biotin 14 datp  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Biotin 14 dATP
    Description:
    Biotin 14 dATP is a patented dATP analog with biotin attached at the 6 position of the purine base by a 14 atom linker The long 14 atom spacer arm allows accessibility to streptavidin for sensitive detection of probe target hybrids in in situ and filter based hybridizations Biotin 14 dATP can be efficiently incorporated into DNA by nick translation in the presence of dCTP dGTP and dTTP 1 Biotin 14 dATP can be added to the 3 end of DNA using terminal deoxynucleotidyl transferase 2 The amount supplied is sufficient for labeling up to 50 µg of DNA by nick translation Performance and Quality Testing Purity is evaluated by reverse phase HPLC analysis
    Catalog Number:
    19524016
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|DNA Labeling|Nucleic Acid Labeling & Oligo Synthesis
    Category:
    Oligos Primers Probes Nucleotides
    Buy from Supplier


    Structured Review

    Thermo Fisher biotin 14 datp
    Biotin 14 dATP is a patented dATP analog with biotin attached at the 6 position of the purine base by a 14 atom linker The long 14 atom spacer arm allows accessibility to streptavidin for sensitive detection of probe target hybrids in in situ and filter based hybridizations Biotin 14 dATP can be efficiently incorporated into DNA by nick translation in the presence of dCTP dGTP and dTTP 1 Biotin 14 dATP can be added to the 3 end of DNA using terminal deoxynucleotidyl transferase 2 The amount supplied is sufficient for labeling up to 50 µg of DNA by nick translation Performance and Quality Testing Purity is evaluated by reverse phase HPLC analysis
    https://www.bioz.com/result/biotin 14 datp/product/Thermo Fisher
    Average 90 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    biotin 14 datp - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: The PCR product was cloned into a pCR2.1 vector for amplification (TOPO cloning kit, Invitrogen). .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The positive clones were sequenced on an ABI Prism 377 DNA sequencer (Perkin Elmer, Branchburg, NJ, USA) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Branchburg, NJ, USA). .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Centrifugation:

    Article Title: ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
    Article Snippet: After incubating at 22°C for 2 h, samples were placed on ice for 10 min, and chromatin was isolated by centrifugation through a 30%-sucrose cushion in XBE2 at 10,000 rpm for 15 min (Sorval HB-4 rotor; DuPont, Wilmington, DE; ). .. To visualize the efficiency of DNA replication, biotin-14-dATP (GIBCO-BRL) was added at a final concentration of 4 μM.

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The plasmid was restriction digested with EcoRI, XbaI, DraI and HindIII, and the positioning array purified by polyethylene glycol (PEG) precipitation using 0.5% incremental increases in PEG concentration, each with a 10 minute, 5,000 × g centrifugation. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    Amplification:

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: 18S rDNA units were amplified according to from total genomic DNA extracted from Caluromys philander liver tissues (heterologous probe), “all human telomeric probes” were obtained according . .. Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen).

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: The PCR product was cloned into a pCR2.1 vector for amplification (TOPO cloning kit, Invitrogen). .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: Paragraph title: 2.3. Amplification of SatDNAs through PCR, Probes and Fluorescence In Situ Hybridization ... The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: A PCR-generated amplicon (~500 bp) was isolated from a gel, purified with the Sephaglas Band Prep Kit (Pharmacia Biotech, Orsay, France) and ligated into the pGEM-T plasmid (Promega, Heidelberg, Germany). .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min. .. ABC-Elite reagent (Vector Laboratories) was used for signal amplification.

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Hybridization was detected with avidin-FITC and the signals were amplified with biotinylated anti-avidin.

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: Copies of the 18S rRNA gene from O. niloticus were amplified using the primers 18Sf (5′ CCG CTT TGG TGA CTC TTG AT) and 18Sr (5′CCG AGG ACC TCA CTA AAC CA), which were designed based upon the sequence of the catfish Ictalurus punctatus to amplify an approximately 1,400 bp DNA segment of the 18S rRNA gene [ ]. .. PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer.

    Electrophoresis:

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The PCR products were visualized on a 1% electrophoresis agarose gel. .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Incubation:

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen). .. Following immunostainin g, slides were dehydrated in ethanol series and incubated in 1 mM EDTA (pH 8.0) for 20 min.

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen). .. The metaphase chromosome slides were incubated with RNAse (40 μg/ml) for 1.5 h at 37°C.

    Article Title: ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
    Article Snippet: When required, half a volume of mitotic HSS was added to the interphase assembly mixture to convert the cell cycle state into mitosis and incubated at 22°C for another 90 min (e.g., Figure B). .. To visualize the efficiency of DNA replication, biotin-14-dATP (GIBCO-BRL) was added at a final concentration of 4 μM.

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min. ..

    Formalin-fixed Paraffin-Embedded:

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: TUNEL staining was performed on 4-μm formalin-fixed paraffin-embedded tissue sections. .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min.

    Hybridization:

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. In situ fluorescent hybridization was based on protocols described by and , with modifications.

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: Paragraph title: In Situ Hybridization/Proximity Ligation Assay (ISH-PLA) ... Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA). .. Images were obtained using a DP71 cooled digital camera in grayscale and then pseudo-colored in blue for chromosomes and red or green for hybridization signals, merged and optimized for brightness and contrast using Adobe Photoshop CS6.

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping. .. The hybridization signals were detected using appropriate antibody sets based on anti-avidin, which was followed by the application of avidin-FITC to enhance the signals of the biotin-labeled probes.

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: Paragraph title: 2.3. Chromosome Hybridization Probes ... The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen).

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen). .. Hybridization mixtures containing 100 ng of denatured probe, 10 mg/ml dextran sulfate, 2× SSC, and 50% formamide in a final volume of 30 μl were dropped on the slides, and the hybridization was performed overnight at 37°C in a 2× SSC moist chamber.

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Hybridization was detected with avidin-FITC and the signals were amplified with biotinylated anti-avidin.

    TUNEL Assay:

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: TUNEL staining was performed on 4-μm formalin-fixed paraffin-embedded tissue sections. .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min.

    Ligation:

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: Paragraph title: In Situ Hybridization/Proximity Ligation Assay (ISH-PLA) ... Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Genomic Sequencing:

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The nucleotide sequence was subjected to Blastn [ ] searches at the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/blast for the identification of any similarity of the isolated sequences to any known sequences from the nucleotide collection (nt/nr), whole-genome shotgun reads (WGS), genomic survey sequences (GSS) and high-throughput genomic sequences (HTGS) in GenBank. .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Nick Translation:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Fluorescence in situ hybridization The plasmid containing the 18S rRNA gene, the PCR products from the histone H3 gene and the C 0 t -1 DNA fraction were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA). .. Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: .. Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. In situ fluorescent hybridization was based on protocols described by and , with modifications.

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen). .. Following immunostainin g, slides were dehydrated in ethanol series and incubated in 1 mM EDTA (pH 8.0) for 20 min.

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: .. The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping. .. The hybridization signals were detected using appropriate antibody sets based on anti-avidin, which was followed by the application of avidin-FITC to enhance the signals of the biotin-labeled probes.

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: .. The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen). .. The telomeric DNA sequence (TTAGGG)n was also used as a probe.

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: .. The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen). .. The metaphase chromosome slides were incubated with RNAse (40 μg/ml) for 1.5 h at 37°C.

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: .. Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. SatDNAs with less than 50 bp were labeled directly at the 5′ end with biotin-14 dATP (Sigma-Aldrich, St Louis, MO, USA) during their synthesis.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA). .. The 18S rDNA and Rex3 probes were labeled by nick translation with DIG-11-dUTP according to the manufacturer's instructions (Roche, Mannheim, Germany).

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: .. The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Hybridization was detected with avidin-FITC and the signals were amplified with biotinylated anti-avidin.

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: .. PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer. .. For FISH on the African and Asian cichlid samples, the 5S rDNA and the 18S rDNA obtained from O. niloticus were use as probes.

    Light Microscopy:

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Metaphase chromosomes were counterstained with DAPI and analyzed under optical light microscope (Olympus BX61).

    Generated:

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen). .. Following immunostainin g, slides were dehydrated in ethanol series and incubated in 1 mM EDTA (pH 8.0) for 20 min.

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen). .. This probe was generated by PCR (PCR DIG-Probe Synthesis Kit, Roche) in the absence of template using (TTAGGG)5 and (CCCTAA)5 as primers (Ijdo et al. [ ]).

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA). .. A probe from the telomeric DNA sequence (TTAGGG)n was generated by PCR (PCR DIG-Probe Synthesis Kit, Roche) in the absence of a template using (TTAGGG)5 and (CCCTAA)5 as primers [ ].

    Sequencing:

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen). .. The telomeric DNA sequence (TTAGGG)n was also used as a probe.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The nucleotide sequence was subjected to Blastn [ ] searches at the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/blast for the identification of any similarity of the isolated sequences to any known sequences from the nucleotide collection (nt/nr), whole-genome shotgun reads (WGS), genomic survey sequences (GSS) and high-throughput genomic sequences (HTGS) in GenBank. .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: Copies of the 18S rRNA gene from O. niloticus were amplified using the primers 18Sf (5′ CCG CTT TGG TGA CTC TTG AT) and 18Sr (5′CCG AGG ACC TCA CTA AAC CA), which were designed based upon the sequence of the catfish Ictalurus punctatus to amplify an approximately 1,400 bp DNA segment of the 18S rRNA gene [ ]. .. PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer.

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: In brief, puC18 containing 19 repeats of the ‘601’ nucleosome positioning sequence ( ) was purified with a Gigaprep kit (QIAGEN) from SURE2 bacteria grown in Luria Broth media. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    Binding Assay:

    Article Title: Disruption of Histone Modification and CARM1 Recruitment by Arsenic Represses Transcription at Glucocorticoid Receptor-Regulated Promoters
    Article Snippet: .. Magnetic Bead DNA A 1.8 kb Sph1/Nco1 fragment of the MMTV LTR from the pGEM3ZFM-LTRCAT plasmid that includes Nucs A-F of the MMTV promoter, was biotinylated (20 ug DNA fragment, 1x Klenow Buffer, 1 mM MgCl2 , 50 µM each dTTP aS, dGTP aS, dCTP aS (Axxora, San Diego, CA), 18 µM Biotin-14-dATP (Invitrogen Carlsbad, California), 10 U Klenow (Invitrogen, Carlsbad, California) at 25°C for 15 min and attached to streptavidin-coated magnetic beads using the Dynabead Kilobase Binder Kit (Dynal Biotech, Lake Success, NY) in 200 µl Kit binding buffer as described by Fletcher et al . ..

    DNA Extraction:

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: Paragraph title: DNA extraction, isolation of 5S and 18S rRNA gene sequences, and FISH ... PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer.

    Fluorescence:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Paragraph title: Fluorescence in situ hybridization ... Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: Paragraph title: 2.3. Amplification of SatDNAs through PCR, Probes and Fluorescence In Situ Hybridization ... The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: FISH procedure, sequential Ag-NOR detection and karyotype analysis Fluorescence in situ hybridization (FISH) was performed on mitotic chromosome spreads [ ]. .. The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen).

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: .. Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. SatDNAs with less than 50 bp were labeled directly at the 5′ end with biotin-14 dATP (Sigma-Aldrich, St Louis, MO, USA) during their synthesis.

    Magnetic Beads:

    Article Title: Disruption of Histone Modification and CARM1 Recruitment by Arsenic Represses Transcription at Glucocorticoid Receptor-Regulated Promoters
    Article Snippet: .. Magnetic Bead DNA A 1.8 kb Sph1/Nco1 fragment of the MMTV LTR from the pGEM3ZFM-LTRCAT plasmid that includes Nucs A-F of the MMTV promoter, was biotinylated (20 ug DNA fragment, 1x Klenow Buffer, 1 mM MgCl2 , 50 µM each dTTP aS, dGTP aS, dCTP aS (Axxora, San Diego, CA), 18 µM Biotin-14-dATP (Invitrogen Carlsbad, California), 10 U Klenow (Invitrogen, Carlsbad, California) at 25°C for 15 min and attached to streptavidin-coated magnetic beads using the Dynabead Kilobase Binder Kit (Dynal Biotech, Lake Success, NY) in 200 µl Kit binding buffer as described by Fletcher et al . ..

    Isolation:

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The monomeric bands were isolated and purified using the Zymoclean™ Gel DNA Recovery Kit (Zymo Research Corp., The Epigenetics Company, CA, USA) according to the manufacturer’s recommendations and then used as template for reamplification using the same PCR conditions. .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: Chromosome Hybridization Probes Two tandem-arrayed DNA sequences isolated from the Hoplias malabaricus (Teleostei, Characiformes) genome were used. .. The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen).

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The nucleotide sequence was subjected to Blastn [ ] searches at the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/blast for the identification of any similarity of the isolated sequences to any known sequences from the nucleotide collection (nt/nr), whole-genome shotgun reads (WGS), genomic survey sequences (GSS) and high-throughput genomic sequences (HTGS) in GenBank. .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
    Article Snippet: After incubating at 22°C for 2 h, samples were placed on ice for 10 min, and chromatin was isolated by centrifugation through a 30%-sucrose cushion in XBE2 at 10,000 rpm for 15 min (Sorval HB-4 rotor; DuPont, Wilmington, DE; ). .. To visualize the efficiency of DNA replication, biotin-14-dATP (GIBCO-BRL) was added at a final concentration of 4 μM.

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: Paragraph title: DNA extraction, isolation of 5S and 18S rRNA gene sequences, and FISH ... PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer.

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs). .. The repeating unit of the 12 × LacO positive array is AGCTTGGATC TCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGCAAGCT CTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGA TTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT CCTCGAGC AATTGT GAGCGGCTCACAATT CGTCCCTATCAGTGATAGAGACTAGTTTCGTTGGAAACGGGA CTGA, with the nucleosome positioning ‘601’ site underlined and the LacO site italicized. pCS2 plasmid containing 12 × LacO positive array (ASP 3317) was digested with BamHI, HaeII and DraI and the array was isolated by PEG precipitation and biotinylated as above for the19 × 601 array.

    Avidin-Biotin Assay:

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping. .. The hybridization signals were detected using appropriate antibody sets based on anti-avidin, which was followed by the application of avidin-FITC to enhance the signals of the biotin-labeled probes.

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Hybridization was detected with avidin-FITC and the signals were amplified with biotinylated anti-avidin.

    Labeling:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: .. Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen). .. The preparations were counterstained using 4′, 6-diamidine-2′-phenylindole dihydrochloride (DAPI) and mounted using Vectashield (Vector, Burlingame, CA, USA).

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: .. Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. In situ fluorescent hybridization was based on protocols described by and , with modifications.

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA). .. The preparations were counterstained using 4′,6-diamidine-2′-phenylindole (DAPI) and mounted in VECTASHIELD (Vector, Burlingame, CA, USA).

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: .. The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping. .. The hybridization signals were detected using appropriate antibody sets based on anti-avidin, which was followed by the application of avidin-FITC to enhance the signals of the biotin-labeled probes.

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: .. The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen). .. The telomeric DNA sequence (TTAGGG)n was also used as a probe.

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: .. The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen). .. The metaphase chromosome slides were incubated with RNAse (40 μg/ml) for 1.5 h at 37°C.

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: .. Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. SatDNAs with less than 50 bp were labeled directly at the 5′ end with biotin-14 dATP (Sigma-Aldrich, St Louis, MO, USA) during their synthesis.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA). .. The 18S rDNA and Rex3 probes were labeled by nick translation with DIG-11-dUTP according to the manufacturer's instructions (Roche, Mannheim, Germany).

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min. ..

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: .. The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. Hybridization was detected with avidin-FITC and the signals were amplified with biotinylated anti-avidin.

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: .. PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer. .. For FISH on the African and Asian cichlid samples, the 5S rDNA and the 18S rDNA obtained from O. niloticus were use as probes.

    Purification:

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The monomeric bands were isolated and purified using the Zymoclean™ Gel DNA Recovery Kit (Zymo Research Corp., The Epigenetics Company, CA, USA) according to the manufacturer’s recommendations and then used as template for reamplification using the same PCR conditions. .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: A PCR-generated amplicon (~500 bp) was isolated from a gel, purified with the Sephaglas Band Prep Kit (Pharmacia Biotech, Orsay, France) and ligated into the pGEM-T plasmid (Promega, Heidelberg, Germany). .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The plasmid was restriction digested with EcoRI, XbaI, DraI and HindIII, and the positioning array purified by polyethylene glycol (PEG) precipitation using 0.5% incremental increases in PEG concentration, each with a 10 minute, 5,000 × g centrifugation. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: The 5S rDNA, U snDNAs (U1, U2) and telomeric probes were PCR labeled with digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: The PCR product was cloned into a pCR2.1 vector for amplification (TOPO cloning kit, Invitrogen). .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: Paragraph title: 2.3. Amplification of SatDNAs through PCR, Probes and Fluorescence In Situ Hybridization ... The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses
    Article Snippet: The second probe corresponded to a 1,400 bp segment of the 18S rRNA gene obtained via PCR from nuclear DNA (Cioffi et al. [ ]). .. The 18S rDNA probe was labeled by nick translation with DIG-11-dUTP, according to the manufacturer's specifications (Roche) and the 5S rDNA probe was labeled with biotin-14-dATP by nick translation, also according to the manufacturer's specifications (Bionick Labelling System, Invitrogen).

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: .. Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. SatDNAs with less than 50 bp were labeled directly at the 5′ end with biotin-14 dATP (Sigma-Aldrich, St Louis, MO, USA) during their synthesis.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: A PCR-generated amplicon (~500 bp) was isolated from a gel, purified with the Sephaglas Band Prep Kit (Pharmacia Biotech, Orsay, France) and ligated into the pGEM-T plasmid (Promega, Heidelberg, Germany). .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen). .. The 18S probe was labeled with digoxigenin 11-dUTP (Roche Applied Sciences) by PCR (Polymerase Chain Reaction) and hybridization signals were detected using anti-digoxigenin-rhodamine.

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: .. PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer. .. For FISH on the African and Asian cichlid samples, the 5S rDNA and the 18S rDNA obtained from O. niloticus were use as probes.

    Microscopy:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen). .. The chromosomes and FISH signals were observed using an Olympus microscope BX61 equipped with a fluorescence lamp and appropriate filters.

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. Hybridized chromosomes were analyzed using an Olympus BX 51 microscope and the images were captured with a digital camera (Olympus DP70), using the Image-Pro MC 6.0 software.

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA). .. FISH results were observed using an Olympus microscope BX61 (Tokyo, Japan) equipped with a fluorescent lamp and the proper filters.

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping. .. The chromosomes were counterstained with DAPI, mounted with antifade solution, and observed using an Olympus BX51 microscope coupled to an Olympus digital camera (model D71).

    In Situ Hybridization:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Paragraph title: Fluorescence in situ hybridization ... Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: Paragraph title: In Situ Hybridization/Proximity Ligation Assay (ISH-PLA) ... Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: Paragraph title: 2.3. Amplification of SatDNAs through PCR, Probes and Fluorescence In Situ Hybridization ... The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: FISH procedure, sequential Ag-NOR detection and karyotype analysis Fluorescence in situ hybridization (FISH) was performed on mitotic chromosome spreads [ ]. .. The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen).

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: .. Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. SatDNAs with less than 50 bp were labeled directly at the 5′ end with biotin-14 dATP (Sigma-Aldrich, St Louis, MO, USA) during their synthesis.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA). .. Fluorescent in situ hybridization (FISH) was performed under high stringency conditions on mitotic chromosome spreads [ ].

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: Mapping of the ribosomal DNA (rDNA) was performed by fluorescent in situ hybridization (FISH) according to . .. The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen).

    Plasmid Preparation:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Fluorescence in situ hybridization The plasmid containing the 18S rRNA gene, the PCR products from the histone H3 gene and the C 0 t -1 DNA fraction were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA). .. Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: The PCR product was cloned into a pCR2.1 vector for amplification (TOPO cloning kit, Invitrogen). .. Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA). .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Disruption of Histone Modification and CARM1 Recruitment by Arsenic Represses Transcription at Glucocorticoid Receptor-Regulated Promoters
    Article Snippet: .. Magnetic Bead DNA A 1.8 kb Sph1/Nco1 fragment of the MMTV LTR from the pGEM3ZFM-LTRCAT plasmid that includes Nucs A-F of the MMTV promoter, was biotinylated (20 ug DNA fragment, 1x Klenow Buffer, 1 mM MgCl2 , 50 µM each dTTP aS, dGTP aS, dCTP aS (Axxora, San Diego, CA), 18 µM Biotin-14-dATP (Invitrogen Carlsbad, California), 10 U Klenow (Invitrogen, Carlsbad, California) at 25°C for 15 min and attached to streptavidin-coated magnetic beads using the Dynabead Kilobase Binder Kit (Dynal Biotech, Lake Success, NY) in 200 µl Kit binding buffer as described by Fletcher et al . ..

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: This plasmid was used to transform DH5α E. coli competent cells (Invitrogen, San Diego, CA, USA). .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min. .. ABC-Elite reagent (Vector Laboratories) was used for signal amplification.

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The plasmid was restriction digested with EcoRI, XbaI, DraI and HindIII, and the positioning array purified by polyethylene glycol (PEG) precipitation using 0.5% incremental increases in PEG concentration, each with a 10 minute, 5,000 × g centrifugation. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    Software:

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. Hybridized chromosomes were analyzed using an Olympus BX 51 microscope and the images were captured with a digital camera (Olympus DP70), using the Image-Pro MC 6.0 software.

    Recombinant:

    Article Title: ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
    Article Snippet: To visualize the efficiency of DNA replication, biotin-14-dATP (GIBCO-BRL) was added at a final concentration of 4 μM. .. To convert the cell cycle state of the extract into mitosis, half a volume of mitotic LSS or recombinant cyclin B Δ90 was added ( ).

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs). .. Reconstituted chromatin containing recombinant nucleosomes was prepared at 2 µM nucleosome concentration by salt dialysis as previously described( ).

    Agarose Gel Electrophoresis:

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: The PCR products were visualized on a 1% electrophoresis agarose gel. .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    In Situ:

    Article Title: Karyological analysis of Proechimys cuvieri and Proechimys guyannensis (Rodentia, Echimyidae) from central Amazon
    Article Snippet: Probe labeling was with biotin-14-dATP by nick translation (BioNick Labeling System, Invitrogen). .. In situ fluorescent hybridization was based on protocols described by and , with modifications.

    Article Title: Activation of the ESC pluripotency factor OCT4 in smooth muscle cells is atheroprotective
    Article Snippet: Paragraph title: In Situ Hybridization/Proximity Ligation Assay (ISH-PLA) ... Probes were generated by Nick Translation (Roche) using biotin-14-dATP (Invitrogen).

    Ethanol Precipitation:

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: PEG precipitations with 19 × 601 DNA were dialyzed into TE buffer (10 mM Tris, pH 8 and 0.5 mM EDTA) and concentrated by ethanol precipitation. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    Concentration Assay:

    Article Title: ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
    Article Snippet: .. To visualize the efficiency of DNA replication, biotin-14-dATP (GIBCO-BRL) was added at a final concentration of 4 μM. .. To convert the cell cycle state of the extract into mitosis, half a volume of mitotic LSS or recombinant cyclin B Δ90 was added ( ).

    Article Title: Xenopus laevis M18BP1 directly binds existing CENP-A nucleosomes to promote centromeric chromatin assembly
    Article Snippet: The plasmid was restriction digested with EcoRI, XbaI, DraI and HindIII, and the positioning array purified by polyethylene glycol (PEG) precipitation using 0.5% incremental increases in PEG concentration, each with a 10 minute, 5,000 × g centrifugation. .. The EcoRI overhangs were filled with biotin-14-dATP (Invitrogen), dCTP, α-thiο-dGTP, and α-thio-dTTP (ChemCyte) using Klenow fragment 3’-5’ exo- (New England Biolabs).

    End Labeling:

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: TdT-mediated dUTP nick end labeling (TUNEL) staining was utilized to determine whether apoptosis occurred following exposure to ADR. .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min.

    High Throughput Screening Assay:

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The nucleotide sequence was subjected to Blastn [ ] searches at the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/blast for the identification of any similarity of the isolated sequences to any known sequences from the nucleotide collection (nt/nr), whole-genome shotgun reads (WGS), genomic survey sequences (GSS) and high-throughput genomic sequences (HTGS) in GenBank. .. The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA).

    Staining:

    Article Title: CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo
    Article Snippet: TUNEL staining was performed on 4-μm formalin-fixed paraffin-embedded tissue sections. .. Following incubation in One-Phor-All buffer (GE Healthcare, Piscataway, NJ), fragmented DNA was labeled by exposure of sections to diluted TdT (GE Healthcare) and biotin-14-dATP (Invitrogen, Grand Island, NY) for 60 min.

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The chromosomal location of active nucleolus organizer regions (NORs) was detected using the silver nitrate staining technique ( ). .. The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen).

    Fluorescence In Situ Hybridization:

    Article Title: Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences
    Article Snippet: Although some two-color FISH assays were performed, the same metaphase is shown separately for each probe. .. Probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin-rhodamine (Roche), and probes labeled with biotin-14-dATP were detected using streptavidin, alexa fluor 488 conjugate (Invitrogen).

    Article Title: Satellite DNAs Unveil Clues about the Ancestry and Composition of B Chromosomes in Three Grasshopper Species
    Article Snippet: FISH was performed in meiotic chromosomes using one or two probes according to a method described previously [ ] with some adjustments as outlined previously [ ]. .. The probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche, Mannheim, Germany), and probes labeled with biotin-14-dATP were detected using Streptavidin Alexa Fluor 488-conjugated (Invitrogen, San Diego, CA, USA).

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: Paragraph title: FISH and chromosome analysis ... The probes were labeled via nick translation with biotin-14-dATP (Invitrogen) to facilitate chromosomal mapping.

    Article Title: Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus
    Article Snippet: Paragraph title: FISH procedure, sequential Ag-NOR detection and karyotype analysis ... The probes were labeled by nick translation with biotin-14-dATP (Bionick labeling system-Invitrogen).

    Article Title: Uncovering the evolutionary history of neo-XY sex chromosomes in the grasshopper Ronderosia bergii (Orthoptera, Melanoplinae) through satellite DNA analysis
    Article Snippet: Probes and Fluorescence In situ Hybridization, measurement of sex chromosomes and distance between signals The PCR products for each satDNA family with more than 50 bp were labeled by nick translation using biotin-14-dATP (Invitrogen) or digoxigenin-11-dUTP (Roche, Mannheim, Germany). .. For single or two-color FISH the protocols proposed Pinkel et al. [ ] with modifications [ ] were followed using mitotic chromosome preparations.

    Article Title: Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish
    Article Snippet: The 5S rDNA probe was labeled with biotin-14-dATP by nick translation according to the manufacturer's recommendations (BioNick™Labeling System; Invitrogen, San Diego, CA, USA). .. Fluorescent in situ hybridization (FISH) was performed under high stringency conditions on mitotic chromosome spreads [ ].

    Article Title: Three sympatric karyomorphs in the fishAstyanax fasciatus (Teleostei, Characidae) do not seem to hybridize in natural populations
    Article Snippet: The 18S and 5S rDNA probes were obtained from the fish Prochilodus argenteus Spix and Agassiz, 1829 ( ) and Leporinus elongatus Valenciennes, 1850 , respectively. .. The 5SS probe was labeled with biotin 14-dATP by nick translation following manufacturer’s instructions (Bionick Labelling System - Invitrogen).

    Article Title: Evolutionary dynamics of rRNA gene clusters in cichlid fish
    Article Snippet: Paragraph title: DNA extraction, isolation of 5S and 18S rRNA gene sequences, and FISH ... PCR products were labeled by nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) according to the specifications of the manufacturer.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher biotin 14 datp
    Biotin 14 Datp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotin 14 datp/product/Thermo Fisher
    Average 90 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    biotin 14 datp - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results