dcm e coli  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    dam dcm Competent E coli
    Description:
    dam dcm Competent E coli 20x0 05 ml
    Catalog Number:
    C2925H
    Price:
    244
    Size:
    1 ml
    Category:
    Competent Bacteria
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs dcm e coli
    dam dcm Competent E coli
    dam dcm Competent E coli 20x0 05 ml
    https://www.bioz.com/result/dcm e coli/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dcm e coli - by Bioz Stars, 2019-10
    92/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The K28/43 IgG1 recombinant R-mAb plasmid was derived from the P1316 plasmid ( ) by restriction enzyme-based cloning of K28/43 variable region sequences as described above. .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Amplification:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The mouse γ2a CH domain was amplified from the cDNA preparation that was obtained from the K28/43 (RRID: AB_2292909 ) hybridoma ( ; ) that was used for cloning of the K28/43 VL and VH domains. .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Agarose Gel Electrophoresis:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Methylation:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925). .. T4 DNA ligase (New England Biolabs Cat# M0202) was used to insert the IgG2a CH fragment into the digested K28/43R plasmid to generate a K28/43 IgG2a R-mAb plasmid, which was confirmed by DNA sequencing.

    Purification:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Plasmid Preparation:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925). .. T4 DNA ligase (New England Biolabs Cat# M0202) was used to insert the IgG2a CH fragment into the digested K28/43R plasmid to generate a K28/43 IgG2a R-mAb plasmid, which was confirmed by DNA sequencing.

    Expressing:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: Paragraph title: Generation of a mouse IgG2a expression vector ... Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Polymerase Chain Reaction:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Gel Extraction:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Recombinant:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The IgG2a CH PCR product and the K28/43 IgG1 recombinant plasmid were both digested with AscI and XbaI restriction enzymes (New England BioLabs Cat# R0558 and R0145, respectively) and column purified (Qiagen/QiaQuick PCR Purification Cat# 28106) or agarose gel purified, respectively (Qiagen/QiaQuick Gel Extraction Cat# 28706). .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Derivative Assay:

    Article Title: A toolbox of IgG subclass-switched recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain
    Article Snippet: The K28/43 IgG1 recombinant R-mAb plasmid was derived from the P1316 plasmid ( ) by restriction enzyme-based cloning of K28/43 variable region sequences as described above. .. Because XbaI is methylation sensitive, the K28/43 IgG1 plasmid was sourced from dam- /dcm- E. coli (New England Biolabs Cat# C2925).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs dam dcm competent e coli
    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam− <t>/dcm−</t> E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).
    Dam Dcm Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam dcm competent e coli/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    dam dcm competent e coli - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    92
    New England Biolabs dcm e coli
    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam− <t>/dcm−</t> E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).
    Dcm E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dcm e coli/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dcm e coli - by Bioz Stars, 2019-10
    92/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam− /dcm− E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Journal:

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis

    doi: 10.1002/cpmc.31

    Figure Lengend Snippet: Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam− /dcm− E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Article Snippet: pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A.

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Construct, Homologous Recombination, Selection, Marker, Transformation Assay