dcm e coli  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    dam dcm Competent E coli
    dam dcm Competent E coli 20x0 05 ml
    Catalog Number:
    1 ml
    Competent Bacteria
    Buy from Supplier

    Structured Review

    New England Biolabs dcm e coli
    dam dcm Competent E coli
    dam dcm Competent E coli 20x0 05 ml
    https://www.bioz.com/result/dcm e coli/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dcm e coli - by Bioz Stars, 2020-02
    95/100 stars


    Related Articles

    Acetylene Reduction Assay:

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. The 2.7 kb Xba I-Xma I fragment of pDS132 [ ] containing sacB and cat was then purified, blunted with Klenow enzyme, and ligated with the Msc I-digested pCM432 vector to generate pCM433 (see Figure ).


    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The CFTR channel and pH sensor contained in the plasmid pcDNA3-ClopHensor (Addgene, Cambridge, MA, ) were amplified by polymerase chain reaction (PCR) producing a 2.455-kb product. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: Finally, a 443-bp fragment spanning the upstream region of the groES gene on chromosome I of B. pseudomallei strain K96243 (BPSL2698) was PCR amplified using primers groESprom-fw (5'-CTT GAGCTC GAACGTCGATTCGGACGCAT-3') and groESprom-rv (5'-GCGG ACTAGT ATTCACTCCTCTCTTTGATT-3'), which included Sac I and Spe I restriction sites, respectively. .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The GFP variant mClover was PCR amplified with primers containing SV40-NLS from pNCS-mClover3 (Addgene).

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. All PCR amplified regions were sequenced at the Dartmouth Molecular Biology Core Facility to verify PCR fidelity.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Reporter Assay:

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Two yeast reporter strains, YM4271[p53HIS] and YM4271 [p53BLUE], were created according to the Matchmaker One-hybrid System User Manual (Clontech, Palo Alto, CA, USA) for reporter assay analysis in the MY1H.

    Clone Assay:

    Article Title: AhR/Arnt:XRE interaction: Turning false negatives into true positives in the modified yeast one-hybrid assay
    Article Snippet: .. Escherichia coli SURE strain (Stop Unwanted Rearrangement Events, Stratagene, La Jolla, CA, USA) or dam − / dcm − C2925 (New England Biolabs) was used for standard cloning and rescue of plasmids from yeast cells. .. SURE cells were used for routine cloning of DNA with secondary structures likely to be rearranged or deleted in conventional strains.

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: Construction of plasmids and generation of strains In order to generate the allelic exchange vector pCM433, the Km resistance cassette of pCM184 [ ] was excised with Nde I and Sac II, and the remaining 5.4 kb vector backbone was ligated together with a synthetic linker designed to introduce three additional, unique cloning sites into the final vector (Pst I, Xho I, and Not I). .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site.

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: The PCR product was cloned into pBHR1-RFP via its Sac I/Spe I sites, resulting in plasmid pBHR1-groS-RFP (KmR , CmR ). .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The fragments containing NLS transport signal and florescent protein were cloned in frame N-terminally of AGO2 coding sequence. .. The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: For gap repair cloning, DNA was transformed into yeast via a modified Lazy Bones protocol [ , ] and assembled into a contiguous piece of DNA via yeast homologous recombination. .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs).

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: The spliced product, in which the native cetZ promoter was swapped for Ptna , was cloned between the HindIII-BamHI sites of pTA131. .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: .. Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 MATa, ura3 – 52, his3 – 200, ade2 – 101, lys2 – 801, leu2 – 3, 112, trp1 – 901, tyr1 – 501, gal4 -Δ 512, gal80-Δ 538 , ade5::hisG ] was used for plasmid construction via homologous recombination and reporter strain construction.

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: PCR products and pxxLAI-3DΔnp were digested with Bcl I and Sgr AI to form 1.89 kb full-length RT inserts and a 9.87 kb pxxLAI-3D cloning vector. .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: .. Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating. .. All restriction and DNA polymerase enzymes were from Fermentas and used according to the manufacturer's recommendations.


    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: Paragraph title: Construction of the Lentiviral Construct Containing CFTR-Puro-EF1α-ClopHensor ... The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: Paragraph title: IF-GFP-ATRX construct generation ... Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H).

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. A construct with the sacB-cat fragment in the opposite orientation, pCM433r, was also obtained.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: Paragraph title: Plasmid constructs and expression ... The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmids were constructed (Additional file : Table S1, Additional file : Table S2) using yeast gap repair cloning [ ] or standard E. coli methods [ ]. .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs).

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: Plasmids for making deletions in H. volcanii were constructed by cloning upstream and downstream DNA fragments that flanked each deletion into pTA131 . .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: .. Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating. .. All restriction and DNA polymerase enzymes were from Fermentas and used according to the manufacturer's recommendations.

    Expression Vector:

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .


    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: Paragraph title: Plasmid constructs and expression ... The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna . .. Preliminary experiments using the resulting strains showed no significant growth defects upon depletion of cetZ gene expression by withdrawal of Trp during mid-log growth.


    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: For gap repair cloning, DNA was transformed into yeast via a modified Lazy Bones protocol [ , ] and assembled into a contiguous piece of DNA via yeast homologous recombination. .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs).

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: Production of infectious recombinant virus containing participant-derived RT sequences The full-length infectious HIV-1 clone pxxLAI was modified by site-directed mutagenesis to introduce silent mutations into RT at codons 321–323, 358, 417–418, 554 and in integrase at codons 29–31 to generate the unique restriction sites BstBI , MluI , HpaI , NgoMIV and SgrAI , respectively (pxxLAI-3D). .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function
    Article Snippet: The phenotype of wild-type and mutant strains was tested using various defined carbon and nitrogen substrates in modified DBCM2 medium which had yeast extract and peptone omitted. .. E. coli strain c2925 (dam, dcm ; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi , and was grown in Luria-Bertani medium with 100 μg mL−1 ampicillin.

    Transformation Assay:

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ). .. The minimum CFTR promoter (372 bp) was inserted into the newly created plasmid by digestion of both the plasmid and the PCR product with EcoRI and AgeI.

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H). ..

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. The 2.7 kb Xba I-Xma I fragment of pDS132 [ ] containing sacB and cat was then purified, blunted with Klenow enzyme, and ligated with the Msc I-digested pCM432 vector to generate pCM433 (see Figure ).

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: AGO2-WT and Y529E-AGO2 plasmids were transformed into DH5α competent bacteria (NEB). .. The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: For gap repair cloning, DNA was transformed into yeast via a modified Lazy Bones protocol [ , ] and assembled into a contiguous piece of DNA via yeast homologous recombination. .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs).

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA). .. Individual recombinant clones or bulk plasmid populations were isolated and DNA sequenced to confirm similarity with the RT sequences in the serum sample from which they were derived.

    Article Title: Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function
    Article Snippet: .. E. coli strain c2925 (dam, dcm ; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi , and was grown in Luria-Bertani medium with 100 μg mL−1 ampicillin. .. Construction of shuttle vector pJWID1 Plasmid pJWID1 was constructed by cloning the up-regulated mutant of the hmgA gene from Hfx. volcanii into the Hfx. volcanii -E. coli shuttle vector pIDJL40 .

    Derivative Assay:

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: To clone participant derived full-length RTs into pxxLAI-3DΔnp, the restriction enzyme sites BclI and SgrAI were first added to the 5′ and 3′ ends of genotyping amplicons using the primers: Bcl-forward ( 5′-GTTTTATCAAAGTAAGACAGTATGATCAGATAC-3′ ) and Sgr-reverse ( 5′- CTACCACCGGTGGCAGGTTA -3′ ). .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).


    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: Paragraph title: Electroporation transformation and 2,3-BDO strain selection ... Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. All PCR amplified regions were sequenced at the Dartmouth Molecular Biology Core Facility to verify PCR fidelity.


    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H). ..


    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: Construction of plasmids and generation of strains In order to generate the allelic exchange vector pCM433, the Km resistance cassette of pCM184 [ ] was excised with Nde I and Sac II, and the remaining 5.4 kb vector backbone was ligated together with a synthetic linker designed to introduce three additional, unique cloning sites into the final vector (Pst I, Xho I, and Not I). .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site.

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: Production of infectious recombinant virus containing participant-derived RT sequences The full-length infectious HIV-1 clone pxxLAI was modified by site-directed mutagenesis to introduce silent mutations into RT at codons 321–323, 358, 417–418, 554 and in integrase at codons 29–31 to generate the unique restriction sites BstBI , MluI , HpaI , NgoMIV and SgrAI , respectively (pxxLAI-3D). .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: .. Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating. .. All restriction and DNA polymerase enzymes were from Fermentas and used according to the manufacturer's recommendations.


    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C). .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H).

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. A series of constructs and strains were generated in order to test the ability of pCM433 to enable unmarked allelic exchange at three distinct loci in the M. extorquens AM1 chromosome.


    Article Title: Sources of artifact in measurements of 6mA and 4mC abundance in eukaryotic genomic DNA
    Article Snippet: Worms were grown on dam − dcm − bacteria (NEB C2925) on standard NGM plates in all experiments.


    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: The variant turboFP635 sequence had been adapted to the codon bias of B. pseudomallei and was preceded by a Spe I site and followed by an EcoR V site. .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: .. The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The plasmid was purified and linearized with ClaI restriction enzyme (NEB) and gel purified using Zymoclean gel DNA recovery kit.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: All PCR-generated fragments were sequence-verified after cloning. .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Binding Assay:

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. These two strains contain three tandem copies of the consensus p53 binding site upstream of the HIS3 and lacZ reporter genes, respectively.


    Article Title: AhR/Arnt:XRE interaction: Turning false negatives into true positives in the modified yeast one-hybrid assay
    Article Snippet: Escherichia coli SURE strain (Stop Unwanted Rearrangement Events, Stratagene, La Jolla, CA, USA) or dam − / dcm − C2925 (New England Biolabs) was used for standard cloning and rescue of plasmids from yeast cells. .. C2925 is a methyltransferase-deficient E. coli strain used for growth and purification of plasmids free of dam and dcm methylation; this allows cloning to be performed with dam - or dcm -sensitive restriction sites.

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. The 2.7 kb Xba I-Xma I fragment of pDS132 [ ] containing sacB and cat was then purified, blunted with Klenow enzyme, and ligated with the Msc I-digested pCM432 vector to generate pCM433 (see Figure ).

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. Purified DNAs from pML4.2 and pUC19 were linearized with AscI and EcoRI to generate molecules measuring 15,156 bp and 2,687 bp, respectively. pML4.2 was in vitro methylated using M.SssI, and the degree of methylation was confirmed using HhaI and DdeI ( ).

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: .. The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The plasmid was purified and linearized with ClaI restriction enzyme (NEB) and gel purified using Zymoclean gel DNA recovery kit.


    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: Production of infectious recombinant virus containing participant-derived RT sequences The full-length infectious HIV-1 clone pxxLAI was modified by site-directed mutagenesis to introduce silent mutations into RT at codons 321–323, 358, 417–418, 554 and in integrase at codons 29–31 to generate the unique restriction sites BstBI , MluI , HpaI , NgoMIV and SgrAI , respectively (pxxLAI-3D). .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function
    Article Snippet: The phenotype of wild-type and mutant strains was tested using various defined carbon and nitrogen substrates in modified DBCM2 medium which had yeast extract and peptone omitted. .. E. coli strain c2925 (dam, dcm ; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi , and was grown in Luria-Bertani medium with 100 μg mL−1 ampicillin.


    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment. .. The 4.1-kb fragment was treated with T4 DNA polymerase (Promega) according to the manufacturer's recommendations and re-ligated overnight at 15°C resulting in plasmid pBHR4 (CmR ).

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. All PCR amplified regions were sequenced at the Dartmouth Molecular Biology Core Facility to verify PCR fidelity.

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA). .. Individual recombinant clones or bulk plasmid populations were isolated and DNA sequenced to confirm similarity with the RT sequences in the serum sample from which they were derived.


    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. The 1xMBD1 probe was expressed in E. coli , purified and then labeled with an Alexa-488 dye (Invitrogen ) as described ( ).


    Article Title: AhR/Arnt:XRE interaction: Turning false negatives into true positives in the modified yeast one-hybrid assay
    Article Snippet: Escherichia coli SURE strain (Stop Unwanted Rearrangement Events, Stratagene, La Jolla, CA, USA) or dam − / dcm − C2925 (New England Biolabs) was used for standard cloning and rescue of plasmids from yeast cells. .. C2925 is a methyltransferase-deficient E. coli strain used for growth and purification of plasmids free of dam and dcm methylation; this allows cloning to be performed with dam - or dcm -sensitive restriction sites.

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. The 2.7 kb Xba I-Xma I fragment of pDS132 [ ] containing sacB and cat was then purified, blunted with Klenow enzyme, and ligated with the Msc I-digested pCM432 vector to generate pCM433 (see Figure ).

    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: .. pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. Purified DNAs from pML4.2 and pUC19 were linearized with AscI and EcoRI to generate molecules measuring 15,156 bp and 2,687 bp, respectively. pML4.2 was in vitro methylated using M.SssI, and the degree of methylation was confirmed using HhaI and DdeI ( ).

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The plasmid was purified and linearized with ClaI restriction enzyme (NEB) and gel purified using Zymoclean gel DNA recovery kit.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. Plasmid DNA was purified from E. coli using QIAGEN Miniprep Kit.

    Polymerase Chain Reaction:

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The CFTR channel and pH sensor contained in the plasmid pcDNA3-ClopHensor (Addgene, Cambridge, MA, ) were amplified by polymerase chain reaction (PCR) producing a 2.455-kb product. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. Following isolation, these colonies were then used for colony PCR to confirm the introduction of plasmids with correct pathway genes using the primers pBAD-GFP_F/R to check the insert size and gene-specific primers.

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: The PCR product was cloned into pBHR1-RFP via its Sac I/Spe I sites, resulting in plasmid pBHR1-groS-RFP (KmR , CmR ). .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The GFP variant mClover was PCR amplified with primers containing SV40-NLS from pNCS-mClover3 (Addgene).

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. All PCR amplified regions were sequenced at the Dartmouth Molecular Biology Core Facility to verify PCR fidelity.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: PCR products and pxxLAI-3DΔnp were digested with Bcl I and Sgr AI to form 1.89 kb full-length RT inserts and a 9.87 kb pxxLAI-3D cloning vector. .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: Standard PCR and cloning techniques were used to generate knock-out and complementation constructs as listed in using the primers listed in . .. Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating.

    Article Title: Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function
    Article Snippet: Paragraph title: Culture conditions, strains, plasmids and PCR primers ... E. coli strain c2925 (dam, dcm ; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi , and was grown in Luria-Bertani medium with 100 μg mL−1 ampicillin.


    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: Paragraph title: Electroporation transformation and 2,3-BDO strain selection ... Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The linearized plasmid and PCR fragments were combined using NEBuilder HIFI DNA assembly kit (NEB), transformed into competent E.coli (NEB) and grown on selection plates overnight.

    Plasmid Preparation:

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The pVLX-mCherry-C1 vector (Clontech Laboratories, Mountain View, CA, ) was similarly digested. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: Then the backbone pEGFP vector was added for a second ligation reaction. .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H).

    Article Title: AhR/Arnt:XRE interaction: Turning false negatives into true positives in the modified yeast one-hybrid assay
    Article Snippet: Escherichia coli SURE strain (Stop Unwanted Rearrangement Events, Stratagene, La Jolla, CA, USA) or dam − / dcm − C2925 (New England Biolabs) was used for standard cloning and rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 [ MATa, ura3-52, his3-200, ade2-101, lys2-801, leu2-3, 112, trp1-901, tyr1-501, gal4-Δ 512, gal80-Δ 538, ade5::hisG ] was purchased from Clontech (Palo Alto, CA, USA) and used for plasmid construction via homologous recombination and reporter strain construction.

    Article Title: Development of a broad-host-range sacB-based vector for unmarked allelic exchange
    Article Snippet: .. The resulting plasmid, pCM432, was then transformed into the dam dcm E. coli strain, C2925H (ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tc S endA1 rspL136 (Sm R ) dam13::Tn9 (Cm R ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2 , New England Biolabs), enabling digestion at an otherwise methylated, and therefore blocked, Msc I site. .. The 2.7 kb Xba I-Xma I fragment of pDS132 [ ] containing sacB and cat was then purified, blunted with Klenow enzyme, and ligated with the Msc I-digested pCM432 vector to generate pCM433 (see Figure ).

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment. .. The 4.1-kb fragment was treated with T4 DNA polymerase (Promega) according to the manufacturer's recommendations and re-ligated overnight at 15°C resulting in plasmid pBHR4 (CmR ).

    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: .. pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. Purified DNAs from pML4.2 and pUC19 were linearized with AscI and EcoRI to generate molecules measuring 15,156 bp and 2,687 bp, respectively. pML4.2 was in vitro methylated using M.SssI, and the degree of methylation was confirmed using HhaI and DdeI ( ).

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: Paragraph title: Plasmid constructs and expression ... The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. All PCR amplified regions were sequenced at the Dartmouth Molecular Biology Core Facility to verify PCR fidelity.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: Paragraph title: Strain and plasmid construction ... These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 MATa, ura3 – 52, his3 – 200, ade2 – 101, lys2 – 801, leu2 – 3, 112, trp1 – 901, tyr1 – 501, gal4 -Δ 512, gal80-Δ 538 , ade5::hisG ] was used for plasmid construction via homologous recombination and reporter strain construction.

    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: .. Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA). .. Individual recombinant clones or bulk plasmid populations were isolated and DNA sequenced to confirm similarity with the RT sequences in the serum sample from which they were derived.

    Article Title: Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function
    Article Snippet: .. E. coli strain c2925 (dam, dcm ; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi , and was grown in Luria-Bertani medium with 100 μg mL−1 ampicillin. .. Construction of shuttle vector pJWID1 Plasmid pJWID1 was constructed by cloning the up-regulated mutant of the hmgA gene from Hfx. volcanii into the Hfx. volcanii -E. coli shuttle vector pIDJL40 .


    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The NLS-AGO2 cloning procedure was designed using SnapGene software. .. The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence.


    Article Title: Zidovudine (AZT) Monotherapy Selects for the A360V Mutation in the Connection Domain of HIV-1 Reverse Transcriptase
    Article Snippet: Paragraph title: Production of infectious recombinant virus containing participant-derived RT sequences ... Vector and full-length RT inserts were ligated with T4 DNA ligase (NEB, Ipswich, MA) and transformed into C2925 cells (NEB, Ipswich, MA).

    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: Paragraph title: Recombinant DNA Techniques ... Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating.

    Sample Prep:

    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: Paragraph title: DNA and MBD1 Sample Preparation. ... pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit.

    In Vitro:

    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. Purified DNAs from pML4.2 and pUC19 were linearized with AscI and EcoRI to generate molecules measuring 15,156 bp and 2,687 bp, respectively. pML4.2 was in vitro methylated using M.SssI, and the degree of methylation was confirmed using HhaI and DdeI ( ).

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. In vitro DNA methylation was carried out according to manufacturer’s instructions using E. coli Dam methylase (New England Biolabs).


    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. Colonies with expected PCR bands pattern were selected and inoculated into RMGSp for preservation and further flask evaluation.


    Article Title: Pseudomonas aeruginosad-Arabinofuranose Biosynthetic Pathway and Its Role in Type IV Pilus Assembly *
    Article Snippet: .. Escherichia coli DH5α or the dam −/ dcm − strain C2925 (New England Biolabs) were used for cloning, whereas E. coli SM10 was used to introduce knock-out constructs into P. aeruginosa by biparental mating. .. All restriction and DNA polymerase enzymes were from Fermentas and used according to the manufacturer's recommendations.

    DNA Methylation Assay:

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs). .. In vitro DNA methylation was carried out according to manufacturer’s instructions using E. coli Dam methylase (New England Biolabs).

    Concentration Assay:

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).


    Article Title: Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel
    Article Snippet: pUC19 and pML4.2 were grown in dam-/dcm- Escherichia coli (New England Biolabs—C2925) and purified using a QIAGEN Plasmid Midi Kit. .. DNA was stained with TOTO-3 (Invitrogen) at a dye to base pair ratio of 1∶5.

    Variant Assay:

    Article Title: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
    Article Snippet: The variant turboFP635 sequence had been adapted to the codon bias of B. pseudomallei and was preceded by a Spe I site and followed by an EcoR V site. .. Firstly, unmethylated pBHR1 plasmid DNA isolated from a dcm - /dam - E. coli strain C2925 (New England Biolabs) was cut with Stu I/PpuM I, which resulted in a 1.2-kb fragment encompassing the kanamycin resistance cassette and a 4.1-kb plasmid backbone fragment.

    Article Title: Argonaute-miRNA Complexes Silence Target mRNAs in the Nucleus of Mammalian Stem Cells
    Article Snippet: The plasmids containing AGO2 sequence were grown up in the dam-/dcm competent E. coli (NEB) to remove methylation on the ClaI restriction site sequence. .. The GFP variant mClover was PCR amplified with primers containing SV40-NLS from pNCS-mClover3 (Addgene).

    Homologous Recombination:

    Article Title: AhR/Arnt:XRE interaction: Turning false negatives into true positives in the modified yeast one-hybrid assay
    Article Snippet: Escherichia coli SURE strain (Stop Unwanted Rearrangement Events, Stratagene, La Jolla, CA, USA) or dam − / dcm − C2925 (New England Biolabs) was used for standard cloning and rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 [ MATa, ura3-52, his3-200, ade2-101, lys2-801, leu2-3, 112, trp1-901, tyr1-501, gal4-Δ 512, gal80-Δ 538, ade5::hisG ] was purchased from Clontech (Palo Alto, CA, USA) and used for plasmid construction via homologous recombination and reporter strain construction.

    Article Title: Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum
    Article Snippet: For gap repair cloning, DNA was transformed into yeast via a modified Lazy Bones protocol [ , ] and assembled into a contiguous piece of DNA via yeast homologous recombination. .. Plasmid DNA was isolated from yeast using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA) and introduced via electroporation into E. coli Top10 (dam +dcm +E. coli K12 derivative from Invitrogen, Carlsbad, CA) and via chemical competence into E. coli BL21 (DE3) (dam +dcm - E. coli B derivative; New England Biolabs, Ipswich, MA) and E. coli C2925 (dam - dcm - E. coli K12 derivative; New England Biolabs).

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 MATa, ura3 – 52, his3 – 200, ade2 – 101, lys2 – 801, leu2 – 3, 112, trp1 – 901, tyr1 – 501, gal4 -Δ 512, gal80-Δ 538 , ade5::hisG ] was used for plasmid construction via homologous recombination and reporter strain construction.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs dam dcm competent e coli
    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − <t>/dcm</t> − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).
    Dam Dcm Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam dcm competent e coli/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    dam dcm competent e coli - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    New England Biolabs dcm mutant e coli er2925
    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − <t>/dcm</t> − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).
    Dcm Mutant E Coli Er2925, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dcm mutant e coli er2925/product/New England Biolabs
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dcm mutant e coli er2925 - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    Image Search Results

    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − /dcm − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Journal: Current protocols in microbiology

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis

    doi: 10.1002/cpmc.31

    Figure Lengend Snippet: Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − /dcm − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Article Snippet: pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A.

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Construct, Homologous Recombination, Selection, Marker, Transformation Assay