Panel D: immunoblot analysis of the A. actinomycetemcomitans whole cell protein preparations using anti-AaPAL peptide antiserum shows the expected 17-kDa signal for each strain. Lanes 1 through 12 strain identification (serotype; genotype): ATCC 29523 (a; 1), SA5002 (a; 1), ATCC 43718 (b; 2), SA5003 (b; 8), ATCC 33384 (c; 3), SA5005 (c; 3), SA5001 (d; 5), SA5007 (d; 22), SA5008 (e; 6), SA5011 (e; 20), CU1000R (f; nd*), SA5022 (f; 19) and standards (S). *nd: not determined.

    Article Snippet: PCR-restriction fragment length polymorphism (PCR-RFLP) of the A. actinomycetemcomitans pal sequence For RFLP, PCR amplicons generated by the primers PAL-SA 5'-GCTGGTTCTGTGGCTGTGT and PAL-MK 5'-ACTGCACGACGGTTTTTAGC were purified (QIAquick® Gel Extraction Kit, Qiagen GmbH, Helden, Germany) and digested with Bsp MI and Dde I (New England BioLabs, Beverly, MA, USA), respectively, prior to analysis on agarose (1.8%) gel electrophoresis.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Purification

    Genetic and structural analysis of the m.15533A > G mutation. (A) Electropherogram showing the nucleotide change in patient's muscle DNA, indicated by arrowheads. (B) PCR-RFLP analysis of the MT-CYB mutation. Uncut (wild-type) DNA consists of a 150 bp PCR product. The mutated sequence contains one Dde I restriction site that results in two products of 90 and 60 bp after digestion. The control sequence contains one Mse I restriction site that results in the same two products after digestion. C, wild-type control; F, proband's fibroblasts DNA; M, proband's muscle DNA; Cy, control cybrid; 1, 2 and 3 refer to three independent mutant cybrid clones. (C) Alignment of cytochrome b amino acid sequences from selected species. Asparagine at amino acid position 263 is indicated with an arrow. (D) Partial 3D-images of the cytochrome b protein. The left panel shows the interaction site between the asparagine 263 (indicated in red) of cytochrome b and the aspartate 2 of the cytochrome c1 subunit (coloured in green). This is the closest negatively charged side-chain of cytochrome c1, which is facing the same aqueous pocket at a distance of 11.25 Armstrongs. Asparagine at position 260 of cytochrome b is indicated in blue. The central panel shows the 3D-structure of the asparagine 263 (in blue) in controls. The right panel shows the predicted structural effect of the N263D substitution (in red) in the patient. The images were obtained using the Chimera software [20] .

    Journal: PLoS ONE

    Article Title: Impact of the Mitochondrial Genetic Background in Complex III Deficiency

    doi: 10.1371/journal.pone.0012801

    Figure Lengend Snippet: Genetic and structural analysis of the m.15533A > G mutation. (A) Electropherogram showing the nucleotide change in patient's muscle DNA, indicated by arrowheads. (B) PCR-RFLP analysis of the MT-CYB mutation. Uncut (wild-type) DNA consists of a 150 bp PCR product. The mutated sequence contains one Dde I restriction site that results in two products of 90 and 60 bp after digestion. The control sequence contains one Mse I restriction site that results in the same two products after digestion. C, wild-type control; F, proband's fibroblasts DNA; M, proband's muscle DNA; Cy, control cybrid; 1, 2 and 3 refer to three independent mutant cybrid clones. (C) Alignment of cytochrome b amino acid sequences from selected species. Asparagine at amino acid position 263 is indicated with an arrow. (D) Partial 3D-images of the cytochrome b protein. The left panel shows the interaction site between the asparagine 263 (indicated in red) of cytochrome b and the aspartate 2 of the cytochrome c1 subunit (coloured in green). This is the closest negatively charged side-chain of cytochrome c1, which is facing the same aqueous pocket at a distance of 11.25 Armstrongs. Asparagine at position 260 of cytochrome b is indicated in blue. The central panel shows the 3D-structure of the asparagine 263 (in blue) in controls. The right panel shows the predicted structural effect of the N263D substitution (in red) in the patient. The images were obtained using the Chimera software [20] .

    Article Snippet: To quantify the heteroplasmy levels of the m.15533 A > G mutation, PCR-restriction fragment length polymorphism (RFLP) analysis was performed in the proband's family using the following primers: 5′-CACTATTCTCACCAGACCTC-3′ , (forward) and 5′-ACGCCTCCTAGTTTGTTAGG-3′ (reverse), and digestion with the restriction enzyme Dde I (New England Biolabs).

    Techniques: Mutagenesis, Polymerase Chain Reaction, Sequencing, Software